id_rna sequence raw_count mapping_loci
ath-miR-158a TCCCAAATGTAGACAAAGCA 5567 1
ath-miR-158a TCCCAAATGTAGATAAAGCA 379 1
ath-miR-158a TCTCAAATGTAGACAAAGCA 125 1
ath-miR-158a TCCCAAATGTAGACAAAGCT 69 1
ath-miR-158a TCACAAATGTAGACAAAGCA 16 1
ath-miR-158a TCCCACATGTAGACAAAGCA 3 1
ath-miR-158a TCCCAAATGTAGACAAAGCATTAT 2 1
ath-miR-158a TCCCAAATGTAGACAAA 2 1
ath-miR-158a TCCCAAATGTAGACATAGCA 6 1
ath-miR-158a TCCCAAATGTAGATACAGCA 2 1
ath-miR-158a TCCCAAATGTAGCCAAAGCA 13 1
ath-miR-158a TCCCAAATGTAGACAACGCA 11 1
ath-miR-158a GCTCAAATGTAGACAAAGCA 2 2
ath-miR-158a TCCAAAATGTAGACAAAGC 2 1
ath-miR-158a TCCCAAATGTGGACAAAGCA 3 1
ath-miR-158a TCCCAAATGAAGACAAAGCA 4 1
ath-miR-158a TCCCAAATGGAGATAAAGCA 5 2
ath-miR-158a AAATGTAGACAAAGCA 2 3
ath-miR-158a TTCCCAAATGTAGAAAAAGCA 2 1
ath-miR-158a TCCCAAATGTAGACACAGCA 7 1
ath-miR-158a TCCCAAATGTAGCTAAAGCA 3 1
ath-miR-158a TCCCAAATGGAGACAAAGCA 19 1
ath-miR-158a TCTCAAATTTAGACAAAGCA 2 2
ath-miR-158a TCCTAAATGTAGACAAAGCA 105 1
ath-miR-158a TCTTAAATGTAGACAAAGCAA 2 1
ath-miR-158a TCCCAGATGTAGACAAAGCA 2 1
ath-miR-158a TCCCAAATGTAGACAAAGCAAGT 2 1
ath-miR-158a TCCTAAATGTAGACAAAGC 3 1
ath-miR-158a ACCCAAATGTAGACAAAGCA 7 2
ath-miR-158a TCCTAAATGTAGATAAAGCA 12 2
ath-miR-158a TTCCAAATGTAGACAAAGCA 94 2
ath-miR-158a TCCCAAATGTCGACANAGCA 3 1
ath-miR-158a TCTTAAATGTAGACAAAGCA 75 1
ath-miR-158a TCACAAATGTAGACAAAG 2 2
ath-miR-158a TCCCAAATGTAGACAAAACA 7 1
ath-miR-158a TCCCAAGTGTAGACAAAGCA 2 1
ath-miR-158a TCGAAAATGTAGACAAAGCA 2 2
ath-miR-158a TCCCAAATGTAGACAAAGTA 24 1
ath-miR-158a TCCCAAATGTAGACAAAGCG 3 1
ath-miR-158a TCCCAAATGTAGACAAAGCC 28 1
ath-miR-158a TCCCAAATGTAGACAAAGCN 2 1
ath-miR-158a TCCCAAATGTAGACACAGC 2 1
ath-miR-158a TCCCAAATATAGACAAAGCA 5 1
ath-miR-158a TCCCAAATGTAGACAAAGAA 19 2
ath-miR-158a TCCCAAATGTAGACAAAGAT 2 2
ath-miR-158a TCCCAAATGTAGACCAAGCA 14 1
ath-miR-158a TCCCAAATGTCGACAAAGCA 5 1
ath-miR-158a TCTAAAATGTAGACAAAGCA 2 3
ath-miR-158a TCCCAAATGCAGACAAAGCA 4 1
ath-miR-158a TCCCAAATGTAGACANAGCA 9 1
ath-miR-158a TTCCAAATGTAGATAAAGCA 3 3
ath-miR-158a TCCCAAATGTAGACAAAGGA 2 1
ath-miR-158a TCCGAAATGGAGACAAAGCA 2 2
ath-miR-158a TCCCAAATGTAGACAAAGA 4 2
ath-miR-158a TCCCAAATGTAGACAAAGT 3 1
ath-miR-158a TTCTTAAATGTAGACAAAGCA 3 1
ath-miR-158a CAAATGTAGACAAAGCA 7 3
ath-miR-158a GCCCAAATGTAGACAAAGAA 2 3
ath-miR-158a TCCCAAATGTAGACAAAGCATA 7 2
ath-miR-158a TCCCAAATGTAGACAAAGCATC 2 1
ath-miR-158a TCCCAAATGTAGACAAAGCATT 8 1
ath-miR-158a TCCGAAATGTAGACAAAGCA 3 1
ath-miR-158a TCCCAAATGTAGACAAAGCAA 6 1
