id_rna sequence raw_count mapping_loci
ath-miR-157b TTGACAGAAGATAGAGAGCAC 22430 3
ath-miR-157b TGACAGAAGATAGAGAGCAC 2306 4
ath-miR-157b TTGACAGAAGATAGAGAGCCC 107 3
ath-miR-157b GTGACAGAAGATAGAGAACAC 2 5
ath-miR-157b TTGACAGAAGATAGAGAGCCA 2 4
ath-miR-157b AGTTGACAGAAGATAGAGAGCAC 2 4
ath-miR-157b TTGACACAAGATAGAGAGCAC 15 3
ath-miR-157b TTGACGGAAGATAGAGAGCA 2 3
ath-miR-157b TTGACAGAAGATAGAGATCAC 53 3
ath-miR-157b TTGACAGAAGATAGAGATCAT 2 5
ath-miR-157b TTGACAGAGGATAGAGAGCAC 7 3
ath-miR-157b GGGACAGAAGATAGAGAGCAC 3 4
ath-miR-157b GTGACAGAAGATAGAGAGCAC 42 4
ath-miR-157b GTGACAGAAGATAGAGAGCAT 2 4
ath-miR-157b TTGACAGAAGATAGAGAGAACC 3 4
ath-miR-157b ATGAAAGAAGATAGAGAGCAC 2 6
ath-miR-157b TGACAGAAGATAGAGAGCACC 19 5
ath-miR-157b TGACAGAAGATAGAGAGCACG 3 6
ath-miR-157b TGACAGAAGATAGAGAGCACA 15 2
ath-miR-157b TTGTCAGAAGATAGAGAGCAC 6 3
ath-miR-157b TTGACAGAAGATACAGAGCAC 46 3
ath-miR-157b TAGACAGAAGATAGAGAGCAC 4 3
ath-miR-157b TGACAGAAGATAGTGAGCAC 12 10
ath-miR-157b TGACAGAAGATAGAGCAC 7 9
ath-miR-157b GTGACAGAAGATAGAGAGAAC 2 5
ath-miR-157b TGACAGAAGATAGAGAGTAC 7 4
ath-miR-157b TTGACAGAAGGTAGAGAGCAC 11 3
ath-miR-157b TTGACAGACGCTAGAGAGCAC 2 3
ath-miR-157b TTGAAAGAAGATAGAGAGCAG 3 4
ath-miR-157b TTGACAGAAGATAGGGAGCAC 8 3
ath-miR-157b TACAGAAGATAGAGAGCAC 6 4
ath-miR-157b TTGACAGAAGATAGAGTGTAC 2 3
ath-miR-157b TTGACAGAAGATAGAGACCACC 2 4
ath-miR-157b TTGACAGAAGATCGAGAGCAC 16 3
ath-miR-157b TCACAGAAGATAGAGAGCAC 5 4
ath-miR-157b TTGACAGAAGATAGAG 5 4
ath-miR-157b TTGACAGATGATAGAGAGCAC 2 3
ath-miR-157b TTGACAGAAGATCGAGCGCAC 2 3
ath-miR-157b TTGACAGCAGATAGAGAGCAC 12 3
ath-miR-157b TTGACAGAAGATAGAGAGC 30 3
ath-miR-157b TGACATAAGATAGAGAGCAC 6 4
ath-miR-157b TAACAGAAGATAGAGAGCAC 3 4
ath-miR-157b TGACAGAAGATAGAGAGCAT 24 4
ath-miR-157b TCGACAGAAGATAGAGAGCA 2 4
ath-miR-157b TTGACAGAAGATAGCGAGCAC 39 3
ath-miR-157b TTGACAAAAGATAGAGAGCCC 2 3
ath-miR-157b ATGACAGAAGATAGAGAGCAC 6 6
ath-miR-157b TGGACAGAAGATAGAGAGCAC 9 3
ath-miR-157b TGACAAAAGATAGAGAGCAC 2 4
ath-miR-157b TGACAGAATATAGAGAGCAC 2 4
ath-miR-157b TTTACAGAAGATAGAGAGCAC 30 3
ath-miR-157b TTGACAGAAGNTAGAGAGCAC 2 3
ath-miR-157b TTGACAGAAGATAG 3 4
ath-miR-157b TTGAGAGAAGATAGAGAGCAC 6 3
ath-miR-157b TTGACAAAAGATAGAGAGCAC 19 3
ath-miR-157b TTGACAAAAGATAGAGAGCAA 2 5
ath-miR-157b TTGACAGTAGATAGAGAGCAC 3 3
ath-miR-157b GTGACAGAAGATAGAGAGCACA 3 2
ath-miR-157b TGACAGAAGCTAGAGAGCAC 3 4
