id_rna sequence raw_count mapping_loci
ath-miR-158b GCCCAAATGTAGACAAAGCA 21 2
ath-miR-158b ACCCAAATGTAGACAAAGCA 7 2
ath-miR-158b GCTCAAATGTAGACAAAGCA 2 2
ath-miR-158b AAATGTAGACAAAGCA 2 3
ath-miR-158b CAAATGTAGACAAAGCA 7 3
ath-miR-158b GCCCAAATGTAGACAAAGAA 2 3
ath-miR-158b GCCCAAATGTAGATAAAGCA 3 2
ath-miR-158b TCCAAATGTAGACAAAGCA 14 4
ath-miR-158b CCAAATGTAGACAAAGCA 3 3
ath-miR-158b GCACAAATGTAGACAAAGCA 3 4
ath-miR-158b TCCCCAAATGTAGACAAAGCA 2 1
ath-miR-158b GCCCAAATGGAGACAAAGCA 6 2
ath-miR-158b CCCCAAATGTAGACAAAGCA 10 1
ath-miR-158b CCCAAATGTAGACAAAGCA 5 2
ath-miR-158b TCAAATGTAGACAAAGCA 9 3