id_rna sequence raw_count mapping_loci
ath-miR-157c TTGACAGAAGATAGAGAGCAC 22430 3
ath-miR-157c TGACAGAAGATAGAGAGCAC 2306 4
ath-miR-157c TTGACAGAAGATAGAGAGCCC 107 3
ath-miR-157c GTGACAGAAGATAGAGAACAC 2 5
ath-miR-157c TTGACAGAAGATAGAGAGCCA 2 4
ath-miR-157c AGTTGACAGAAGATAGAGAGCAC 2 4
ath-miR-157c TTGACACAAGATAGAGAGCAC 15 3
ath-miR-157c TTGACGGAAGATAGAGAGCA 2 3
ath-miR-157c TTGACAGAAGATAGAGATCAC 53 3
ath-miR-157c TTGACAGAAGATAGAGATCAT 2 5
ath-miR-157c TTGACAGAGGATAGAGAGCAC 7 3
ath-miR-157c GGGACAGAAGATAGAGAGCAC 3 4
ath-miR-157c GTGACAGAAGATAGAGAGCAC 42 4
ath-miR-157c GTGACAGAAGATAGAGAGCAT 2 4
ath-miR-157c TTGACAGAAGATAGAGAGAACC 3 4
ath-miR-157c ATGAAAGAAGATAGAGAGCAC 2 6
ath-miR-157c TGACAGAAGATAGAGAGCACC 19 5
ath-miR-157c TGACAGAAGATAGAGAGCACG 3 6
ath-miR-157c TGACAGAAGATAGAGAGCACT 34 2
ath-miR-157c TTGTCAGAAGATAGAGAGCAC 6 3
ath-miR-157c TTGACAGAAGATACAGAGCAC 46 3
ath-miR-157c TAGACAGAAGATAGAGAGCAC 4 3
ath-miR-157c TGACAGAAGATAGTGAGCAC 12 10
ath-miR-157c TGACAGAAGATAGAGCAC 7 9
ath-miR-157c GTGACAGAAGATAGAGAGAAC 2 5
ath-miR-157c TGACAGAAGATAGAGAGTAC 7 4
ath-miR-157c TTGACAGAAGGTAGAGAGCAC 11 3
ath-miR-157c TTGACAGACGCTAGAGAGCAC 2 3
ath-miR-157c TTGAAAGAAGATAGAGAGCAG 3 4
ath-miR-157c TTGACAGAAGATAGGGAGCAC 8 3
ath-miR-157c TACAGAAGATAGAGAGCAC 6 4
ath-miR-157c TTGACAGAAGATAGAGTGTAC 2 3
ath-miR-157c TTGACAGAAGATAGAGACCACC 2 4
ath-miR-157c TTGACAGAAGATCGAGAGCAC 16 3
ath-miR-157c TCACAGAAGATAGAGAGCAC 5 4
ath-miR-157c TTGACAGAAGATAGAG 5 4
ath-miR-157c TTGACAGATGATAGAGAGCAC 2 3
ath-miR-157c TTGACAGAAGATCGAGCGCAC 2 3
ath-miR-157c TTGACAGCAGATAGAGAGCAC 12 3
ath-miR-157c TTGACAGAAGATAGAGAGC 30 3
ath-miR-157c TGACATAAGATAGAGAGCAC 6 4
ath-miR-157c TAACAGAAGATAGAGAGCAC 3 4
ath-miR-157c TGACAGAAGATAGAGAGCAT 24 4
ath-miR-157c TCGACAGAAGATAGAGAGCA 2 4
ath-miR-157c TTGACAGAAGATAGCGAGCAC 39 3
ath-miR-157c TTGACAAAAGATAGAGAGCCC 2 3
ath-miR-157c ATGACAGAAGATAGAGAGCAC 6 6
ath-miR-157c TGGACAGAAGATAGAGAGCAC 9 3
ath-miR-157c TGACAAAAGATAGAGAGCAC 2 4
ath-miR-157c TGACAGAATATAGAGAGCAC 2 4
ath-miR-157c TTTACAGAAGATAGAGAGCAC 30 3
ath-miR-157c TTGACAGAAGNTAGAGAGCAC 2 3
ath-miR-157c TTGACAGAAGATAG 3 4
ath-miR-157c TTGAGAGAAGATAGAGAGCAC 6 3
ath-miR-157c TTGACAAAAGATAGAGAGCAC 19 3
ath-miR-157c TTGACAAAAGATAGAGAGCAA 2 5
ath-miR-157c TTGACAGTAGATAGAGAGCAC 3 3
ath-miR-157c TGACAGAAGCTAGAGAGCAC 3 4
ath-miR-157c TTGACAGAAGATAGAGACCAC 24 3
ath-miR-157c TTGACAGAAGCTAGAGAGCAC 23 3