ath-miR-157b TTGACAGAAGATAGAGACCAC 24 3
ath-miR-157b TTGACAGAAGCTAGAGAGCAC 23 3
ath-miR-157b TTGACAGAAGCTAGAGAGCAA 2 3
ath-miR-157b TGAAAGAAGATAGAGAGCAC 3 4
ath-miR-157b TTGACAGAAGATAGAGAGNNC 5 3
ath-miR-157b CGACAGAAGATAGAGAGCAC 5 4
ath-miR-157b TGACAGAAGATAGAGCGCAC 5 4
ath-miR-157b TTGCAGAAGATAGAGAGCAC 5 6
ath-miR-157b TGACAGAAGATATAGAGCAC 5 4
ath-miR-157b TTGACAGAAGATAGAGAGGAC 13 3
ath-miR-157b GTGACAGAAGATAGAGAGCACG 5 6
ath-miR-157b TTGACAGAAGATAGACAGCAC 53 3
ath-miR-157b TTGACAGAAGATAGAGCAC 57 5
ath-miR-157b TTGACAGAAGATAGAGAACAC 17 3
ath-miR-157b TGGAGAGAAGATAGAGAGCAC 2 4
ath-miR-157b TTAACAGAAGATAGAGAGCAC 10 3
ath-miR-157b TTGACAGAAGACAGAGAGCAC 13 9
ath-miR-157b TTGCCAGAAGATAGAGAGCAC 6 3
ath-miR-157b TTGACAGAATATAGAGAGCAC 6 3
ath-miR-157b GTGACAGAAGATAGAGAGCAG 2 6
ath-miR-157b TTGACAGAAAATAGAGAGCAC 5 3
ath-miR-157b TTGACAGAAGATAGAGTGCAC 18 3
ath-miR-157b GACAGAAGATAGAGAGCA 2 4
ath-miR-157b TTGACAGAAGTTAGAGAGCAC 9 3
ath-miR-157b TTGACAGCCGATAGAGAGCAC 2 3
ath-miR-157b TTCACAGAAGATAGAGAGCAC 17 3
ath-miR-157b CACAGAAGATAGAGAGCAC 2 4
ath-miR-157b TTGACAGAAGATAGANAGCAC 8 3
ath-miR-157b TCGACAGAAGATAGAGAGCAC 60 3
ath-miR-157b TGACAGAAGATAGAGATCAC 5 4
ath-miR-157b TTGACAGAAGATATAGAGCAC 86 3
ath-miR-157b TTGACAGAAGATAGAGAGTA 4 3
ath-miR-157b TTGACAGGAGATAGAGAGCAC 17 3
ath-miR-157b TGACAGAACATAGAGAGCAC 2 4
ath-miR-157b TTGGCAGAAGATAGAGAGCAC 11 3
ath-miR-157b TGACAGAAGATAGATAGCAC 11 4
ath-miR-157b TTGACAGAAGATAGATAGCACC 2 4
ath-miR-157b TTGACATAAGATAGAGAGCAC 37 3
ath-miR-157b TTGACATAAGATAGAGAGCAA 2 3
ath-miR-157b TTGACAGAAGATAGAGAGTAC 73 3
ath-miR-157b TTGACAGAAGATAGAGAGTAA 5 5
ath-miR-157b TTGAAAGAAGATAGAGAGCACG 2 4
ath-miR-157b ACAGAAGATAGAGAGCAC 4 4
ath-miR-157b TTGACAGAAGATAGAGAGCNC 3 3
ath-miR-157b TTGACAGCAGATAGAGATCAC 2 4
ath-miR-157b TTGACAGAAGATAGAGAGCC 2 3
ath-miR-157b TGACAGAAGTTAGAGAGCAC 2 4
ath-miR-157b TGACAGAAGATAGAGAGAAC 3 4
ath-miR-157b TTGACAGAAGATAAAGAGCAC 3 3
ath-miR-157b TTGACAGAAGATAGAGAGCATC 3 4
ath-miR-157b TTGACAGAAGATAGAGAGCATA 2 2
ath-miR-157b TTGACAGAAGATAGAGAGCACCT 8 4
ath-miR-157b TTGACAGAAGATAGTGAGCAC 31 4
ath-miR-157b TTGAAAGAAGATAGAGAGCAC 37 3
ath-miR-157b TGATAGAAGATAGAGAGCAC 10 4
ath-miR-157b TTGACAGAAGATAGAGAG 7 4
ath-miR-157b TGACAGAAGATAGAGAGCAA 9 4
ath-miR-157b TTGACAGAAGANAGAGAGCAC 2 9
ath-miR-157b GTGACAGAAGATAGAGAGCA 2 4
