id_rna sequence raw_count mapping_loci
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTT 857231 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAT 1334 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTT 1287 3
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTT 44 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTTA 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTTT 13 3
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTTAA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTG 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTA 16 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTT 174 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTA 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTTTAA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAT 133 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAG 12 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAA 197 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAC 4 1
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGG 5 1
mmu-let-7b-5p NGAGGTAGTAGGTTTTGTGGTT 6 2
mmu-let-7b-5p GGTAGTAGGTTGTGTTGTT 2 1
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGTTT 3 2
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGTTA 12 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACA 35 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACC 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACG 30 1
mmu-let-7b-5p TCGTAGTAGGTTGTGTGGTT 4 4
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGG 5 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTT 10 2
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTA 8 2
mmu-let-7b-5p GAGGTAGTAGTTTGTGTGGTTT 3 2
mmu-let-7b-5p GAGGTAGTAGTTTGTGTGGTTA 4 2
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTT 230 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGG 338 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGA 14 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGT 8 3
mmu-let-7b-5p TAGTAGGTTGTGTGGTTGAA 2 8
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTAC 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTTA 10 1
mmu-let-7b-5p TGAGGTAGTAAGTTTTGTGGTT 2 6
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGT 65 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGT 63 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGA 3 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTT 527 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTA 10 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTAT 7 3
mmu-let-7b-5p GTAGGTTGTGTGGTTAC 16 5
mmu-let-7b-5p TGAGGTAGTAGGTTATG 2 9
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTAA 9 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTT 415 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTGA 2 2
mmu-let-7b-5p TGATGTAGTAGGTTGTGTG 5 3
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTA 89 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAGAG 68 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTTGA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGT 107 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTA 16249 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTC 265 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTG 541 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTN 51 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTTA 4 2
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTA 4 1
mmu-let-7b-5p GTAGGTTGTGTGGTTTAAG 3 1
mmu-let-7b-5p GAGGTAGCAGGTTGTGTGGTT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTAT 6 1
mmu-let-7b-5p GTAGGTTGTGTGGTTTAAT 5 41
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTATG 24 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTTTT 42 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAG 5079 2
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGAGGTAGGTTGTGTGGTT 11 2
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGG 26 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCA 26 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCC 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTAT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGG 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGA 8 40
mmu-let-7b-5p CAGGTAGTAGGTTGTGTGG 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTTT 21 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTTA 20 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTTT 5 2
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTTA 7 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTTT 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATTA 2 2
mmu-let-7b-5p TGATCTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTGT 4 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTTAA 5 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTTAT 2 2
mmu-let-7b-5p TGAGGTAGTAGTTTGTGCGGTTT 3 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGGT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTTA 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTTT 12 2
mmu-let-7b-5p GAGTAGTAGGTTGTGTGGTT 6 7
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTTGA 2 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTG 3 3
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTT 4351 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTT 16 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTA 11 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTTTA 2 2
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTTTT 3 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGG 8 2
mmu-let-7b-5p TGAGGTAGTGTGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTT 12 1
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTT 15 1
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTA 17 1
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTA 13 2
mmu-let-7b-5p NGAGGTAGTAGGTCGTGTGGTT 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTG 71 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTA 1028 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTC 24 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTT 1236 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTT 87 1
mmu-let-7b-5p GAGGTATTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p GGTAGTAGGTTGT 3 43
mmu-let-7b-5p AGGTAGTAGGTTGTGTGA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTT 70 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTG 5 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTA 75 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGGTT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGGTA 3 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTT 23 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGT 6 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTT 165 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTA 3 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTT 19 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTAT 4 6
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCTT 4 8
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTTTA 2 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTT 115 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTC 2 2
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTA 110 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTT 119 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTG 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTATAA 4 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAAG 11 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAAC 6 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAAT 23 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGTTT 22 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGTTA 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTT 43 1
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGG 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTG 1547 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAAT 335 1
mmu-let-7b-5p TTAGGTAGTATGTTGTGTGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAAA 39774 1
mmu-let-7b-5p CGATGAGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTT 36 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTG 3 2
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTA 48 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGCGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTAT 7 1
mmu-let-7b-5p NTAGGTTGTGTGGTTT 7 13
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAAAGG 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGG 27 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGT 3 2
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTT 181 1
mmu-let-7b-5p TAGTAGGTTGTGTG 2 15
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTT 168 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTTAA 14 2