ath-miR-157c TTGACAGAAGCTAGAGAGCAA 2 3
ath-miR-157c TGAAAGAAGATAGAGAGCAC 3 4
ath-miR-157c TTGACAGAAGATAGAGAGNNC 5 3
ath-miR-157c CGACAGAAGATAGAGAGCAC 5 4
ath-miR-157c TGACAGAAGATAGAGCGCAC 5 4
ath-miR-157c TTGCAGAAGATAGAGAGCAC 5 6
ath-miR-157c TGACAGAAGATATAGAGCAC 5 4
ath-miR-157c TTGACAGAAGATAGAGAGGAC 13 3
ath-miR-157c GTGACAGAAGATAGAGAGCACG 5 6
ath-miR-157c TTGACAGAAGATAGACAGCAC 53 3
ath-miR-157c TTGACAGAAGATAGAGCAC 57 5
ath-miR-157c TTGACAGAAGATAGAGAACAC 17 3
ath-miR-157c TGGAGAGAAGATAGAGAGCAC 2 4
ath-miR-157c TTAACAGAAGATAGAGAGCAC 10 3
ath-miR-157c TTGACAGAAGACAGAGAGCAC 13 9
ath-miR-157c TGACAGAAGATAGAGAGCACTT 5 2
ath-miR-157c TTGCCAGAAGATAGAGAGCAC 6 3
ath-miR-157c TTGACAGAATATAGAGAGCAC 6 3
ath-miR-157c GTGACAGAAGATAGAGAGCAG 2 6
ath-miR-157c TTGACAGAAAATAGAGAGCAC 5 3
ath-miR-157c TTGACAGAAGATAGAGTGCAC 18 3
ath-miR-157c GACAGAAGATAGAGAGCA 2 4
ath-miR-157c TTGACAGAAGTTAGAGAGCAC 9 3
ath-miR-157c TTGACAGCCGATAGAGAGCAC 2 3
ath-miR-157c TTCACAGAAGATAGAGAGCAC 17 3
ath-miR-157c CACAGAAGATAGAGAGCAC 2 4
ath-miR-157c TTGACAGAAGATAGANAGCAC 8 3
ath-miR-157c TCGACAGAAGATAGAGAGCAC 60 3
ath-miR-157c TGACAGAAGATAGAGATCAC 5 4
ath-miR-157c TTGACAGAAGATATAGAGCAC 86 3
ath-miR-157c TTGACAGAAGATAGAGAGTA 4 3
ath-miR-157c TTGACAGGAGATAGAGAGCAC 17 3
ath-miR-157c TGACAGAACATAGAGAGCAC 2 4
ath-miR-157c TTGGCAGAAGATAGAGAGCAC 11 3
ath-miR-157c TGACAGAAGATAGATAGCAC 11 4
ath-miR-157c TTGACAGAAGATAGATAGCACC 2 4
ath-miR-157c TTGACATAAGATAGAGAGCAC 37 3
ath-miR-157c TTGACATAAGATAGAGAGCAA 2 3
ath-miR-157c TTGACAGAAGATAGAGAGTAC 73 3
ath-miR-157c TTGACAGAAGATAGAGAGTAA 5 5
ath-miR-157c TTGAAAGAAGATAGAGAGCACG 2 4
ath-miR-157c TTGACAGAAGATAGAGAGCACTT 60 1
ath-miR-157c TTGACAGAAGATAGAGAGCACTC 29 1
ath-miR-157c ACAGAAGATAGAGAGCAC 4 4
ath-miR-157c TTGACAGAAGATAGAGAGCNC 3 3
ath-miR-157c TTGACAGCAGATAGAGATCAC 2 4
ath-miR-157c TTGACAGAAGATAGAGAGCC 2 3
ath-miR-157c TGACAGAAGTTAGAGAGCAC 2 4
ath-miR-157c TGACAGAAGATAGAGAGAAC 3 4
ath-miR-157c TTGACAGAAGATAAAGAGCAC 3 3
ath-miR-157c TTGACAGAAGATAGAGAGCATT 22 1
ath-miR-157c TTGACAGAAGATAGAGAGCATC 3 4
ath-miR-157c TTGACAGAAGATAGAGAGCACCT 8 4
ath-miR-157c TTGACAGAAGATAGTGAGCAC 31 4
ath-miR-157c TTGAAAGAAGATAGAGAGCAC 37 3
ath-miR-157c TGATAGAAGATAGAGAGCAC 10 4
ath-miR-157c TTGACAGAAGATAGAGAG 7 4
ath-miR-157c TGACAGAAGATAGAGAGCAA 9 4
ath-miR-157c TTGACAGAAGANAGAGAGCAC 2 9
ath-miR-157c GTGACAGAAGATAGAGAGCA 2 4
ath-miR-157c TTACAGAAGATAGAGAGCAC 41 4