ath-miR-157b TTACAGAAGATAGAGAGCAC 41 4
ath-miR-157b TGACAGAAGATAGAGAGCA 20 4
ath-miR-157b TGACAGAAGATAGAGAGCCC 8 4
ath-miR-157b TTGACAGAAGATAGAGA 8 4
ath-miR-157b AAGATAGAGAGCAC 2 4
ath-miR-157b TTGACAGAAGATAGAGAGCTC 22 3
ath-miR-157b TTGACAGAAGATAGAGAGCAGC 2 4
ath-miR-157b TGACAGAAGATAGAGAGGAC 4 4
ath-miR-157b GTGACAGAAGATAGACAGCAC 2 4
ath-miR-157b TTGACCGAAGATAGAGCGCAC 2 3
ath-miR-157b TTGACAGAAGATAGAGAGNAC 2 3
ath-miR-157b TTGACAGAAGATAGAGAGCNN 2 3
ath-miR-157b TTGACAGAAGCTAGANAGCAC 2 3
ath-miR-157b TTGACAGAAGATAGAGAGCACAT 8 2
ath-miR-157b TTGACAGAAGATAGAAAGCAC 4 3
ath-miR-157b TGACAGAAGATAGAGTGCAC 3 4
ath-miR-157b GGACAGAAGATAGAGAGCAC 3 4
ath-miR-157b TGACAGAAGATAGAGNGCAC 2 4
ath-miR-157b TTGACAGAACATAGAGAGCAC 5 3
ath-miR-157b TTGACAGAAGATAGAGAGCACA 61 2
ath-miR-157b TTGACAGAAGATAGAGAGCACC 92 4
ath-miR-157b TTGACAGAAGATAGAGAGCACG 28 4
ath-miR-157b TTGAGAGAAGATAGAGAGCAA 2 4
ath-miR-157b TTGACAGACGATAGAGAGCAC 8 3
ath-miR-157b TTGACAGAAGATTGAGAGCAC 9 3
ath-miR-157b TTGACAGAAGATAGAGCGCCC 3 3
ath-miR-157b TTGATAGAAGATAGAGAGCAC 52 3
ath-miR-157b TTGATAGAAGATAGAGAGCAA 3 6
ath-miR-157b TTGACAGAAGATAGAGGGCAC 13 3
ath-miR-157b TTGACAGAAGATAGATTGCAC 2 3
ath-miR-157b TTGACAGAAGATAGAGAGCAAA 2 2
ath-miR-157b TTGACAGAAGATAGAGAGCAAG 2 6
ath-miR-157b TTGACAGAAGATAGAGAGCAAC 2 5
ath-miR-157b TTGACAGAAGATAGA 20 4
ath-miR-157b TTGACAGAAGATAGAGAGCGC 10 3
ath-miR-157b TTGACGGAAGATAGAGAGCAC 10 3
ath-miR-157b TTGACAGAAGATGGAGAGCAC 6 3
ath-miR-157b TTGACAGAAGATAGAGCGCAC 27 3
ath-miR-157b TTGACAGAAGATAGAGCGCAT 2 3
ath-miR-157b TTGACAGAAGATA 2 12
ath-miR-157b TTGACAGAAGATAGAGAGAAC 31 3
ath-miR-157b TTGACTGAAGATAGAGAGCAC 2 3
ath-miR-157b TTGACAGAAGATAGAGAGAAA 3 6
ath-miR-157b TTCACAGAAGATAGAGAGCACA 3 2
ath-miR-157b TTGACAGAAGATAGAGAGCA 249 3
ath-miR-157b TTGACAGAAGATAGAGAGCT 2 4
ath-miR-157b TGACAGACGATAGAGAGCAC 2 4
ath-miR-157b TGACAGAAGATAGACAGCAC 2 4
ath-miR-157b TTGACAGAAGATAGAGAGCAG 13 3
ath-miR-157b TTGACAGAAGATAGAGAGCAA 72 3
ath-miR-157b TTGACAGAAGATAGAGAGCAT 332 3
ath-miR-157b TTTGACAGAAGATAGAGAGCAC 4 6
ath-miR-157b GTGAGAGAAGATAGAGAGCAC 2 4
ath-miR-157b TTGAAAGAGGATAGAGAGCAC 2 3
ath-miR-157b GACAGAAGATAGAGAGCAC 4 4
ath-miR-157b TTGACAGAAGATAGAGAGAA 3 3
ath-miR-157b TTGACAGAAGATAGATAGCAC 84 3
ath-miR-157b GTTGACAGAAGATAGAGAGCAC 2 3
ath-miR-157b GTGACAGAAGATAGAGAGGAC 2 5
ath-miR-157b TGACAGAAGATACAGAGCAC 7 4