id_rna sequence raw_count mapping_loci
ath-miR-159a TTTGGATTGAAGGGAGCTCTA 182 1
ath-miR-159a TTGGATTGAAGGGAGCTCTA 11 1
ath-miR-159a TTTGGATTGAAGGGAG 6 4
ath-miR-159a TTTGGATTGAAGGGAGCTTA 3 3
ath-miR-159a TTTGGATTGAAGGGAGATCTA 3 1
ath-miR-159a TTTGGATTGACGGGAGCTCTA 2 1
ath-miR-159a TTTGGATTGAAGGGGGCTCTA 2 2
ath-miR-159a TTTGGATTGAAGGG 2 8
ath-miR-159a TTTGGATTGAAGGGA 4 6
ath-miR-159a TTTGGATTGAATGGAGCTCTA 3 1
ath-miR-159a TTTGGATTGAAGGGAGCTC 9 3
ath-miR-159a TTTGGATTGAAGGGAGCTTTA 6 1
ath-miR-159a TTTGGATTGAAGGGAGCT 7 3
ath-miR-159a TTTGGATTGAAGGTAGCTCTA 2 1
ath-miR-159a TTTGGATTGAAGGGAGCTCTAA 5 1
ath-miR-159a TTTGGATTGAAGTGAGCTCTA 4 1
ath-miR-159a TTTGGATTGCAGGGAGCTCTA 3 1
ath-miR-159a TTTGGATTGAAGGGAGCTATA 4 1
ath-miR-159a GTTGGATTGAAGGGAGCTCTA 4 1
ath-miR-159a TTTGGATTGAAGGGAGCTCT 4 2
ath-miR-159a TTGGGATTGAAGGGAGCTTTA 2 1
ath-miR-159a TTTGGATTGAAGGGANCTCTA 3 1
ath-miR-159a TTTGGATTGAAGGGAGC 19 3
ath-miR-159a TTTGGATTGAAGGGAGA 3 14
ath-miR-159a TTTGGATCGAAGGGAGCTCTA 2 1
ath-miR-159a TTTGGATTGAAGGGAGTTCTA 12 1
ath-miR-159a TTTGGATTGAACGGAGCTCTA 2 1