id_rna sequence raw_count mapping_loci
ath-miR-156g TCGACAGAAGAGAGTGAGCAC 19 2
ath-miR-156g TACAGAAGAGAGTGAGCAC 16 7
ath-miR-156g TACAGAAGAGAGTGAGCAT 2 10
ath-miR-156g TGCAGAAGAGAGTGAGCAC 2 10
ath-miR-156g GACAGAAGAGAGTGAGCAC 6 7
ath-miR-156g GGACAGAAGAGAGTGAGCAC 10 7
ath-miR-156g GACAGAAGAGAGTGAGCACA 2 7
ath-miR-156g CGACAGAAGAGAGTGAGCAC 8 1
ath-miR-156g ACAGAAGAGAGTGAGCAC 8 7