id_rna sequence raw_count mapping_loci
ath-miR-156e TGACAGAAGAGAGTGAGCAC 3755 6
ath-miR-156e TGACAGAAGAGAGTGAGCACA 145 6
ath-miR-156e TACAGAAGAGAGTGAGCAC 16 7
ath-miR-156e TGACAGAAGAGTGTGAGCAC 9 6
ath-miR-156e TGACAGAAGAGAGTGAACAC 6 6
ath-miR-156e TGCCAGAAGAGAGTGAGCAC 3 6
ath-miR-156e TGACAGAAGCGAGTGAGCAC 3 6
ath-miR-156e TACAGAAGAGAGTGAGCAT 2 10
ath-miR-156e TGACAGAATAGAGTGAGCAC 9 6
ath-miR-156e TGACAGAAGATAGTGAGCAC 12 10
ath-miR-156e GTGACAGAAGAGAGAGAGCAC 3 10
ath-miR-156e TGACAGAAGAGAGTGACCAC 5 6
ath-miR-156e TGACAGAACAGAGTGAGCAC 7 6
ath-miR-156e TGCAGAAGAGAGTGAGCAC 2 10
ath-miR-156e TGACAGAAGAGAGTGAG 2 6
ath-miR-156e TGACAGAAGAGGGTGAGCAC 3 6
ath-miR-156e TGACAGAAGAGAGTGAGCACC 7 7
ath-miR-156e TGACAGAAGAGAGTGAGCACG 2 8
ath-miR-156e TGACAGAAGAGAGTGAGCACT 10 7
ath-miR-156e TGACAGAAGAGAGCGAGCAC 8 14
ath-miR-156e GACAGAAGAGAGTGAGCAC 6 7
ath-miR-156e ATGACAGAAGAGAGTGAGCAC 2 8
ath-miR-156e TGACAGAAGAGAGTGAGCAAG 2 9
ath-miR-156e GGACAGAAGAGAGTGAGCAC 10 7
ath-miR-156e TGACAGAAGAGAGTGATCAC 14 6
ath-miR-156e GTGACAGAAGAGAGTGAGCAC 5 2
ath-miR-156e TGACATAAGAGAGTGAGCAC 5 6
ath-miR-156e TGATAGAAGAGAGTGAGCAC 9 6
ath-miR-156e TGACAGAAGAGCGTGAGCAC 12 6
ath-miR-156e TGACAAAAGAGAGTGAGCAC 3 6
ath-miR-156e TGACAGAAGAGACTGAGCAC 12 6
ath-miR-156e GACAGAAGAGAGTGAGCACA 2 7
ath-miR-156e TCACAGAAGAGAGTGAGCAC 8 6
ath-miR-156e TGACAGAAGAGAGGGAGCAC 9 14
ath-miR-156e TTACAGAAGAGAGTGAGCACA 2 6
ath-miR-156e TGACAGACGAGAGTGAGCAC 4 6
ath-miR-156e TGACAGAAGAGAGTGAGCA 51 6
ath-miR-156e TGACAGAAGAGCGTGCGCAC 3 6
ath-miR-156e TGACAGAAGAGAGTGAGC 5 6
ath-miR-156e TGACAGAAGAGAGCGCGCAC 2 14
ath-miR-156e TGACAGGAGAGAGTGAGCAC 3 6
ath-miR-156e TGACAGAAGACAGTGAGCAC 9 6
ath-miR-156e TGACAGAAGAGAG 3 26
ath-miR-156e TGACAGAAGAGAGTGAGCTC 3 6
ath-miR-156e TGAAAGAAGAGAGTGAGCAC 3 6
ath-miR-156e TGAAAGAAGAGAGTGAGCAT 2 7
ath-miR-156e TGACAGAAGAGATTGAGCAC 34 6
ath-miR-156e TGACAGAAGAGAGTGCGCAC 6 6
ath-miR-156e TGACAGAAGAGAGTGAGGAC 2 6
ath-miR-156e TAACAGAAGAGAGTGAGCAC 2 6
ath-miR-156e TGACAGAAGAGAGTGAGAAC 5 6
ath-miR-156e TGACAGAAGAGAGTGAGAAA 2 11
ath-miR-156e TGACAGAAGAGAGTGAGTAC 9 6
ath-miR-156e TGACAGAAGAGAGTTAGCAC 8 6
ath-miR-156e TGACAGAAGAGAGTGAGCAA 15 7
ath-miR-156e ACAGAAGAGAGTGAGCAC 8 7
ath-miR-156e TGACAGAAAAGAGTGAGCAC 4 6
ath-miR-156e TGACAGAAGAGAGTGAGCCC 9 6
ath-miR-156e TGACAGAAGAGAGTGTGCAC 2 6
ath-miR-156e TGACAGAAGAGAGTAAGCAC 5 7
ath-miR-156e TTACAGAAGAGAGTGAGCAC 21 6
ath-miR-156e TGACAGAAGAGAGTGGGCAC 3 6
ath-miR-156e TGACAGAAGAGAGTCAGCAC 5 6
ath-miR-156e TGACAGAAGAGAGTGAGCAT 49 6