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTG 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGT 370 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGG 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGC 29 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGA 734 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGT 776 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGA 1305 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGC 31 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTC 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTA 127 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTT 214 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTG 10 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTT 201 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGT 21 1
mmu-let-7b-5p NTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p GTAGGTTGTGTGGTTTTA 4 9
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGA 3 6
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTAA 8 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTAT 8 2
mmu-let-7b-5p TAGTAGGTTGTGTGG 64 3
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGT 114 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAA 1711 2
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGTT 42 2
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTAA 5 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGT 45 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTT 66 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTA 63 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAGG 14 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTAT 13 2
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTG 3 7
mmu-let-7b-5p GAGGTAGGAGGTTGTGGGGTTT 2 12
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTAT 11 1
mmu-let-7b-5p GAGGTAGTGGGTTGTGTGGT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTA 2 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTA 4 1
mmu-let-7b-5p GAGTTAGTAGGTTGTGTGGT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTAT 4 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTT 10 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTT 287 3
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGG 73 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGA 2 9
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGA 3945 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGG 64835 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGT 1440 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTT 160 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAT 12 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAG 47 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAA 31 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGG 5 1
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTT 40 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCAGTT 2 6
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTT 276 1
mmu-let-7b-5p NGCGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTT 260 1
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTT 105 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTA 82 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTTT 12 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGG 40 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGG 17 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGA 2 3
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTTT 4 2
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTGAA 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTTAAG 2 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTTAA 7 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGCGGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCAA 190 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTTTGGTT 6 3
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAAA 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAAG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAAT 12 1
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGT 16 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTT 571 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTA 6 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTT 508 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTA 5 3
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTT 41 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTA 37 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTG 4 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGT 2 15
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTTA 17 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGNTT 5 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTAT 70 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTA 5 2
mmu-let-7b-5p AGTAGGTTGTGTGGTTTAA 17 3
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTTA 34 1
mmu-let-7b-5p NTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGT 56 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGG 21 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGA 2 3
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTT 271 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGG 3 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTA 6 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGC 222 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGA 7504 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGG 48 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGN 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGT 6178 2
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTT 53 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTCA 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTCC 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTCT 6 3
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTT 1809 1
mmu-let-7b-5p GAGTTAGTAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGA 5 9
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTC 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTAT 2 1
mmu-let-7b-5p GAGGTAGTCGGTTGTGTGGTT 2 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTT 27 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTA 17 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTA 3 3
mmu-let-7b-5p GTAGTAGGTTGTGTGGTA 12 7
mmu-let-7b-5p GTAGTAGGTTGTGTGGTT 462 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTT 585 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTG 6 5
mmu-let-7b-5p GAGGTAGTAGGTTGTGGGGTT 5 2
mmu-let-7b-5p TAGTAGGTTGTGTGGTAAC 2 20
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAGA 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTNA 2 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTT 43 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTAAG 3 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTAGA 3 14
mmu-let-7b-5p GAGGTAGTAGGTTGTTTGGT 2 3
mmu-let-7b-5p NGAGGTAGTAGGTTGT 7 11
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATC 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATA 19 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATT 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTATA 1475 1
mmu-let-7b-5p NGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTTTA 3 2
mmu-let-7b-5p GGTAGTAGGTTGTGTG 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTNAA 4 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGG 34 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATAT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCTT 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCTA 9 2
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTTAA 11 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAAA 26 1
mmu-let-7b-5p NGAGGTAGTGGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTT 63 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTTA 20 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTTG 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGA 8 2
mmu-let-7b-5p TGAGTTAGTAGGTTTTGTGGTT 3 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTT 384 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTC 13 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTA 306 2
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTTA 5 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTTT 4 26
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTTAA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAG 1088 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAC 205 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAT 1723 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTN 69 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTG 11887 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTC 4364 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTA 202035 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTT 246314 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTGT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTGA 9 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTA 3429 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGGA 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTT 3426 2
