id_rna sequence raw_count mapping_loci
ath-miR-156f TGACAGAAGAGAGTGAGCAC 3755 6
ath-miR-156f TGACAGAAGAGAGTGAGCACA 145 6
ath-miR-156f TACAGAAGAGAGTGAGCAC 16 7
ath-miR-156f TGACAGAAGAGTGTGAGCAC 9 6
ath-miR-156f TGACAGAAGAGAGTGAACAC 6 6
ath-miR-156f TGCCAGAAGAGAGTGAGCAC 3 6
ath-miR-156f TGACAGAAGCGAGTGAGCAC 3 6
ath-miR-156f TACAGAAGAGAGTGAGCAT 2 10
ath-miR-156f TGACAGAATAGAGTGAGCAC 9 6
ath-miR-156f TGACAGAAGATAGTGAGCAC 12 10
ath-miR-156f GTGACAGAAGAGAGAGAGCAC 3 10
ath-miR-156f TGACAGAAGAGAGTGACCAC 5 6
ath-miR-156f TGACAGAACAGAGTGAGCAC 7 6
ath-miR-156f TGCAGAAGAGAGTGAGCAC 2 10
ath-miR-156f TGACAGAAGAGAGTGAG 2 6
ath-miR-156f TGACAGAAGAGGGTGAGCAC 3 6
ath-miR-156f TGACAGAAGAGAGTGAGCACC 7 7
ath-miR-156f TGACAGAAGAGAGTGAGCACG 2 8
ath-miR-156f TGACAGAAGAGAGTGAGCACT 10 7
ath-miR-156f TGACAGAAGAGAGCGAGCAC 8 14
ath-miR-156f GACAGAAGAGAGTGAGCAC 6 7
ath-miR-156f ATGACAGAAGAGAGTGAGCAC 2 8
ath-miR-156f TGACAGAAGAGAGTGAGCAAG 2 9
ath-miR-156f GGACAGAAGAGAGTGAGCAC 10 7
ath-miR-156f TGACAGAAGAGAGTGATCAC 14 6
ath-miR-156f GTGACAGAAGAGAGTGAGCAC 5 2
ath-miR-156f TGACATAAGAGAGTGAGCAC 5 6
ath-miR-156f TGATAGAAGAGAGTGAGCAC 9 6
ath-miR-156f TGACAGAAGAGCGTGAGCAC 12 6
ath-miR-156f TGACAAAAGAGAGTGAGCAC 3 6
ath-miR-156f TGACAGAAGAGACTGAGCAC 12 6
ath-miR-156f GACAGAAGAGAGTGAGCACA 2 7
ath-miR-156f TCACAGAAGAGAGTGAGCAC 8 6
ath-miR-156f TGACAGAAGAGAGGGAGCAC 9 14
ath-miR-156f TTACAGAAGAGAGTGAGCACA 2 6
ath-miR-156f TGACAGACGAGAGTGAGCAC 4 6
ath-miR-156f TGACAGAAGAGAGTGAGCA 51 6
ath-miR-156f TGACAGAAGAGCGTGCGCAC 3 6
ath-miR-156f TGACAGAAGAGAGTGAGC 5 6
ath-miR-156f TGACAGAAGAGAGCGCGCAC 2 14
ath-miR-156f TGACAGGAGAGAGTGAGCAC 3 6
ath-miR-156f TGACAGAAGACAGTGAGCAC 9 6
ath-miR-156f TGACAGAAGAGAG 3 26
ath-miR-156f TGACAGAAGAGAGTGAGCTC 3 6
ath-miR-156f TGAAAGAAGAGAGTGAGCAC 3 6
ath-miR-156f TGAAAGAAGAGAGTGAGCAT 2 7
ath-miR-156f TGACAGAAGAGATTGAGCAC 34 6
ath-miR-156f TGACAGAAGAGAGTGCGCAC 6 6
ath-miR-156f TGACAGAAGAGAGTGAGGAC 2 6
ath-miR-156f TAACAGAAGAGAGTGAGCAC 2 6
ath-miR-156f TGACAGAAGAGAGTGAGAAC 5 6
ath-miR-156f TGACAGAAGAGAGTGAGAAA 2 11
ath-miR-156f TGACAGAAGAGAGTGAGTAC 9 6
ath-miR-156f TGACAGAAGAGAGTTAGCAC 8 6
ath-miR-156f TGACAGAAGAGAGTGAGCAA 15 7
ath-miR-156f ACAGAAGAGAGTGAGCAC 8 7
ath-miR-156f TGACAGAAAAGAGTGAGCAC 4 6
ath-miR-156f TGACAGAAGAGAGTGAGCCC 9 6
ath-miR-156f TGACAGAAGAGAGTGTGCAC 2 6
ath-miR-156f TGACAGAAGAGAGTAAGCAC 5 7
ath-miR-156f TTACAGAAGAGAGTGAGCAC 21 6
ath-miR-156f TGACAGAAGAGAGTGGGCAC 3 6
ath-miR-156f TGACAGAAGAGAGTCAGCAC 5 6
ath-miR-156f TGACAGAAGAGAGTGAGCAT 49 6