id_rna sequence raw_count mapping_loci
ath-miR-156i TGACAGAAGAGAG 3 26
ath-miR-156i GTGACAGAAGATAGAGAGCAG 2 6