Forgot password? Reset it!

 Back to Results Overview 

Results for Project: Osanto_et_al_Reneal_Cancer (7277231af3)


Condition: Control - Phenotype: SRR491337_fastq
Filter:

Download complete Table · Download complete Table (decimal-comma)
id raw_count normalized_mapping_loci type most_prominent_tag
sequence
most_prominent_tag
raw_count
most_prominent_tag
mapping_loci
Alignment of
all sequences
Add to
favorites
hsa-let-7a-1_precursor 6798 2050.98 pre_miRNA GAGGTAGTAGGTTGTATAGTT 876 3 Show
hsa-let-7a-2_precursor 6777 2044.12 pre_miRNA GAGGTAGTAGGTTGTATAGTT 876 3 Show
hsa-let-7a-3_precursor 6718 1992.14 pre_miRNA GAGGTAGTAGGTTGTATAGTT 876 3 Show
hsa-let-7a-3p 138 63.7 mature_miRNA TATACAATCTACTGTCTTTCT 25 2 Show
hsa-let-7a-5p 20155 6023.54 mature_miRNA GAGGTAGTAGGTTGTATAGTT 876 3 Show
hsa-let-7b-3p 53 34.5 mature_miRNA TATACAACCTACTGCCTTCCT 22 2 Show
hsa-let-7b-5p 4807 3598.71 mature_miRNA GAGGTAGTAGGTTGTGTGGTT 777 1 Show
hsa-let-7b_precursor 4862 3635.21 pre_miRNA GAGGTAGTAGGTTGTGTGGTT 777 1 Show
hsa-let-7c 2292 1267.71 mature_miRNA GAGGTAGTAGGTTGTATGGTT 189 1 Show
hsa-let-7c_precursor 2295 1270.71 pre_miRNA GAGGTAGTAGGTTGTATGGTT 189 1 Show
hsa-let-7d-3p 15 13.5 mature_miRNA TATACGACCTGCTGCCTTTCT 8 1 Show
hsa-let-7d-5p 1141 715.138 mature_miRNA GAGGTAGTAGGTTGCATAGT 202 1 Show
hsa-let-7d_precursor 1156 728.638 pre_miRNA GAGGTAGTAGGTTGCATAGT 202 1 Show
hsa-let-7e-3p 6 6.0 mature_miRNA TATACGGCCTCCTAGCTTTCC 6 1 Show
hsa-let-7e-5p 906 620.103 mature_miRNA GAGGTAGGAGGTTGTATAGTT 121 1 Show
hsa-let-7e_precursor 912 626.103 pre_miRNA GAGGTAGGAGGTTGTATAGTT 121 1 Show
hsa-let-7f-1-3p 15 12.3333 mature_miRNA TATACAATCTATTGCCTTCCT 9 1 Show
hsa-let-7f-1_precursor 4017 1875.85 pre_miRNA GAGGTAGTAGATTGTATAGTT 619 2 Show
hsa-let-7f-2-3p 27 25.5 mature_miRNA TATACAGTCTACTGTCTTTCT 23 1 Show
hsa-let-7f-2_precursor 3868 1770.7 pre_miRNA GAGGTAGTAGATTGTATAGTT 619 2 Show

1 of 59 next