id_rna sequence raw_count mapping_loci
ath-miR-159b TTTGGATTGAAGGGAGCTCTT 20 1
ath-miR-159b TTTGGATTGAAGGGAGCTC 9 3
ath-miR-159b TTTGGATTGAAGGGAG 6 4
ath-miR-159b TTTGGATTGAAGGGAGCTTA 3 3
ath-miR-159b TTTGGATTGAAGGG 2 8
ath-miR-159b TTTGGATTGAAGGGA 4 6
ath-miR-159b TTTGGATTGAAGGGAGCT 7 3
ath-miR-159b TTTGGATTGAAGGGAGCTCTTC 3 1
ath-miR-159b TTTGGATTGAAGGGAGCTCT 4 2
ath-miR-159b TTTGGATTGAAGGGAGC 19 3
ath-miR-159b TTTGGATTGAAGGGAGA 3 14
ath-miR-159b TTTGGATTGAAGGGAGTTCTT 3 1