id_rna sequence raw_count mapping_loci
ath-miR-157d TGACAGAAGATAGAGAGCAC 2306 4
ath-miR-157d GTGACAGAAGATAGAGAGCAC 42 4
ath-miR-157d GGGACAGAAGATAGAGAGCAC 3 4
ath-miR-157d GTGACAGAAGATAGAGAACAC 2 5
ath-miR-157d GTGACAGAAGATAGAGAGCAT 2 4
ath-miR-157d ATGAAAGAAGATAGAGAGCAC 2 6
ath-miR-157d TGACAGAAGATAGAGAGCACC 19 5
ath-miR-157d TGACAGAAGATAGAGAGCACG 3 6
ath-miR-157d TGACAGAAGATAGAGAGCACT 34 2
ath-miR-157d TGACAGAAGATAGTGAGCAC 12 10
ath-miR-157d TGACAGAAGATAGAGCAC 7 9
ath-miR-157d GTGACAGAAGATAGAGAGAAC 2 5
ath-miR-157d TGACAGAAGATAGAGAGTAC 7 4
ath-miR-157d TACAGAAGATAGAGAGCAC 6 4
ath-miR-157d TCACAGAAGATAGAGAGCAC 5 4
ath-miR-157d TGACATAAGATAGAGAGCAC 6 4
ath-miR-157d TAACAGAAGATAGAGAGCAC 3 4
ath-miR-157d TGACAGAAGATAGAGAGCAT 24 4
ath-miR-157d ATGACAGAAGATAGAGAGCAC 6 6
ath-miR-157d TGACAAAAGATAGAGAGCAC 2 4
ath-miR-157d TGACAGAATATAGAGAGCAC 2 4
ath-miR-157d TGACAGAAGCTAGAGAGCAC 3 4
ath-miR-157d TGAAAGAAGATAGAGAGCAC 3 4
ath-miR-157d CGACAGAAGATAGAGAGCAC 5 4
ath-miR-157d TGACAGAAGATAGAGCGCAC 5 4
ath-miR-157d TTGCAGAAGATAGAGAGCAC 5 6
ath-miR-157d TGACAGAAGATATAGAGCAC 5 4
ath-miR-157d GTGACAGAAGATAGAGAGCACG 5 6
ath-miR-157d TGACAGAAGATAGAGAGCACTT 5 2
ath-miR-157d GTGACAGAAGATAGAGAGCAG 2 6
ath-miR-157d GACAGAAGATAGAGAGCA 2 4
ath-miR-157d CACAGAAGATAGAGAGCAC 2 4
ath-miR-157d TGACAGAAGATAGAGATCAC 5 4
ath-miR-157d TGACAGAACATAGAGAGCAC 2 4
ath-miR-157d TGACAGAAGATAGATAGCAC 11 4
ath-miR-157d ACAGAAGATAGAGAGCAC 4 4
ath-miR-157d TGACAGAAGTTAGAGAGCAC 2 4
ath-miR-157d TGACAGAAGATAGAGAGAAC 3 4
ath-miR-157d TGATAGAAGATAGAGAGCAC 10 4
ath-miR-157d CGGAGAGAAGATAGAGAGCAC 2 1
ath-miR-157d TGACAGAAGATAGAGAGCAA 9 4
ath-miR-157d GTGACAGAAGATAGAGAGCA 2 4
ath-miR-157d TTACAGAAGATAGAGAGCAC 41 4
ath-miR-157d TGACAGAAGATAGAGAGCA 20 4
ath-miR-157d TGACAGAAGATAGAGAGCCC 8 4
ath-miR-157d AAGATAGAGAGCAC 2 4
ath-miR-157d TGACAGAAGATAGAGAGGAC 4 4
ath-miR-157d GTGACAGAAGATAGACAGCAC 2 4
ath-miR-157d ACAGAAGATAGAGAGCACTAA 2 2
ath-miR-157d TGACAGAAGATAGAGTGCAC 3 4
ath-miR-157d GGACAGAAGATAGAGAGCAC 3 4
ath-miR-157d TGACAGAAGATAGAGNGCAC 2 4
ath-miR-157d CTGACAGAAGATAGAGAGCAC 35 1
ath-miR-157d CTGACAGAAGATAGAGAGCAT 2 1
ath-miR-157d ATGACAGAAGATAGAGAGCACTC 2 2
ath-miR-157d TGACAGACGATAGAGAGCAC 2 4
ath-miR-157d TGACAGAAGATAGACAGCAC 2 4
ath-miR-157d GTGAGAGAAGATAGAGAGCAC 2 4
ath-miR-157d GACAGAAGATAGAGAGCAC 4 4
ath-miR-157d GTGACAGAAGATAGAGAGGAC 2 5
ath-miR-157d TGACAGAAGATACAGAGCAC 7 4