id_rna sequence raw_count mapping_loci
ath-miR-156c TGACAGAAGAGAGTGAGCAC 3755 6
ath-miR-156c TGACAGAAGAGAGTGAGCACA 145 6
ath-miR-156c TACAGAAGAGAGTGAGCAC 16 7
ath-miR-156c TGACAGAAGAGTGTGAGCAC 9 6
ath-miR-156c TGACAGAAGAGAGTGAACAC 6 6
ath-miR-156c TGCCAGAAGAGAGTGAGCAC 3 6
ath-miR-156c TGACAGAAGCGAGTGAGCAC 3 6
ath-miR-156c TACAGAAGAGAGTGAGCAT 2 10
ath-miR-156c TGACAGAATAGAGTGAGCAC 9 6
ath-miR-156c TGACAGAAGATAGTGAGCAC 12 10
ath-miR-156c TGACAGAAGAGAGTGACCAC 5 6
ath-miR-156c TGACAGAACAGAGTGAGCAC 7 6
ath-miR-156c TGCAGAAGAGAGTGAGCAC 2 10
ath-miR-156c TGACAGAAGAGAGTGAG 2 6
ath-miR-156c TGACAGAAGAGGGTGAGCAC 3 6
ath-miR-156c TGACAGAAGAGAGTGAGCACC 7 7
ath-miR-156c TGACAGAAGAGAGTGAGCACG 2 8
ath-miR-156c TGACAGAAGAGAGTGAGCACT 10 7
ath-miR-156c TGACAGAAGAGAGCGAGCAC 8 14
ath-miR-156c GACAGAAGAGAGTGAGCAC 6 7
ath-miR-156c ATGACAGAAGAGAGTGAGCAC 2 8
ath-miR-156c TGACAGAAGAGAGTGAGCAAG 2 9
ath-miR-156c GGACAGAAGAGAGTGAGCAC 10 7
ath-miR-156c TGACAGAAGAGAGTGATCAC 14 6
ath-miR-156c TGACATAAGAGAGTGAGCAC 5 6
ath-miR-156c TGATAGAAGAGAGTGAGCAC 9 6
ath-miR-156c TGACAGAAGAGCGTGAGCAC 12 6
ath-miR-156c TGACAAAAGAGAGTGAGCAC 3 6
ath-miR-156c TGACAGAAGAGACTGAGCAC 12 6
ath-miR-156c GACAGAAGAGAGTGAGCACA 2 7
ath-miR-156c TCACAGAAGAGAGTGAGCAC 8 6
ath-miR-156c TGACAGAAGAGAGGGAGCAC 9 14
ath-miR-156c TTACAGAAGAGAGTGAGCACA 2 6
ath-miR-156c TGACAGACGAGAGTGAGCAC 4 6
ath-miR-156c TGACAGAAGAGAGTGAGCA 51 6
ath-miR-156c TGACAGAAGAGCGTGCGCAC 3 6
ath-miR-156c TGACAGAAGAGAGTGAGC 5 6
ath-miR-156c TGACAGAAGAGAGCGCGCAC 2 14
ath-miR-156c TGACAGGAGAGAGTGAGCAC 3 6
ath-miR-156c TGACAGAAGACAGTGAGCAC 9 6
ath-miR-156c TGACAGAAGAGAG 3 26
ath-miR-156c TGACAGAAGAGAGTGAGCTC 3 6
ath-miR-156c TGAAAGAAGAGAGTGAGCAC 3 6
ath-miR-156c TGAAAGAAGAGAGTGAGCAT 2 7
ath-miR-156c TGACAGAAGAGATTGAGCAC 34 6
ath-miR-156c TGACAGAAGAGAGTGCGCAC 6 6
ath-miR-156c TGACAGAAGAGAGTGAGGAC 2 6
ath-miR-156c TAACAGAAGAGAGTGAGCAC 2 6
ath-miR-156c TGACAGAAGAGAGTGAGAAC 5 6
ath-miR-156c TGACAGAAGAGAGTGAGAAA 2 11
ath-miR-156c TGACAGAAGAGAGTGAGTAC 9 6
ath-miR-156c TGACAGAAGAGAGTTAGCAC 8 6
ath-miR-156c TGACAGAAGAGAGTGAGCAA 15 7
ath-miR-156c ACAGAAGAGAGTGAGCAC 8 7
ath-miR-156c TGACAGAAAAGAGTGAGCAC 4 6
ath-miR-156c CTGACAGAAGAGAGTGAGCAC 3 3
ath-miR-156c TGACAGAAGAGAGTGAGCCC 9 6
ath-miR-156c TGACAGAAGAGAGTGTGCAC 2 6
ath-miR-156c TGACAGAAGAGAGTAAGCAC 5 7
ath-miR-156c TTACAGAAGAGAGTGAGCAC 21 6
ath-miR-156c TGACAGAAGAGAGTGGGCAC 3 6
ath-miR-156c TGACAGAAGAGAGTCAGCAC 5 6
ath-miR-156c TGACAGAAGAGAGTGAGCAT 49 6