id_rna sequence raw_count mapping_loci
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCT 104 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCCT 4 2
mmu-let-7a-1-3p TATACAATCTACTGTCTTTCTT 2 2
mmu-let-7a-1-3p TACAATCTACTGTCTTT 2 4
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCCA 3 2
mmu-let-7a-1-3p TATACAATCTACTGTCTT 2 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCGT 2 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCC 101 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCG 8 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTC 66 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCTG 2 3
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCTA 4 3
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCTT 4 2
mmu-let-7a-1-3p TATACAATCTACTGTCTTTCC 3 2
mmu-let-7a-1-3p TATACAATCTACTGTCTTTCT 4 3
mmu-let-7a-1-3p ATCTACTGTCTTTCC 2 16
mmu-let-7a-1-3p TATACAATCTACTGTCTTTC 2 2
mmu-let-7a-1-3p CTATACAATCTACT 2 25
mmu-let-7a-1-3p CTATACAATCTACTGTCTTT 52 2