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTT 33 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTA 59 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTANA 2 1
mmu-let-7b-5p TGGGTTAGTAGGTTGTGTGGTT 2 4
mmu-let-7b-5p AGTAGGTTGTGTGG 97 20
mmu-let-7b-5p NGAGGTAGTAGGTTGTGA 2 24
mmu-let-7b-5p AGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTTT 23 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTTT 14 2
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTA 68 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTG 6 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGA 10 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGT 36 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTT 502 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTA 16 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGGGGT 2 3
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGG 8 2
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTA 2 3
mmu-let-7b-5p TGAGGTATTAGGTTTTGTGGTT 2 2
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGT 17 3
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAG 83 3
mmu-let-7b-5p GAGGTAGTAGGTTGTATGGTTTC 6 3
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGT 50 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCGA 8 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGT 45 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTT 23 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTA 21 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTTTT 2 3
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGGTTGGTT 7 10
mmu-let-7b-5p GAGGTAGTAGGTTGTTTGGTT 6 3
mmu-let-7b-5p NGAGGTAGCAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTT 78 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGT 26 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGG 7 2
mmu-let-7b-5p GAGGTAGCAGGTTGTGTGGT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTTTA 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTCAA 2 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTT 48 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTG 3 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTA 31 1
mmu-let-7b-5p GAGGTAGTAGGTTATGTGGT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTTTT 5 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGAT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTAC 2 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTTAA 5 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTAT 8 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGA 80 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGG 946 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGT 14 3
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTA 92 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTT 100 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTG 13 3
mmu-let-7b-5p GGCAGTAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTTAAG 2 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTAT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTTAA 2 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGT 49 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTTA 7 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTTG 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGTT 8 8
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTTT 3 2
mmu-let-7b-5p GTGAGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTT 71 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTA 57 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTG 4 1
mmu-let-7b-5p NTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAAAG 11 1
mmu-let-7b-5p GAGGTAGTAGTTTGTGTGGTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTAT 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGAAG 118 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTAT 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGG 17 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGA 2 13
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTTTT 6 2
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTG 2 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTA 30 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGT 37 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTA 91 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTG 3 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTAT 8 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGT 38 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGT 158 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGA 4 5
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTT 15 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTA 9 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p TAGGTTGTGTGGTT 407 27
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGG 6 2
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTT 53 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTG 2 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTA 25 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTTT 4 3
mmu-let-7b-5p TCTGAGGTAGTAGGTTGTGTGGTT 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCTGTTT 20 3
mmu-let-7b-5p GGTAGTAGCTTGTGTGGTTT 2 2
mmu-let-7b-5p GGTAGTAGGTTTTGTGGTT 3 8
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTAA 4 1
mmu-let-7b-5p TGAGGGGGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGCTAGTAGGTTGTGTGGTTT 2 5
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTT 94 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTTT 10 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGT 23 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTT 489 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTA 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTG 8 4
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTTT 6 4
mmu-let-7b-5p TTAGGTAGTAGGTTTTGTGGTT 2 10
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTA 5 3
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGG 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTTG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTAT 13 3
mmu-let-7b-5p TGAGGTAGTAGGTGTTGTGGT 2 5
mmu-let-7b-5p GAGGTAGTAGGTTGT 25 11
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTA 3 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGT 10 2
mmu-let-7b-5p NGAGGTAGTAGTTTGTGTGGT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAA 103 16
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTT 28 1
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTG 3 2
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTA 13 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTAT 12 4
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGG 6 1
mmu-let-7b-5p GTAGGTTGTGTGGT 694 15
mmu-let-7b-5p GTAGTAGGTTGTATGGTTTAAG 2 5
mmu-let-7b-5p TGAGGGAGTAGGTGGTGTGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTACG 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTTA 4 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAA 349 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAC 18 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAT 214 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAG 30 3
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTAC 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGAA 1767 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTGT 5 9
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTT 22 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTG 2 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTA 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATTAG 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTTTGGTTA 4 3
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGG 18 2
mmu-let-7b-5p TGATAGTAGGTTGTGTGGT 2 32
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGTTT 6 1
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGTTA 7 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTN 7 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTAT 25 4
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTAA 17 2
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTAG 10 2
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTT 262 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCG 19 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTTT 29 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTTA 27 1
mmu-let-7b-5p AGTAGGTTGTGTGGTAT 6 19
mmu-let-7b-5p GAGGTAGTAGGTTGTCTGGTT 6 3
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTA 2 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTTT 23 9
mmu-let-7b-5p AGTAGGTTGTGTGGTTTA 9 10