ath-miR-158a TCCCAAATGTAGACAAAGCAG 9 1
ath-miR-158a TCCCAAATGTAGACAAAGCAC 11 1
ath-miR-158a GCCCAAATGTAGACAAAGCA 21 2
ath-miR-158a TCCCAAATGTAGTCAAAGCA 2 1
ath-miR-158a TTCCCAAATGTAGACAAAGAA 2 2
ath-miR-158a TTCCCAAATGTAGATAAAGCA 4 1
ath-miR-158a TCCCAAATGTAGACAAAGCTA 7 1
ath-miR-158a TCCCAAATGTAGACAAAGCTT 4 1
ath-miR-158a TCCCAAATGTAGACAAATCA 8 1
ath-miR-158a TCCCAAATGTAGACAAACA 3 5
ath-miR-158a TCCCAAACGTAGACAAAGCA 4 1
ath-miR-158a TCCAAAATGAAGACAAAGCA 2 4
ath-miR-158a TCCCAAATGTAGATAAAGCT 5 1
ath-miR-158a TCCCAAATGTAGAAAAAGCA 8 1
ath-miR-158a TCCCAAATGTAGATAAAGCG 2 1
ath-miR-158a TCCCAAATGTAGATAAAGCC 2 2
ath-miR-158a TCCCAAAGGTAGACAAAGCA 3 1
ath-miR-158a TTCTCAAATGTAGACAAAGCA 5 1
ath-miR-158a TCCCAAATCTAGACAAAGCA 2 1
ath-miR-158a GCCCAAATGTAGATAAAGCA 3 2
ath-miR-158a TACCAAATGGAGACAAAGCA 2 3
ath-miR-158a TCCAAATGTAGACAAAGCA 14 4
ath-miR-158a TCCTAAATGTCGACAAAGCA 2 2
ath-miR-158a TCCCAAATGTAGATAAAGC 3 1
ath-miR-158a TCAAAAATGTAGACAAAGCA 3 3
ath-miR-158a TCCCAATTGTAGACAAAGCA 2 1
ath-miR-158a TCCCAAATGTAGACAAAGC 86 1
ath-miR-158a TAACAAATGTAGACAAAGCA 2 3
ath-miR-158a TCCCAACTGTAGACAAAGCA 2 1
ath-miR-158a CCAAATGTAGACAAAGCA 3 3
ath-miR-158a TCCCAAATGTAGATAAAGTA 2 2
ath-miR-158a TCCCAAATGTATACAAAGCA 6 1
ath-miR-158a GCACAAATGTAGACAAAGCA 3 4
ath-miR-158a TACCAAATGTAGACAAAGCA 10 2
ath-miR-158a TCCCTAATGTAGACAAAGCA 4 2
ath-miR-158a TCCCAAATTTAGACAAAGCA 11 1
ath-miR-158a TCCCAAATGTAGA 3 6
ath-miR-158a TCCCAAATGTAGACTAAGCA 13 1
ath-miR-158a TCCCAAATGTAGACGAAGCA 5 1
ath-miR-158a TCCCAAATGGAGACANAGCA 2 1
ath-miR-158a TCCCAAATGTCGACACAGCA 3 1
ath-miR-158a TTCCCAAATGTAGACAAAGCA 147 1
ath-miR-158a TCCCATATGTAGACAAAGCA 3 1
ath-miR-158a TCCCAAATGTAGATAAAGCAG 2 2
ath-miR-158a TCCCAAATGTAGATAAAGCAT 4 1
ath-miR-158a TCTCAAATGTAGATAAAGCA 12 2
ath-miR-158a TCTCAAATGTAGACAAAGCAT 3 1
ath-miR-158a TCACAAATGTAGATAAAGCA 2 1
ath-miR-158a TTCCAAATGTAGACAAAGCT 2 3
ath-miR-158a GCCCAAATGGAGACAAAGCA 6 2
ath-miR-158a TTTCAAATGTAGACAAAGCA 130 3
ath-miR-158a TCCCCAATGTAGACAAAGCA 3 1
ath-miR-158a TTCCTAAATGTAGACAAAGCA 5 1
ath-miR-158a TCGCAAATGTAGACAAAGCA 3 2
ath-miR-158a TCCAAAATGTAGACAAAGAA 2 5
ath-miR-158a TCCCAAATGTAGACAAAG 37 1
ath-miR-158a CCCAAATGTAGACAAAGCA 5 2
ath-miR-158a TCCAAAATGTAGACAAAGCA 28 1
ath-miR-158a TCCCAAATGTAGACAAAGCAT 108 1
ath-miR-158a TCCCAAATGTAGACAAGGCA 5 1
ath-miR-158a TCCCAAATGTAG 2 16
ath-miR-158a TTTCCAAATGTAGACAAAGCA 3 2
ath-miR-158a TCCCAAATGTAGACAATGCA 4 1
ath-miR-158a TCTTTCCCAAATGTAGACAAA 2 1
ath-miR-158a TCAAATGTAGACAAAGCA 9 3