id_rna sequence raw_count mapping_loci
ath-miR-160a TGCCTGGCTCCCTGTATGCCA 754 3
ath-miR-160a TGCTTGGCTCCCTGTATGCCA 68 3
ath-miR-160a TGCCTGGCTTCCTGTATGCCA 14 3
ath-miR-160a TGCTGGCTCCCTGTATGCCA 6 5
ath-miR-160a ATGCTTGGCTCCCTGTATGCC 3 2
ath-miR-160a CTGGCTCCCTGTATGCCA 3 3
ath-miR-160a ATGCCTGGCTTCCTGTATGCC 2 2
ath-miR-160a TGCCTGTCTCCCTGTATGCCA 2 3
ath-miR-160a TTTGGCTCCCTGTATGCCA 2 4
ath-miR-160a TGTCTGGCTCCCTGTATGCCA 12 3
ath-miR-160a TGCCTGGCTCCCTGTATGCCAT 2 1
ath-miR-160a GGCCTGGCTCCCTGTATGCCA 2 3
ath-miR-160a ATGCCTGGTTCCCTGTATGCC 3 2
ath-miR-160a TGCTTGGCTCTCTGTATGCCA 3 3
ath-miR-160a TGCCTGGATCCCTGTATGCCA 2 3
ath-miR-160a TGCCTCGCTCCCTGTATGCCA 2 3
ath-miR-160a TGTTTGGCTCCCTGTATGCCA 5 3
ath-miR-160a TGCCTGGCTCCTTGTATGCCA 24 3
ath-miR-160a TGGCTCCCTGTATGCCA 2 3
ath-miR-160a TCCTGGCTCCCTGTATGCCA 5 3
ath-miR-160a ATGCCTGGCTCC 7 7
ath-miR-160a TGCCTGGCTCCCTGTATGCCC 16 3
ath-miR-160a TGCCTGGCTCCCTGTATGCCT 14 4
ath-miR-160a ATGCCTGGCTCCCTGTATGC 3 2
ath-miR-160a CCTGGCTCCCTGTATGCCA 2 3
ath-miR-160a ATGCCTGGCTCCC 3 3
ath-miR-160a TGCCTGGCTTTCTGTATGCCA 2 3
ath-miR-160a TGCCTGGCTCCCTGTATTCCA 2 4
ath-miR-160a TGCCTGGCTCCCTGTATGACA 3 3
ath-miR-160a TGCCTGGCTCCC 27 6
ath-miR-160a TGCCTGGCTCTCTGTATGCCA 20 3
ath-miR-160a ATGCCTGGCTCCCTGTATGCC 152 2
ath-miR-160a TCTGGCTCCCTGTATGCCA 2 3
ath-miR-160a ATGCCTGGCTCCTTGTATGCC 7 2
ath-miR-160a TGCTTGGCTCCTTGTATGCCA 2 4
ath-miR-160a ATGTCTGGCTCCCTGTATGCC 2 2
ath-miR-160a TGACTGGCTCCCTGTATGCCA 2 3
ath-miR-160a TTCCTGGCTCCCTGTATGCCA 2 3
ath-miR-160a ATGCCTGGCTCCCTGTATGCT 2 2
ath-miR-160a TCCCTGGCTCCCTGTATGCCA 4 3
ath-miR-160a ATGCCTGGCTTTCTGTATGCC 2 2
ath-miR-160a TTGGCTCCCTGTATGCCA 5 3
ath-miR-160a TGCCTGGCTCCCTGTATGCC 4 3
ath-miR-160a TGCCTGGCTCC 106 13