id_rna sequence raw_count mapping_loci
ath-miR-156h TTGACAGAAGACAGAGAGCAC 13 9
ath-miR-156h TTGACAGAAGAAAGAGAGCAC 8 1
ath-miR-156h TTGACAGAAGANAGAGAGCAC 2 9
ath-miR-156h TGACAGAAGAAAGAGAGCAC 3 1