id_rna sequence raw_count mapping_loci
ath-miR-156d TGACAGAAGAGAGTGAGCAC 3755 6
ath-miR-156d TTGACAGAAGAGAGTGAGCAC 1754 1
ath-miR-156d TCGACAGAAGAGAGTGAGCAC 19 2
ath-miR-156d TACAGAAGAGAGTGAGCAC 16 7
ath-miR-156d TTGACAGAAGAGAGTGAGCA 14 1
ath-miR-156d TGCCAGAAGAGAGTGAGCAC 3 6
ath-miR-156d TGACAGAAGAGAGTGAACAC 6 6
ath-miR-156d TTGACAGAAGAGAGTGAGC 7 1
ath-miR-156d TGACAGAAGAGTGTGAGCAC 9 6
ath-miR-156d TTGACAGAAGAGATTGAGCAC 14 1
ath-miR-156d TGACAGAAGCGAGTGAGCAC 3 6
ath-miR-156d TACAGAAGAGAGTGAGCAT 2 10
ath-miR-156d TGACAGAATAGAGTGAGCAC 9 6
ath-miR-156d TGACAGAAGATAGTGAGCAC 12 10
ath-miR-156d TTGACAGAAGAGAG 2 9
ath-miR-156d TGACAGAAGAGAGTGACCAC 5 6
ath-miR-156d TTGACAGAACAGAGTGAGCAC 2 1
ath-miR-156d TTGACAGAAGAGAGTGA 3 1
ath-miR-156d TTGACAGAAGAGAGTTAGCAC 10 1
ath-miR-156d TGACAGAACAGAGTGAGCAC 7 6
ath-miR-156d TGCAGAAGAGAGTGAGCAC 2 10
ath-miR-156d TGACAGAAGAGAGTGAG 2 6
ath-miR-156d TTGACAGAAGAGAGTGAGCAA 7 1
ath-miR-156d TTGACAGAAGAGAGTGAGCAT 17 1
ath-miR-156d TGACAGAAGAGGGTGAGCAC 3 6
ath-miR-156d TGACAGAAGAGAGTGAGCACC 7 7
ath-miR-156d TGACAGAAGAGAGTGAGCACA 145 6
ath-miR-156d TGACAGAAGAGAGTGAGCACG 2 8
ath-miR-156d TGACAGAAGAGAGTGAGCACT 10 7
ath-miR-156d TGACAGAAGAGAGCGAGCAC 8 14
ath-miR-156d TTGATAGAAGAGAGTGAGCAC 6 1
ath-miR-156d TTGACATAAGAGAGTGAGCAC 4 1
ath-miR-156d TTGACAGAAGAGAGTGAGCCC 6 1
ath-miR-156d TTGACAGAAGAGCGTGAGCAC 6 1
ath-miR-156d GACAGAAGAGAGTGAGCAC 6 7
ath-miR-156d ATGACAGAAGAGAGTGAGCAC 2 8
ath-miR-156d TGACAGAAGAGAGTGAGCAAG 2 9
ath-miR-156d GGACAGAAGAGAGTGAGCAC 10 7
ath-miR-156d TGACAGAAGAGAGTGATCAC 14 6
ath-miR-156d TTGACAGAAGAGAGTGGGCAC 3 1
ath-miR-156d TTGACAGAAGAGAGGGAGCAC 3 6
ath-miR-156d TGACATAAGAGAGTGAGCAC 5 6
ath-miR-156d TTGACAGAAGAGAGTGAGCGC 2 1
ath-miR-156d TGATAGAAGAGAGTGAGCAC 9 6
ath-miR-156d TGACAGAAGAGCGTGAGCAC 12 6
ath-miR-156d TTGACAGAAGAGAGTGAGCAG 3 1
ath-miR-156d TGACAAAAGAGAGTGAGCAC 3 6
ath-miR-156d TGACAGAAGAGACTGAGCAC 12 6
ath-miR-156d GACAGAAGAGAGTGAGCACA 2 7
