id_rna sequence raw_count mapping_loci
ath-miR-156j TTGACAGAAGAGAGAGAGCAC 38 5
ath-miR-156j TTGACAGAAGACAGAGAGCAC 13 9
ath-miR-156j TGACAGAAGAGAGAGAGCAC 9 8
ath-miR-156j TTGAAAGAAGAGAGAGAGCAC 3 5
ath-miR-156j TTGACAGAAGAGAGAGCAC 2 6
ath-miR-156j GTGACAGAAGAGAGAGAGCAC 3 10
ath-miR-156j TTGACAGAAGAGAG 2 9
ath-miR-156j TGACAGAAGAGAGCGAGCAC 8 14
ath-miR-156j TGGACAGAAGAGAGAGAGCAC 2 5
ath-miR-156j TTGACAGAAGAGAGGGAGCAC 3 6
ath-miR-156j TGACAGAAGAGAGGGAGCAC 9 14
ath-miR-156j TTGACAGAAGAGAGAGAGCA 2 5
ath-miR-156j TGACAGAAGAGAGCGCGCAC 2 14
ath-miR-156j TGACAGAAGAGAG 3 26
ath-miR-156j TTGACAGAAGAGACAGAGCAC 2 5
ath-miR-156j TTGACAGAAGANAGAGAGCAC 2 9
ath-miR-156j TTGACAGAAGAGAGCGAGCAC 8 6
ath-miR-156j TTTGACAGAAGATAGAGAGCAC 4 6