id_rna sequence raw_count mapping_loci
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTT 857231 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTAT 1334 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTT 1287 3
mmu-let-7b_precursor GGAGGTAGTAGGTTGTGTGGTT 44 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTTTA 5 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTTTT 13 3
mmu-let-7b_precursor CTATACAACCTACTGCCTTCCTAG 2 1
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTTTAA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTG 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTA 16 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTT 174 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTA 2 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCGTTTAA 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGAT 133 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGAG 12 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGAA 197 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGAC 4 1
mmu-let-7b_precursor TGAGATAGTAGGTTGTGTGG 5 1
mmu-let-7b_precursor NGAGGTAGTAGGTTTTGTGGTT 6 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTTGTT 2 1
mmu-let-7b_precursor GAGGGAGTAGGTTGTGTGGTTT 3 2
mmu-let-7b_precursor GAGGGAGTAGGTTGTGTGGTTA 12 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACA 35 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACC 11 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACG 30 1
mmu-let-7b_precursor TCGTAGTAGGTTGTGTGGTT 4 4
mmu-let-7b_precursor TGTGGTAGTAGGTTGTGTGG 5 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTTT 10 2
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTTA 8 2
mmu-let-7b_precursor GAGGTAGTAGTTTGTGTGGTTT 3 2
mmu-let-7b_precursor GAGGTAGTAGTTTGTGTGGTTA 4 2
mmu-let-7b_precursor TGAGCTAGTAGGTTGTGTGGTT 230 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGG 338 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGA 14 2
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGT 8 3
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTGAA 2 8
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTTAC 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGGGTGGTTA 10 1
mmu-let-7b_precursor TGAGGTAGTAAGTTTTGTGGTT 2 6
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGT 65 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGT 63 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGA 3 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTT 527 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTA 10 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTAT 7 3
mmu-let-7b_precursor GTAGGTTGTGTGGTTAC 16 5
mmu-let-7b_precursor TGAGGTAGTAGGTTATG 2 9
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTTAA 9 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTT 415 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTTGA 2 2
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTG 5 3
mmu-let-7b_precursor TGAGGTAATAGGTTGTGTGGTTTT 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTA 89 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAGAG 68 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTTTGA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGT 107 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTA 16249 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTC 265 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTG 541 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTN 51 1
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGTTTA 4 2
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTA 4 1
mmu-let-7b_precursor GTAGGTTGTGTGGTTTAAG 3 1
mmu-let-7b_precursor GAGGTAGCAGGTTGTGTGGTT 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTAT 6 1
mmu-let-7b_precursor GTAGGTTGTGTGGTTTAAT 5 41
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTATG 24 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTTTT 42 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTAG 5079 2
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor TGAGGAGGTAGGTTGTGTGGTT 11 2
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGG 26 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCA 26 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCC 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTAT 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGG 2 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGA 8 40
mmu-let-7b_precursor CAGGTAGTAGGTTGTGTGG 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAGGTTT 21 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAGGTTA 20 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTTTT 5 2
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTTTA 7 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGGTTT 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGATTT 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGATTA 2 2
mmu-let-7b_precursor TGATCTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTGT 4 1
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTTAA 5 1
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTTAT 2 2
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGCGGTTT 3 3
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGGT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTTTA 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTTTT 12 2
mmu-let-7b_precursor GAGTAGTAGGTTGTGTGGTT 6 7
mmu-let-7b_precursor TGAGGTAGTTGGTTGTGTGG 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTTGA 2 1
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTG 3 3
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTT 4351 1
mmu-let-7b_precursor AGAGGTAGTAGGTTGTGTGGTTT 16 1
mmu-let-7b_precursor AGAGGTAGTAGGTTGTGTGGTTA 11 1
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTGGTTTA 2 2
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTGGTTTT 3 2
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGG 8 2
mmu-let-7b_precursor TGAGGTAGTGTGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGATGTGTGGTTT 12 1
mmu-let-7b_precursor TGAGGTAGTTGGTTGTGTGGTTT 15 1
mmu-let-7b_precursor TGAGGTAGTAGGATGTGTGGTTA 17 1
mmu-let-7b_precursor TGAGGTAGTTGGTTGTGTGGTTA 13 2
mmu-let-7b_precursor NGAGGTAGTAGGTCGTGTGGTT 2 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTG 71 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTA 1028 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTC 24 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTT 1236 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAGGTT 87 1
mmu-let-7b_precursor GAGGTATTAGGTTGTGTGGTT 3 1
mmu-let-7b_precursor GGTAGTAGGTTGT 3 43
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTTT 70 1
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTTG 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTTA 75 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGGTT 5 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGGTA 3 1
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTTT 23 1
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTGGT 6 1
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGTT 165 1
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGTA 3 1
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTT 19 1
mmu-let-7b_precursor TGAGCTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTAT 4 6
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCTT 4 8
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTTTA 2 1
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTGGTT 115 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTTC 2 2
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTTA 110 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTTT 119 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTTG 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTATAA 4 1
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGTTTA 3 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTAAG 11 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTAAC 6 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTAAT 23 1
mmu-let-7b_precursor TGAGGTAGAAGGTTGTGTGGTTT 22 1
mmu-let-7b_precursor TGAGGTAGAAGGTTGTGTGGTTA 16 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTTT 43 1
mmu-let-7b_precursor TGAGGTAGTAGGATGTGTGG 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTG 1547 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGAAT 335 1
mmu-let-7b_precursor TTAGGTAGTATGTTGTGTGGTT 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAAA 39774 1
mmu-let-7b_precursor CGATGAGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGTTT 36 1
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGTTG 3 2
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGTTA 48 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGCGGTT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTAT 7 1
mmu-let-7b_precursor NTAGGTTGTGTGGTTT 7 13