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGG 3 5
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAC 21 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAG 120 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAT 1278 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTTA 2 3
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTAT 5 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTT 129 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTG 4 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTA 101 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTC 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGTAG 32 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTC 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTA 131 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTG 15 3
mmu-let-7b-5p TGACGTAGTAGGTTGT 2 15
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAGT 82 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAGC 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAGA 92 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGG 20 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCTC 2 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTTAA 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTTA 2 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTG 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTC 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTT 9423 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGGTT 3 2
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTA 34 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTACA 2 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTAC 3 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTTT 11 2
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGTTT 2 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTG 7 19
mmu-let-7b-5p AGTAGGTTGTGTGGTTC 3 14
mmu-let-7b-5p AGTAGGTTGTGTGGTTA 158 20
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTT 4 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGGTT 2 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGA 4 5
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGTTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACAGT 5 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTGA 6 6
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTGT 5 16
mmu-let-7b-5p NGAGGTAGTAGGTTGTG 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTAA 24 2
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGT 49 1
mmu-let-7b-5p TGGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCT 118 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCC 24 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCG 63 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCA 98 2
mmu-let-7b-5p TAAGTAGTAGGTTGTGTGGTT 3 4
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTAT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTATAG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTGA 352 4
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTT 110 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTG 3 2
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTA 84 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTC 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTTA 11 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTTT 19 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTTTA 4 3
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTG 31 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGT 55 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGT 12 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTTA 6 2
mmu-let-7b-5p TGAGGGAGGAGGTTGTGTGGTT 4 3
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTG 3 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTA 40 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTT 41 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGCT 2 1
mmu-let-7b-5p TGTAGTAGGTTGTGTGG 12 16
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTGT 10 4
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTGA 9 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAG 299 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAC 22 1
mmu-let-7b-5p GAGGTAGTAGGGTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTT 9 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTA 9 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTGA 2 2
mmu-let-7b-5p TGAGGTATTAGGTTGTTTGGTT 2 6
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTGT 3 3
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTTTA 3 9
mmu-let-7b-5p GAGGTAGCAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTTT 39 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTA 18 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGGTTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTTG 12 2
mmu-let-7b-5p AGTAGGTTGTGTGGTT 617 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTG 13 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTT 72 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTA 65 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATC 33 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATA 221 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATG 34 1
mmu-let-7b-5p TGAGGGAGTCGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCT 33 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATTA 25 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTCTG 8 37
mmu-let-7b-5p GAGGTAGTAGGTTATGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGCA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAA 5260 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTTAG 4 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGT 98 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTT 252 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTC 2 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTA 124 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGGTTA 2 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTTT 7 2
mmu-let-7b-5p TGAGGTAGTAGGTTGT 1390 8
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTT 38 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTA 41 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCT 157 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCA 6 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTGAA 27 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGT 31 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTAA 13 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAAT 3 4
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTGC 4 1
mmu-let-7b-5p TGATGTAGTAGGTTGTTTGGTT 2 4
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTGT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTC 119 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTA 3 2
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGT 7 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGCGGTTAC 2 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTTA 4 2
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTT 493 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTA 7 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTTGGGTT 3 7
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTC 3 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTG 2 2
mmu-let-7b-5p TAGGTTGTGTGGTTT 85 13
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTG 2 4
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTA 214 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTAC 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTGA 90 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTGT 23 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTG 8 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTA 128 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGG 52 3
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTT 196 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTG 7 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTA 153 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGGT 9 4
mmu-let-7b-5p NGAGGTAGTAGGTTGTGT 8 2
mmu-let-7b-5p TCTGAGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGTTTT 2 5
mmu-let-7b-5p GTAGTAGGTTGTGTGGTAT 5 4
mmu-let-7b-5p GTAGTAGGTTGTGTGGTAA 20 28
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGT 51 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGAT 2 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCGA 27 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTT 121 1
mmu-let-7b-5p GAGGCAGTAGGTTGTGTGGT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAGG 31 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGG 14 1
mmu-let-7b-5p GGTAGTAGGTTGTG 2 9
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGT 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGCAT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCG 3 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTT 97 1