ath-miR-156d TCACAGAAGAGAGTGAGCAC 8 6
ath-miR-156d TTGACAGAAGAGAGTGAGCACC 2 2
ath-miR-156d TTGACAGAAGAGAGTGAGCACG 2 2
ath-miR-156d TGACAGAAGAGAGGGAGCAC 9 14
ath-miR-156d TTACAGAAGAGAGTGAGCACA 2 6
ath-miR-156d TTGACAGAAGAGACTGAGCAC 5 1
ath-miR-156d TTGACAGAAGAGAGTGCGCAC 3 1
ath-miR-156d TGACAGACGAGAGTGAGCAC 4 6
ath-miR-156d TGACAGAAGAGAGTGAGCA 51 6
ath-miR-156d TGACAGAAGAGCGTGCGCAC 3 6
ath-miR-156d TGACAGAAGAGAGTGAGC 5 6
ath-miR-156d TTGACAGAAGAGAGTGAGNNC 2 1
ath-miR-156d TGACAGAAGAGAGCGCGCAC 2 14
ath-miR-156d TGACAGGAGAGAGTGAGCAC 3 6
ath-miR-156d TGACAGAAGACAGTGAGCAC 9 6
ath-miR-156d GTTGACAGAAGAGAGTGAGCAC 2 1
ath-miR-156d TGACAGAAGAGAG 3 26
ath-miR-156d TTGAAAGAAGAGAGTGAGCAC 2 1
ath-miR-156d TGACAGAAGAGAGTGAGCTC 3 6
ath-miR-156d TGAAAGAAGAGAGTGAGCAC 3 6
ath-miR-156d TGAAAGAAGAGAGTGAGCAT 2 7
ath-miR-156d TTGACAGAAGAGAGTGAGTAC 6 1
ath-miR-156d TTGACAGAAGAGTGTGAGCAC 3 1
ath-miR-156d TGACAGAAGAGATTGAGCAC 34 6
ath-miR-156d TTGACAGAATAGAGTGAGCAC 2 1
ath-miR-156d TTGACAGAAGAGAGTGAGAAC 3 1
ath-miR-156d TTGACAGAAGATAGTGAGCAC 31 4
ath-miR-156d TGACAGAAGAGAGTGCGCAC 6 6
ath-miR-156d TGACAGAAGAGAGTGAGGAC 2 6
ath-miR-156d TTTACAGAAGAGAGTGAGCAC 3 1
ath-miR-156d TAACAGAAGAGAGTGAGCAC 2 6
ath-miR-156d TGACAGAAGAGAGTGAGAAC 5 6
ath-miR-156d TGACAGAAGAGAGTGAGAAA 2 11
ath-miR-156d TGACAGAAGAGAGTGAGTAC 9 6
ath-miR-156d TTGACAGACGAGAGTGAGCAC 3 1
ath-miR-156d TTGACAGAAGAGAGTGATCAC 7 1
ath-miR-156d TGACAGAAGAGAGTTAGCAC 8 6
ath-miR-156d TGACAGAAGAGAGTGAGCAA 15 7
ath-miR-156d AAGTTGACAGAAGAGAGTGAG 2 1
ath-miR-156d ACAGAAGAGAGTGAGCAC 8 7
ath-miR-156d TGACAGAAAAGAGTGAGCAC 4 6
ath-miR-156d TTGACACAAGAGAGTGAGCAC 2 1
ath-miR-156d TGACAGAAGAGAGTGAGCCC 9 6
ath-miR-156d TTGACAGAAGAGAGCGAGCAC 8 6
ath-miR-156d TGACAGAAGAGAGTGTGCAC 2 6
ath-miR-156d TGACAGAAGAGAGTAAGCAC 5 7
ath-miR-156d TTACAGAAGAGAGTGAGCAC 21 6
ath-miR-156d TGACAGAAGAGAGTGGGCAC 3 6
ath-miR-156d TGACAGAAGAGAGTCAGCAC 5 6
ath-miR-156d TGACAGAAGAGAGTGAGCAT 49 6