id_rna sequence raw_count mapping_loci
ath-miR-156a TGACAGAAGAGAGTGAGCAC 3755 6
ath-miR-156a TGACAGAAGAGAGTGAGCACA 145 6
ath-miR-156a TACAGAAGAGAGTGAGCAC 16 7
ath-miR-156a TGACAGAAGAGTGTGAGCAC 9 6
ath-miR-156a TGACAGAAGAGAGTGAACAC 6 6
ath-miR-156a TGCCAGAAGAGAGTGAGCAC 3 6
ath-miR-156a TGACAGAAGCGAGTGAGCAC 3 6
ath-miR-156a TACAGAAGAGAGTGAGCAT 2 10
ath-miR-156a TGACAGAATAGAGTGAGCAC 9 6
ath-miR-156a TGACAGAAGATAGTGAGCAC 12 10
ath-miR-156a TGACAGAAGAGAGTGACCAC 5 6
ath-miR-156a TGACAGAACAGAGTGAGCAC 7 6
ath-miR-156a TGCAGAAGAGAGTGAGCAC 2 10
ath-miR-156a TGACAGAAGAGAGTGAG 2 6
ath-miR-156a TGACAGAAGAGGGTGAGCAC 3 6
ath-miR-156a TGACAGAAGAGAGTGAGCACC 7 7
ath-miR-156a TGACAGAAGAGAGTGAGCACG 2 8
ath-miR-156a TGACAGAAGAGAGTGAGCACT 10 7
ath-miR-156a TGACAGAAGAGAGCGAGCAC 8 14
ath-miR-156a GACAGAAGAGAGTGAGCAC 6 7
ath-miR-156a ATGACAGAAGAGAGTGAGCAC 2 8
ath-miR-156a TGACAGAAGAGAGTGAGCAAG 2 9
ath-miR-156a GGACAGAAGAGAGTGAGCAC 10 7
ath-miR-156a TGACAGAAGAGAGTGATCAC 14 6
ath-miR-156a TGACATAAGAGAGTGAGCAC 5 6
ath-miR-156a TGATAGAAGAGAGTGAGCAC 9 6
ath-miR-156a TGACAGAAGAGCGTGAGCAC 12 6
ath-miR-156a TGACAAAAGAGAGTGAGCAC 3 6
ath-miR-156a TGACAGAAGAGACTGAGCAC 12 6
ath-miR-156a GACAGAAGAGAGTGAGCACA 2 7
ath-miR-156a TCACAGAAGAGAGTGAGCAC 8 6
ath-miR-156a TGACAGAAGAGAGGGAGCAC 9 14
ath-miR-156a TTACAGAAGAGAGTGAGCACA 2 6
ath-miR-156a TGACAGACGAGAGTGAGCAC 4 6
ath-miR-156a TGACAGAAGAGAGTGAGCA 51 6
ath-miR-156a TGACAGAAGAGCGTGCGCAC 3 6
ath-miR-156a TGACAGAAGAGAGTGAGC 5 6
ath-miR-156a TGACAGAAGAGAGCGCGCAC 2 14
ath-miR-156a TGACAGGAGAGAGTGAGCAC 3 6
ath-miR-156a TGACAGAAGACAGTGAGCAC 9 6
ath-miR-156a TGACAGAAGAGAG 3 26
ath-miR-156a TGACAGAAGAGAGTGAGCTC 3 6
ath-miR-156a TGAAAGAAGAGAGTGAGCAC 3 6
ath-miR-156a TGAAAGAAGAGAGTGAGCAT 2 7
ath-miR-156a TGACAGAAGAGATTGAGCAC 34 6
ath-miR-156a TGACAGAAGAGAGTGCGCAC 6 6
ath-miR-156a TGACAGAAGAGAGTGAGGAC 2 6
ath-miR-156a TAACAGAAGAGAGTGAGCAC 2 6
ath-miR-156a TGACAGAAGAGAGTGAGAAC 5 6
ath-miR-156a TGACAGAAGAGAGTGAGAAA 2 11
ath-miR-156a TGACAGAAGAGAGTGAGTAC 9 6
ath-miR-156a TGACAGAAGAGAGTTAGCAC 8 6
ath-miR-156a TGACAGAAGAGAGTGAGCAA 15 7
ath-miR-156a ACAGAAGAGAGTGAGCAC 8 7
ath-miR-156a TGACAGAAAAGAGTGAGCAC 4 6
ath-miR-156a CTGACAGAAGAGAGTGAGCAC 3 3
ath-miR-156a TGACAGAAGAGAGTGAGCCC 9 6
ath-miR-156a TGACAGAAGAGAGTGTGCAC 2 6
ath-miR-156a TGACAGAAGAGAGTAAGCAC 5 7
ath-miR-156a TTACAGAAGAGAGTGAGCAC 21 6
ath-miR-156a TGACAGAAGAGAGTGGGCAC 3 6
ath-miR-156a TGACAGAAGAGAGTCAGCAC 5 6
ath-miR-156a TGACAGAAGAGAGTGAGCAT 49 6