mmu-let-7b-5p GGTAGTAGGTTGTGTCGTT 2 1
mmu-let-7b-5p GTAGGTTGTGTGGTTTT 54 41
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGT 29 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTCTGGTT 2 4
mmu-let-7b-5p NGAGGTAGTATGTTGTGTGGTT 4 1
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTT 142 3
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAGA 12 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAC 2423 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAT 109468 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAA 113693 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAN 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTAC 2 1
mmu-let-7b-5p GAGGTAGGAGGTTGTGTGGTTT 2 2
mmu-let-7b-5p GAGGTAGGAGGTTGTGTGGTTA 3 5
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTA 10 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATT 99 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATA 9 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTATA 19 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTT 30 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTT 314 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTG 2 10
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTA 15 4
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTT 60 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGG 23 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGG 10 1
mmu-let-7b-5p GAGGTAGTAGGTTG 38 26
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGG 2 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCAAG 12 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATT 45 2
mmu-let-7b-5p TGTAGTAGGTTGTGTGGT 30 7
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTAT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTTGT 2 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTTT 14 2
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTTA 7 2
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTT 36 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAAA 531 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTATAG 352 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTTT 20 2
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTTA 18 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAT 57 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAC 13 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAA 449 5
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAG 43 2
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGT 24 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTGA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCTAG 2 1
mmu-let-7b-5p GATGTAGTAGGTTGTGTGGTT 12 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGG 40 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGA 4 3
mmu-let-7b-5p NGTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGT 42 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGA 2 3
mmu-let-7b-5p GTAGTAGGTTGTGTG 2 5
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTNT 13 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTNA 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAT 224 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAG 89 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAC 21 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAA 1205 2
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGT 33 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTAT 3 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGG 2 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTTT 8 2
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGT 17 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGG 12 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGT 128 3
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTT 36 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTTAA 3 5
mmu-let-7b-5p TAGTAGGTTGTGTGGTA 12 16
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTAG 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTT 222 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTC 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTA 166 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTG 12 3
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTA 4 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b-5p TGAGGTAGTAGGTT 5169 17
mmu-let-7b-5p NGAGGTACTAGGTTGTGTGGTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTAC 4 1
mmu-let-7b-5p NGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTA 4 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGT 95 1
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTTA 7 13
mmu-let-7b-5p TGAGGTAGTAGGTTGTTT 11 15
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTT 54 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTC 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTA 53 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTG 7 2
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTTTA 4 2
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTTA 4 2
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTTT 5 2
mmu-let-7b-5p GAGGTAGTAGGTTGCGTGGTTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGG 21 2
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGG 21 1
mmu-let-7b-5p GAGGTAGTATGTTGTGTGGTT 2 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTTGT 2 2
mmu-let-7b-5p TTGAGGTAGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTCGTT 2 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGG 15 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTTT 4 3
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGT 774 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGC 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGA 9 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTT 66 1
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGTT 96 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGT 6 2
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7b-5p TGGGGTAGTAGGTTGTTTGGTT 2 4
mmu-let-7b-5p TGAGGTCGTCGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTAGTTT 2 6
mmu-let-7b-5p TAGTAGGTTGTGTGGTTG 8 4
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGG 37 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGA 4 5
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGG 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGNT 39 1
mmu-let-7b-5p AGGGAGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGG 39 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTAT 3 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTAG 3 17
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTAA 22 11
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGT 20 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTG 110 1
mmu-let-7b-5p NGAGGTAGCAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTG 3 24
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTT 260 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTA 12 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTCA 4 2
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTTT 22 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTTA 8 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGG 2 2
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGAC 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAAA 76 3
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTA 9 1
mmu-let-7b-5p TGATAGTAGGTTGTGTGGTT 6 14
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGT 59 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTT 325 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTA 4 4
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTCT 3 3
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTTC 2 1
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTTT 6 2
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p GTAGGTTGTGTGGTT 4403 3
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTAA 73 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTTGTT 3 9
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTT 157 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAGG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAGA 237 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAGT 190 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAGC 12 1
mmu-let-7b-5p NTAGGTTGTGTGGTT 20 27
mmu-let-7b-5p GGGGTAGTAGGTTGTGTGGTT 8 1
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTT 60 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAGA 38 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAAT 40 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGN 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGG 30 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGA 2683 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGC 141 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGT 149476 1
