id_rna sequence raw_count mapping_loci
ath-miR-157a TTGACAGAAGATAGAGAGCAC 22430 3
ath-miR-157a TGACAGAAGATAGAGAGCAC 2306 4
ath-miR-157a TTGACAGAAGATAGAGAGCCC 107 3
ath-miR-157a GTGACAGAAGATAGAGAACAC 2 5
ath-miR-157a TTGACAGAAGATAGAGAGCCA 2 4
ath-miR-157a AGTTGACAGAAGATAGAGAGCAC 2 4
ath-miR-157a TTGACACAAGATAGAGAGCAC 15 3
ath-miR-157a TTGACGGAAGATAGAGAGCA 2 3
ath-miR-157a TTGACAGAAGATAGAGATCAC 53 3
ath-miR-157a TTGACAGAAGATAGAGATCAT 2 5
ath-miR-157a TTGACAGAGGATAGAGAGCAC 7 3
ath-miR-157a GGGACAGAAGATAGAGAGCAC 3 4
ath-miR-157a GTGACAGAAGATAGAGAGCAC 42 4
ath-miR-157a GTGACAGAAGATAGAGAGCAT 2 4
ath-miR-157a TTGACAGAAGATAGAGAGAACC 3 4
ath-miR-157a ATGAAAGAAGATAGAGAGCAC 2 6
ath-miR-157a TGACAGAAGATAGAGAGCACC 19 5
ath-miR-157a TGACAGAAGATAGAGAGCACG 3 6
ath-miR-157a TGACAGAAGATAGAGAGCACA 15 2
ath-miR-157a TTGTCAGAAGATAGAGAGCAC 6 3
ath-miR-157a TTGACAGAAGATACAGAGCAC 46 3
ath-miR-157a TAGACAGAAGATAGAGAGCAC 4 3
ath-miR-157a TGACAGAAGATAGTGAGCAC 12 10
ath-miR-157a TGACAGAAGATAGAGCAC 7 9
ath-miR-157a GTGACAGAAGATAGAGAGAAC 2 5
ath-miR-157a TGACAGAAGATAGAGAGTAC 7 4
ath-miR-157a TTGACAGAAGGTAGAGAGCAC 11 3
ath-miR-157a TTGACAGACGCTAGAGAGCAC 2 3
ath-miR-157a TTGAAAGAAGATAGAGAGCAG 3 4
ath-miR-157a TTGACAGAAGATAGGGAGCAC 8 3
ath-miR-157a TACAGAAGATAGAGAGCAC 6 4
ath-miR-157a TTGACAGAAGATAGAGTGTAC 2 3
ath-miR-157a TTGACAGAAGATAGAGACCACC 2 4
ath-miR-157a TTGACAGAAGATCGAGAGCAC 16 3
ath-miR-157a TCACAGAAGATAGAGAGCAC 5 4
ath-miR-157a TTGACAGAAGATAGAG 5 4
ath-miR-157a TTGACAGATGATAGAGAGCAC 2 3
ath-miR-157a TTGACAGAAGATCGAGCGCAC 2 3
ath-miR-157a TTGACAGCAGATAGAGAGCAC 12 3
ath-miR-157a TTGACAGAAGATAGAGAGC 30 3
ath-miR-157a TGACATAAGATAGAGAGCAC 6 4
ath-miR-157a TAACAGAAGATAGAGAGCAC 3 4
ath-miR-157a TGACAGAAGATAGAGAGCAT 24 4
ath-miR-157a TCGACAGAAGATAGAGAGCA 2 4
ath-miR-157a TTGACAGAAGATAGCGAGCAC 39 3
ath-miR-157a TTGACAAAAGATAGAGAGCCC 2 3
ath-miR-157a ATGACAGAAGATAGAGAGCAC 6 6
ath-miR-157a TGGACAGAAGATAGAGAGCAC 9 3
ath-miR-157a TGACAAAAGATAGAGAGCAC 2 4
ath-miR-157a TGACAGAATATAGAGAGCAC 2 4
ath-miR-157a TTTACAGAAGATAGAGAGCAC 30 3
ath-miR-157a TTGACAGAAGNTAGAGAGCAC 2 3
ath-miR-157a TTGACAGAAGATAG 3 4
ath-miR-157a TTGAGAGAAGATAGAGAGCAC 6 3
ath-miR-157a TTGACAAAAGATAGAGAGCAC 19 3
ath-miR-157a TTGACAAAAGATAGAGAGCAA 2 5
ath-miR-157a TTGACAGTAGATAGAGAGCAC 3 3
ath-miR-157a GTGACAGAAGATAGAGAGCACA 3 2
ath-miR-157a TGACAGAAGCTAGAGAGCAC 3 4
