id_rna sequence raw_count mapping_loci
ath-miR-156b TGACAGAAGAGAGTGAGCAC 3755 6
ath-miR-156b TGACAGAAGAGAGTGAGCACA 145 6
ath-miR-156b TACAGAAGAGAGTGAGCAC 16 7
ath-miR-156b TGACAGAAGAGTGTGAGCAC 9 6
ath-miR-156b TGACAGAAGAGAGTGAACAC 6 6
ath-miR-156b TGCCAGAAGAGAGTGAGCAC 3 6
ath-miR-156b TGACAGAAGCGAGTGAGCAC 3 6
ath-miR-156b TACAGAAGAGAGTGAGCAT 2 10
ath-miR-156b TGACAGAATAGAGTGAGCAC 9 6
ath-miR-156b TGACAGAAGATAGTGAGCAC 12 10
ath-miR-156b TGACAGAAGAGAGTGACCAC 5 6
ath-miR-156b TGACAGAACAGAGTGAGCAC 7 6
ath-miR-156b TGCAGAAGAGAGTGAGCAC 2 10
ath-miR-156b TGACAGAAGAGAGTGAG 2 6
ath-miR-156b TGACAGAAGAGGGTGAGCAC 3 6
ath-miR-156b TGACAGAAGAGAGTGAGCACC 7 7
ath-miR-156b TGACAGAAGAGAGTGAGCACG 2 8
ath-miR-156b TGACAGAAGAGAGTGAGCACT 10 7
ath-miR-156b TGACAGAAGAGAGCGAGCAC 8 14
ath-miR-156b GACAGAAGAGAGTGAGCAC 6 7
ath-miR-156b ATGACAGAAGAGAGTGAGCAC 2 8
ath-miR-156b TGACAGAAGAGAGTGAGCAAG 2 9
ath-miR-156b GGACAGAAGAGAGTGAGCAC 10 7
ath-miR-156b TGACAGAAGAGAGTGATCAC 14 6
ath-miR-156b TGACATAAGAGAGTGAGCAC 5 6
ath-miR-156b TGATAGAAGAGAGTGAGCAC 9 6
ath-miR-156b TGACAGAAGAGCGTGAGCAC 12 6
ath-miR-156b TGACAAAAGAGAGTGAGCAC 3 6
ath-miR-156b TGACAGAAGAGACTGAGCAC 12 6
ath-miR-156b GACAGAAGAGAGTGAGCACA 2 7
ath-miR-156b TCACAGAAGAGAGTGAGCAC 8 6
ath-miR-156b TGACAGAAGAGAGGGAGCAC 9 14
ath-miR-156b TTACAGAAGAGAGTGAGCACA 2 6
ath-miR-156b TGACAGACGAGAGTGAGCAC 4 6
ath-miR-156b TGACAGAAGAGAGTGAGCA 51 6
ath-miR-156b TGACAGAAGAGCGTGCGCAC 3 6
ath-miR-156b TGACAGAAGAGAGTGAGC 5 6
ath-miR-156b TGACAGAAGAGAGCGCGCAC 2 14
ath-miR-156b TGACAGGAGAGAGTGAGCAC 3 6
ath-miR-156b TGACAGAAGACAGTGAGCAC 9 6
ath-miR-156b TGACAGAAGAGAG 3 26
ath-miR-156b TGACAGAAGAGAGTGAGCTC 3 6
ath-miR-156b TGAAAGAAGAGAGTGAGCAC 3 6
ath-miR-156b TGAAAGAAGAGAGTGAGCAT 2 7
ath-miR-156b TGACAGAAGAGATTGAGCAC 34 6
ath-miR-156b TGACAGAAGAGAGTGCGCAC 6 6
ath-miR-156b TGACAGAAGAGAGTGAGGAC 2 6
ath-miR-156b TAACAGAAGAGAGTGAGCAC 2 6
ath-miR-156b TGACAGAAGAGAGTGAGAAC 5 6
ath-miR-156b TGACAGAAGAGAGTGAGAAA 2 11
ath-miR-156b TGACAGAAGAGAGTGAGTAC 9 6
ath-miR-156b TGACAGAAGAGAGTTAGCAC 8 6
ath-miR-156b TGACAGAAGAGAGTGAGCAA 15 7
ath-miR-156b ACAGAAGAGAGTGAGCAC 8 7
ath-miR-156b TGACAGAAAAGAGTGAGCAC 4 6
ath-miR-156b CTGACAGAAGAGAGTGAGCAC 3 3
ath-miR-156b TGACAGAAGAGAGTGAGCCC 9 6
ath-miR-156b TGACAGAAGAGAGTGTGCAC 2 6
ath-miR-156b TGACAGAAGAGAGTAAGCAC 5 7
ath-miR-156b TTACAGAAGAGAGTGAGCAC 21 6
ath-miR-156b TGACAGAAGAGAGTGGGCAC 3 6
ath-miR-156b TGACAGAAGAGAGTCAGCAC 5 6
ath-miR-156b TGACAGAAGAGAGTGAGCAT 49 6