mmu-let-7b-5p TTATGTAGTAGGTTGTGTGGTT 3 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGG 40 2
mmu-let-7b-5p GAGGCAGTAGGTTGTGTGG 2 2
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGT 46 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTG 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGT 62 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTACA 6 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTTAA 10 1
mmu-let-7b-5p GAGGTAGTAGGCTGTGTGGT 2 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGT 3 6
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTTA 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTTT 8 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTTTAA 4 3
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTTAA 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTAT 2 4
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTT 125 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTT 114 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTA 9 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTT 19 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGNTT 13 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGNTA 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTG 5 5
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGT 108 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGA 3 4
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTT 18 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTAT 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGTTA 5 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTT 48 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTA 40 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTG 3 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTTT 17 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTG 19 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAAG 61 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTAC 2 1
mmu-let-7b-5p NAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGG 9 2
mmu-let-7b-5p TGAGGTCGTAGGTTGTCTGGTT 2 3
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTA 8 3
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTT 506 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTA 54 2
mmu-let-7b-5p GAGCTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGT 94 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTGGGTTT 2 5
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTT 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTA 8 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGG 8 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTCTGGTT 2 3
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCTT 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCTA 10 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGT 43 1
mmu-let-7b-5p TGAGGTAGTAGGTTG 1284 10
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTT 42 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAT 85 12
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAG 20 12
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAA 93 5
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTATC 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTATA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTGA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGC 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGA 177 6
mmu-let-7b-5p TGAGGTAGTAGGTTGTGG 72 7
mmu-let-7b-5p TGAGGTAGTAGGTTGTGT 2299 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTT 320 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTA 9 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGG 2 2
mmu-let-7b-5p AATGAGGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAGA 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTA 29 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTG 7 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGGGGTT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTT 60 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTA 39 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTG 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCTA 44 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTAT 5 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGA 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTTT 2 2
mmu-let-7b-5p AGTAGGTTGTGTGGTTGAA 2 37
mmu-let-7b-5p NGTAGTAGGTTGTGTGGTT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACAAG 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGT 54 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTAT 5 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGT 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTAT 2 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGT 19 9
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAG 24 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAA 84 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAT 97 6
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTAT 7 1
mmu-let-7b-5p GAGGTAGTACGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTTAA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTTT 72 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTTG 15 5
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTTA 90 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAAC 9 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTGA 11 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTC 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTGC 195 3
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGG 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTT 153 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGG 27 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTT 19 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTA 18 1
mmu-let-7b-5p GAGGTAATAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTT 143 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTA 4 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTG 2 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTA 15 2
mmu-let-7b-5p GAGGTAGTAGGTTGTTTGG 3 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTNT 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTNA 12 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGTA 10 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTCTGGT 2 3
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTAT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGT 4 3
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTA 16 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTT 20 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGT 65 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGA 4 4
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTAA 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTATCA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGG 11 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGT 79 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAGC 49 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTT 6 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGG 35 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATGA 49 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTT 508 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTA 13 3
mmu-let-7b-5p GTAGTAGGTTGTG 2 46
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTATTT 4 5
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTT 39 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTG 4 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTAAAG 2 14
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGTT 2 3
mmu-let-7b-5p GTAGTAGGTTGTGTGGT 57 1
mmu-let-7b-5p TGAGGTGGTGGGTTGTGTGGTT 3 4
mmu-let-7b-5p CTAGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTT 276 1
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGTT 10 2
mmu-let-7b-5p TAGTAGGTTGTGTGCTT 2 14
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p GAGGTAGTAGTTTGTGTGGT 2 2
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGCT 2 4
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTT 278 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTC 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTA 69 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTT 814 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTG 12 1
mmu-let-7b-5p TGGGTAGTAGGTTGTGTGGTT 18 7
mmu-let-7b-5p GAGGTAGTTGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTTTT 3 2
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTAT 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTTAA 6 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGTTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTATC 23 3
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGA 2 2
mmu-let-7b-5p GTACGTTGTGTGGTTT 2 34
mmu-let-7b-5p GAGGTAGTAGGTTGTGTAGTT 6 3