ath-miR-157a TTGACAGAAGATAGAGACCAC 24 3
ath-miR-157a TTGACAGAAGCTAGAGAGCAC 23 3
ath-miR-157a TTGACAGAAGCTAGAGAGCAA 2 3
ath-miR-157a TGAAAGAAGATAGAGAGCAC 3 4
ath-miR-157a TTGACAGAAGATAGAGAGNNC 5 3
ath-miR-157a CGACAGAAGATAGAGAGCAC 5 4
ath-miR-157a TGACAGAAGATAGAGCGCAC 5 4
ath-miR-157a TTGCAGAAGATAGAGAGCAC 5 6
ath-miR-157a TGACAGAAGATATAGAGCAC 5 4
ath-miR-157a TTGACAGAAGATAGAGAGGAC 13 3
ath-miR-157a GTGACAGAAGATAGAGAGCACG 5 6
ath-miR-157a TTGACAGAAGATAGACAGCAC 53 3
ath-miR-157a TTGACAGAAGATAGAGCAC 57 5
ath-miR-157a TTGACAGAAGATAGAGAACAC 17 3
ath-miR-157a TGGAGAGAAGATAGAGAGCAC 2 4
ath-miR-157a TTAACAGAAGATAGAGAGCAC 10 3
ath-miR-157a TTGACAGAAGACAGAGAGCAC 13 9
ath-miR-157a TTGCCAGAAGATAGAGAGCAC 6 3
ath-miR-157a TTGACAGAATATAGAGAGCAC 6 3
ath-miR-157a GTGACAGAAGATAGAGAGCAG 2 6
ath-miR-157a TTGACAGAAAATAGAGAGCAC 5 3
ath-miR-157a TTGACAGAAGATAGAGTGCAC 18 3
ath-miR-157a GACAGAAGATAGAGAGCA 2 4
ath-miR-157a TTGACAGAAGTTAGAGAGCAC 9 3
ath-miR-157a TTGACAGCCGATAGAGAGCAC 2 3
ath-miR-157a TTCACAGAAGATAGAGAGCAC 17 3
ath-miR-157a CACAGAAGATAGAGAGCAC 2 4
ath-miR-157a TTGACAGAAGATAGANAGCAC 8 3
ath-miR-157a TCGACAGAAGATAGAGAGCAC 60 3
ath-miR-157a TGACAGAAGATAGAGATCAC 5 4
ath-miR-157a TTGACAGAAGATATAGAGCAC 86 3
ath-miR-157a TTGACAGAAGATAGAGAGTA 4 3
ath-miR-157a TTGACAGGAGATAGAGAGCAC 17 3
ath-miR-157a TGACAGAACATAGAGAGCAC 2 4
ath-miR-157a TTGGCAGAAGATAGAGAGCAC 11 3
ath-miR-157a TGACAGAAGATAGATAGCAC 11 4
ath-miR-157a TTGACAGAAGATAGATAGCACC 2 4
ath-miR-157a TTGACATAAGATAGAGAGCAC 37 3
ath-miR-157a TTGACATAAGATAGAGAGCAA 2 3
ath-miR-157a TTGACAGAAGATAGAGAGTAC 73 3
ath-miR-157a TTGACAGAAGATAGAGAGTAA 5 5
ath-miR-157a TTGAAAGAAGATAGAGAGCACG 2 4
ath-miR-157a ACAGAAGATAGAGAGCAC 4 4
ath-miR-157a TTGACAGAAGATAGAGAGCNC 3 3
ath-miR-157a TTGACAGCAGATAGAGATCAC 2 4
ath-miR-157a TTGACAGAAGATAGAGAGCC 2 3
ath-miR-157a TGACAGAAGTTAGAGAGCAC 2 4
ath-miR-157a TGACAGAAGATAGAGAGAAC 3 4
ath-miR-157a TTGACAGAAGATAAAGAGCAC 3 3
ath-miR-157a TTGACAGAAGATAGAGAGCATC 3 4
ath-miR-157a TTGACAGAAGATAGAGAGCATA 2 2
ath-miR-157a TTGACAGAAGATAGAGAGCACCT 8 4
ath-miR-157a TTGACAGAAGATAGTGAGCAC 31 4
ath-miR-157a TTGAAAGAAGATAGAGAGCAC 37 3
ath-miR-157a TGATAGAAGATAGAGAGCAC 10 4
ath-miR-157a TTGACAGAAGATAGAGAG 7 4
ath-miR-157a TGACAGAAGATAGAGAGCAA 9 4
ath-miR-157a TTGACAGAAGANAGAGAGCAC 2 9
ath-miR-157a GTGACAGAAGATAGAGAGCA 2 4