ath-miR-157c TGACAGAAGATAGAGAGCA 20 4
ath-miR-157c TGACAGAAGATAGAGAGCCC 8 4
ath-miR-157c TTGACAGAAGATAGAGA 8 4
ath-miR-157c AAGATAGAGAGCAC 2 4
ath-miR-157c TTGACAGAAGATAGAGAGCTC 22 3
ath-miR-157c TTGACAGAAGATAGAGAGCAGC 2 4
ath-miR-157c TTGACAGAAGATAGAGTGCACT 2 1
ath-miR-157c TGACAGAAGATAGAGAGGAC 4 4
ath-miR-157c GTGACAGAAGATAGACAGCAC 2 4
ath-miR-157c TTGACCGAAGATAGAGCGCAC 2 3
ath-miR-157c TTGACAGAAGATAGAGAGNAC 2 3
ath-miR-157c TTGACAGAAGATAGAGAGCNN 2 3
ath-miR-157c ACAGAAGATAGAGAGCACTAA 2 2
ath-miR-157c TTGACAGAAGCTAGANAGCAC 2 3
ath-miR-157c TTGACAGAAGATAGAAAGCAC 4 3
ath-miR-157c TGACAGAAGATAGAGTGCAC 3 4
ath-miR-157c GGACAGAAGATAGAGAGCAC 3 4
ath-miR-157c TGACAGAAGATAGAGNGCAC 2 4
ath-miR-157c TTGACAGAACATAGAGAGCAC 5 3
ath-miR-157c TTGACAGAAGATAGAGAGCACC 92 4
ath-miR-157c TTGACAGAAGATAGAGAGCACG 28 4
ath-miR-157c TTGACAGAAGATAGAGAGCACT 142 1
ath-miR-157c TTGAGAGAAGATAGAGAGCAA 2 4
ath-miR-157c TTGACAGACGATAGAGAGCAC 8 3
ath-miR-157c TTGACAGAAGATTGAGAGCAC 9 3
ath-miR-157c TTGACAGAAGATAGAGCGCCC 3 3
ath-miR-157c TTGATAGAAGATAGAGAGCAC 52 3
ath-miR-157c TTGATAGAAGATAGAGAGCAA 3 6
ath-miR-157c TTGACAGAAGATAGAGGGCAC 13 3
ath-miR-157c TTGACAGAAGATAGATTGCAC 2 3
ath-miR-157c TTGACAGAAGATAGAGAGCAAG 2 6
ath-miR-157c TTGACAGAAGATAGAGAGCAAC 2 5
ath-miR-157c ATGACAGAAGATAGAGAGCACTC 2 2
ath-miR-157c TTGACAGAAGATAGA 20 4
ath-miR-157c TTGACAGAAGATAGAGAGCCCT 2 1
ath-miR-157c TTGACAGAAGATAGAGAGCGC 10 3
ath-miR-157c TTGACGGAAGATAGAGAGCAC 10 3
ath-miR-157c TTGACAGAAGATGGAGAGCAC 6 3
ath-miR-157c TTGACAGAAGATAGAGCGCAC 27 3
ath-miR-157c TTGACAGAAGATAGAGCGCAT 2 3
ath-miR-157c TTGACAGAAGATA 2 12
ath-miR-157c TTGACAGAAGATAGAGAGAAC 31 3
ath-miR-157c TTGACTGAAGATAGAGAGCAC 2 3
ath-miR-157c TTGACAGAAGATAGAGAGAAA 3 6
ath-miR-157c TTGACAGAAGATAGAGAGCA 249 3
ath-miR-157c TTGACAGAAGATAGAGAGCT 2 4
ath-miR-157c TGACAGACGATAGAGAGCAC 2 4
ath-miR-157c TTGACAGAAGATAGAGAGTACT 4 1
ath-miR-157c TGACAGAAGATAGACAGCAC 2 4
ath-miR-157c TTGACAGAAGATAGAGAGCAG 13 3
ath-miR-157c TTGACAGAAGATAGAGAGCAA 72 3
ath-miR-157c TTGACAGAAGATAGAGAGCAT 332 3
ath-miR-157c TTTGACAGAAGATAGAGAGCAC 4 6
ath-miR-157c GTGAGAGAAGATAGAGAGCAC 2 4
ath-miR-157c TTGAAAGAGGATAGAGAGCAC 2 3
ath-miR-157c GACAGAAGATAGAGAGCAC 4 4
ath-miR-157c TTGACAGAAGATAGAGAGAA 3 3
ath-miR-157c TTGACAGAAGATAGATAGCAC 84 3
ath-miR-157c GTTGACAGAAGATAGAGAGCAC 2 3
ath-miR-157c GTGACAGAAGATAGAGAGGAC 2 5
ath-miR-157c TGACAGAAGATACAGAGCAC 7 4