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAAA 28 1
mmu-let-7b-5p GGTAGTAGGTTGTTTGGTT 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAGT 15 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAGA 4 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGG 23 1
mmu-let-7b-5p TGAGGTAGTAGGTGTTGTGGTT 3 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTG 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTTAA 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTT 170 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTTT 2 2
mmu-let-7b-5p GGTAGTAGGTTGTTTGGTTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTAAG 2 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b-5p TATGTAGTAGGTTGTGTGGTT 8 3
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTT 25 1
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTA 17 2
mmu-let-7b-5p GTAGTAGGTTCTGTGGTTT 2 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTAAA 7 3
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGG 19 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTA 22 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTT 23 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTGT 6 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTTA 16 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTAAA 2 3
mmu-let-7b-5p GAGGTAGTAGGTTGCGTGGTT 5 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTT 61 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTA 2 4
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTA 98 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTC 3 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTG 9 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTT 109 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTG 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGA 11 13
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTAC 1159 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTGC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTT 44 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTTT 36 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTTA 8 2
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTTT 21 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTAA 5 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTT 292 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTAAA 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAAG 2 1
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTAT 2 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTA 11 2
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTT 10 2
mmu-let-7b-5p TGAGGTCGTCGGTTGTGTGGTT 3 2
mmu-let-7b-5p GGGAGTAGGTTGTGTGGTT 4 2
mmu-let-7b-5p GTAGGTTGTGTGGTTTA 32 24
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGCAA 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTT 252 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTAC 4 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTTGTTTA 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTCG 3 2
mmu-let-7b-5p TAGTAGGTTGTGTGGTTT 186 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTAGTT 2 4
mmu-let-7b-5p GAGGTAGTAGGTTGTGT 43 2
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGT 18 1
mmu-let-7b-5p TGAGGAGGTAGGTTGTGTGGT 8 3
mmu-let-7b-5p GACGTAGTAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAAC 292 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTC 545 3
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGT 3 3
mmu-let-7b-5p GAGGTAGTAGGTCGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTCGGTT 2 3
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTG 2 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGG 3 4
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGT 19 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTTA 6 2
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAGT 25 1
mmu-let-7b-5p AGTAGGTTGTGTGGT 99 7
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAGA 9007 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCTTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGCAG 2 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTT 16 1
mmu-let-7b-5p GTAGGTTGTGTGGTTA 484 41
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTA 10 2
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGTT 41 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTG 11 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTA 65 2
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTT 67 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTTC 3 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGG 27 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGT 2 28
mmu-let-7b-5p AGTAGGTTGTGTGGTTAAA 36 36
mmu-let-7b-5p AAGGTAGTAGGTTGTGTGGTTA 3 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTAT 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTG 4969 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTC 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTT 26 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTGAG 4 3
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTAA 9 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTAT 6 14
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTT 98 1
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTA 2 3
mmu-let-7b-5p TGCTAGTAGGTTGTGTGGTT 9 10
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAT 14122 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAC 1164 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAA 27337 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAN 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTC 75 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTA 2840 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTT 2963 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAA 14760 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAC 251 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTT 134 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGT 2138 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAT 10311 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGA 20 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGC 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTA 74 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTT 117 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTTA 7 2
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTG 2 3
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTA 31 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCT 3 10
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTT 508 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTA 6 2
mmu-let-7b-5p GTAGGTTGTGTGGTTAAAG 4 38
mmu-let-7b-5p GAGGTAGGAGGTTGTGTGGT 2 3
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGT 138 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTGA 8 23
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTAAG 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTG 10 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTT 79 1
mmu-let-7b-5p GAGGTAGTAGGTTGTATGGTTAC 24 3
mmu-let-7b-5p TGGTAGTAGGTTGTGTGG 2 5
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGT 50 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTTA 14 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAG 22504 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTC 2 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTT 25 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTA 26 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p GAGGTAGTAAGTTGTGTGGTTA 2 1
mmu-let-7b-5p TAGTAGGTTGTGTGGT 87 1
mmu-let-7b-5p GAGGCAGTAGGTTGTGTGGTT 14 1
mmu-let-7b-5p AAGGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGG 17 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTG 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTA 83 2
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTT 104 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTAT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTA 2 6
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAT 133 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAA 195 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAC 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAAAG 1493 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTA 37 1
mmu-let-7b-5p TAGGTTGTGTGGTTAC 4 35
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTG 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTT 374 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGG 28 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTCTGGTT 2 3
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTTAA 2 3
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTTAT 3 2
mmu-let-7b-5p GGTAGTAGGTTCTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACAT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACAA 31 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACAG 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTCC 3 3