ath-miR-157a TTACAGAAGATAGAGAGCAC 41 4
ath-miR-157a TGACAGAAGATAGAGAGCA 20 4
ath-miR-157a TGACAGAAGATAGAGAGCCC 8 4
ath-miR-157a TTGACAGAAGATAGAGA 8 4
ath-miR-157a AAGATAGAGAGCAC 2 4
ath-miR-157a TTGACAGAAGATAGAGAGCTC 22 3
ath-miR-157a TTGACAGAAGATAGAGAGCAGC 2 4
ath-miR-157a TGACAGAAGATAGAGAGGAC 4 4
ath-miR-157a GTGACAGAAGATAGACAGCAC 2 4
ath-miR-157a TTGACCGAAGATAGAGCGCAC 2 3
ath-miR-157a TTGACAGAAGATAGAGAGNAC 2 3
ath-miR-157a TTGACAGAAGATAGAGAGCNN 2 3
ath-miR-157a TTGACAGAAGCTAGANAGCAC 2 3
ath-miR-157a TTGACAGAAGATAGAGAGCACAT 8 2
ath-miR-157a TTGACAGAAGATAGAAAGCAC 4 3
ath-miR-157a TGACAGAAGATAGAGTGCAC 3 4
ath-miR-157a GGACAGAAGATAGAGAGCAC 3 4
ath-miR-157a TGACAGAAGATAGAGNGCAC 2 4
ath-miR-157a TTGACAGAACATAGAGAGCAC 5 3
ath-miR-157a TTGACAGAAGATAGAGAGCACA 61 2
ath-miR-157a TTGACAGAAGATAGAGAGCACC 92 4
ath-miR-157a TTGACAGAAGATAGAGAGCACG 28 4
ath-miR-157a TTGAGAGAAGATAGAGAGCAA 2 4
ath-miR-157a TTGACAGACGATAGAGAGCAC 8 3
ath-miR-157a TTGACAGAAGATTGAGAGCAC 9 3
ath-miR-157a TTGACAGAAGATAGAGCGCCC 3 3
ath-miR-157a TTGATAGAAGATAGAGAGCAC 52 3
ath-miR-157a TTGATAGAAGATAGAGAGCAA 3 6
ath-miR-157a TTGACAGAAGATAGAGGGCAC 13 3
ath-miR-157a TTGACAGAAGATAGATTGCAC 2 3
ath-miR-157a TTGACAGAAGATAGAGAGCAAA 2 2
ath-miR-157a TTGACAGAAGATAGAGAGCAAG 2 6
ath-miR-157a TTGACAGAAGATAGAGAGCAAC 2 5
ath-miR-157a TTGACAGAAGATAGA 20 4
ath-miR-157a TTGACAGAAGATAGAGAGCGC 10 3
ath-miR-157a TTGACGGAAGATAGAGAGCAC 10 3
ath-miR-157a TTGACAGAAGATGGAGAGCAC 6 3
ath-miR-157a TTGACAGAAGATAGAGCGCAC 27 3
ath-miR-157a TTGACAGAAGATAGAGCGCAT 2 3
ath-miR-157a TTGACAGAAGATA 2 12
ath-miR-157a TTGACAGAAGATAGAGAGAAC 31 3
ath-miR-157a TTGACTGAAGATAGAGAGCAC 2 3
ath-miR-157a TTGACAGAAGATAGAGAGAAA 3 6
ath-miR-157a TTCACAGAAGATAGAGAGCACA 3 2
ath-miR-157a TTGACAGAAGATAGAGAGCA 249 3
ath-miR-157a TTGACAGAAGATAGAGAGCT 2 4
ath-miR-157a TGACAGACGATAGAGAGCAC 2 4
ath-miR-157a TGACAGAAGATAGACAGCAC 2 4
ath-miR-157a TTGACAGAAGATAGAGAGCAG 13 3
ath-miR-157a TTGACAGAAGATAGAGAGCAA 72 3
ath-miR-157a TTGACAGAAGATAGAGAGCAT 332 3
ath-miR-157a TTTGACAGAAGATAGAGAGCAC 4 6
ath-miR-157a GTGAGAGAAGATAGAGAGCAC 2 4
ath-miR-157a TTGAAAGAGGATAGAGAGCAC 2 3
ath-miR-157a GACAGAAGATAGAGAGCAC 4 4
ath-miR-157a TTGACAGAAGATAGAGAGAA 3 3
ath-miR-157a TTGACAGAAGATAGATAGCAC 84 3
ath-miR-157a GTTGACAGAAGATAGAGAGCAC 2 3
ath-miR-157a GTGACAGAAGATAGAGAGGAC 2 5
ath-miR-157a TGACAGAAGATACAGAGCAC 7 4