id_rna sequence raw_count mapping_loci
ath-miR-159c TTTGGATTGAAGGGAGC 19 3
ath-miR-159c TTTGGATTGAAGGGAGCTC 9 3
ath-miR-159c TTTGGATTGAAGGGAG 6 4
ath-miR-159c TTTGGATTGAAGGGAGCTTA 3 3
ath-miR-159c TTTGGATTGAAGGG 2 8
ath-miR-159c TTTGGATTGAAGGGA 4 6
ath-miR-159c TTTGGATTGAAGGGAGCT 7 3
ath-miR-159c TTTGGATTGAAGGGAGA 3 14