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGT 19 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTT 30 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTA 12 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTTTTT 6 3
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p GGTAGTAGGTTGTGCGGTT 2 1
mmu-let-7b-5p ATGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGTTTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGGTTGGT 2 10
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTAT 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAAG 7 13
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTA 5 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGCT 2 14
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCTAG 3 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTT 303 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTA 6 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATAA 170 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTTA 53 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTTT 59 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTTA 2 2
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGG 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAA 1304 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGT 3 6
mmu-let-7b-5p GTAGGTTGTGTGGTTTAA 21 3
mmu-let-7b-5p NTAGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTT 182 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGT 33 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTTA 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTACC 8 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTAT 8 2
mmu-let-7b-5p GAGGTAGGAGGTTGTGTGGTT 6 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTTGTT 2 1
mmu-let-7b-5p GAGGAAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p GAGGTGGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTA 13 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTT 744 3
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTG 4 3
mmu-let-7b-5p NGAGTTAGTAGGTTGTGTGGT 2 2
mmu-let-7b-5p GAGGTAGTAGGTTCTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTAAG 221 4
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTTT 4 2
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTT 26844 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTTA 6 2
mmu-let-7b-5p TGATTTAGTAGGTTGTGTGGTT 16 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTTA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGG 56 2
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTA 33 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGGT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTTAA 2 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTTT 22 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTTA 13 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGT 103 1
mmu-let-7b-5p GAGGTAGTAGGTTGGGTGGTT 3 1
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTT 67 1
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTA 4 2
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTTGTTT 11 2
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTGA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCT 41 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCC 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCG 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCA 43 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTT 29 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTA 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCT 15 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCG 12 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGTA 270 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTAA 7 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTG 174 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTG 2 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTG 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTA 95 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTT 188 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTAAA 6 8
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGG 35 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAAG 106 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTG 2 5
mmu-let-7b-5p TAGTAGGTTGTGTGGTTAAA 30 8
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTG 6 3
mmu-let-7b-5p TCTGAGGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTAA 113 24
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGT 51 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAAGT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTATGGTTTGA 6 4
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTA 10 2
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGT 13 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGT 11 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTT 233 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGT 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGG 43 3
mmu-let-7b-5p NGAGGTAGTAGGTTG 3 26
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGA 2 1
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTT 18 1
mmu-let-7b-5p CGTTGAGGTAGTAGGTTGTGTGGT 2 2
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTA 5 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGTTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGNA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAG 11 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGC 31 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAT 14 38
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTAT 10 1
mmu-let-7b-5p GAGGTAGTGGGTTGTGTGGTT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTTT 5 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTAA 10 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTCTGGTT 5 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTTTTA 2 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAGC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTAT 53 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGTAA 14 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGAT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGAA 12 5
mmu-let-7b-5p TAGTAGGTTGTGTGGTTA 174 4
mmu-let-7b-5p TAGTAGGTTGTGTGGTTC 4 5
mmu-let-7b-5p GAGGTAGTAGGTTGTGA 2 24
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTT 22 3
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTA 13 3
mmu-let-7b-5p TGAGGTAGTAGGCTGTCTGGTT 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAAGT 2 8
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTAT 7 1
mmu-let-7b-5p TGGTAGTAGGTTGTGTTGTT 2 23
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTG 3 2
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGT 9 1
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGG 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCTAA 5 1
mmu-let-7b-5p TTTGAGGTAGTAGGTTGTGTGG 4 4
mmu-let-7b-5p NGATGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTG 2 4
mmu-let-7b-5p GTAGTAGGTTGTGTGG 39 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTTTT 6 3
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTT 107 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGG 7 1
mmu-let-7b-5p GTAGGTTGTGTGGTTT 749 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTC 856 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTG 1190 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTA 19068 2
mmu-let-7b-5p AGGTAGTAGGTTGTGTGG 18 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTTT 2 2
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTTT 46 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTTG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTTA 33 1
mmu-let-7b-5p TTAGTAGGTTGTGTGGTT 8 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTTTT 2 2
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTAT 9 1
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTTT 29 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTTT 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTCAA 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTCAT 2 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTTAA 9 1
mmu-let-7b-5p GTAGGTTGTGTGGTTTCT 4 6
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTG 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTTA 15 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGGGGTT 6 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTTTAA 2 2
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTAA 5 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTG 10 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTTAT 23 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTTAA 26 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTTGA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATAAG 11 1