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTAC 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAAAGG 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGG 27 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGT 3 2
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTGGTT 181 1
mmu-let-7b_precursor TAGTAGGTTGTGTG 2 15
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTTTTA 2 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGTT 168 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGTA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTTAA 14 2
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTG 3 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGT 370 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGG 7 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGC 29 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGA 734 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGT 776 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGA 1305 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGC 31 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTC 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTA 127 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTT 214 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTG 10 1
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGTT 201 1
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGT 21 1
mmu-let-7b_precursor NTAGTAGGTTGTGTGGT 2 1
mmu-let-7b_precursor GTAGGTTGTGTGGTTTTA 4 9
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGA 3 6
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTTAA 8 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTTAT 8 2
mmu-let-7b_precursor TAGTAGGTTGTGTGG 64 3
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGT 114 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTAA 1711 2
mmu-let-7b_precursor GAGGGAGTAGGTTGTGTGGTT 42 2
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTTTAA 5 1
mmu-let-7b_precursor NAGGTAGTAGGTTGTGTGGTAT 2 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGT 45 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTTT 66 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTTA 63 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTTG 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAGG 14 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAGGT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTAT 13 2
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTG 3 7
mmu-let-7b_precursor GAGGTAGGAGGTTGTGGGGTTT 2 12
mmu-let-7b_precursor AGAACACGGACACCGCAGGG 2 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTAT 11 1
mmu-let-7b_precursor GAGGTAGTGGGTTGTGTGGT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTA 2 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTA 4 1
mmu-let-7b_precursor GAGTTAGTAGGTTGTGTGGT 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTAT 4 1
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTTTT 10 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTT 287 3
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGG 73 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGA 2 9
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGA 3945 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGG 64835 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGT 1440 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGTT 160 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGTA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAT 12 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAG 47 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAA 31 1
mmu-let-7b_precursor AGAGGTAGTAGGTTGTGTGG 5 1
mmu-let-7b_precursor TGAGGTAGTAGGATGTGTGGTT 40 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCAGTT 2 6
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTT 276 1
mmu-let-7b_precursor NGCGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b_precursor AGTAGGTTGTGTGGTTT 260 1
mmu-let-7b_precursor TGAAGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor TGAGCTAGTAGGTTGTGTGGTAT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTTT 105 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTTA 82 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTTG 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGGGTGGTTT 12 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGG 40 1
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGG 17 1
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGA 2 3
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGTTTT 4 2
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGTTTA 3 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTGAA 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTTTAAG 2 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTTTAA 7 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGCGGT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCAA 190 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTTTGGTT 6 3
mmu-let-7b_precursor TCAGGTAGTAGGTTGTGTGGTAT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAAA 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAAG 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAAT 12 1
mmu-let-7b_precursor TGAGGTAGTAGATTGTGTGGT 16 1
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGTT 571 1
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGTA 6 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGTT 508 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGTA 5 3
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTTT 41 1
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTTA 37 1
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTTG 4 1
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGT 2 15
mmu-let-7b_precursor CTATACAACCTACTGCCTTCCTT 2 1
mmu-let-7b_precursor TGAGATAGTAGGTTGTGTGGTTA 17 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGNTT 5 1
mmu-let-7b_precursor TGTGGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b_precursor CTATACAACCTACTGCCTTCTT 6 2
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTAT 70 1
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTA 5 2
mmu-let-7b_precursor AGTAGGTTGTGTGGTTTAA 17 3
mmu-let-7b_precursor TGAGCTAGTAGGTTGTGTGGTTA 34 1
mmu-let-7b_precursor NTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGT 56 1
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGG 21 1
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGA 2 3
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTT 271 1
mmu-let-7b_precursor TGAGGAAGTAGGTTGTGTGG 3 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTA 6 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGC 222 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGA 7504 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGG 48 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGN 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGT 6178 2
mmu-let-7b_precursor AGAGGTAGTAGGTTGTGTGGTT 53 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTCA 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTCC 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTCT 6 3
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTT 1809 1
mmu-let-7b_precursor GAGTTAGTAGGTTGTGTGGTT 6 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGA 5 9
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTTC 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCGTAT 2 1
mmu-let-7b_precursor GAGGTAGTCGGTTGTGTGGTT 2 1
mmu-let-7b_precursor TCAGGTAGTAGGTTGTGTGGTTT 27 1
mmu-let-7b_precursor TCAGGTAGTAGGTTGTGTGGTTA 17 1
mmu-let-7b_precursor AGAGGTAGTAGGTTGTGTGGTA 3 3
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTA 12 7
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTT 462 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTT 585 1
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTG 6 5
mmu-let-7b_precursor GAGGTAGTAGGTTGTGGGGTT 5 2
mmu-let-7b_precursor TAGTAGGTTGTGTGGTAAC 2 20
mmu-let-7b_precursor TGAGGTAGTAGGGTGTGTGGT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGAGA 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTNA 2 1
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGTTT 43 1
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTTTAAG 3 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTAGA 3 14
mmu-let-7b_precursor GAGGTAGTAGGTTGTTTGGT 2 3
mmu-let-7b_precursor NGAGGTAGTAGGTTGT 7 11
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGATC 7 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGATA 19 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGATG 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGATT 10 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTATA 1475 1
mmu-let-7b_precursor NGTAGGTTGTGTGGTTT 2 1
mmu-let-7b_precursor AGTAGGTTGTGTGGTTTTA 3 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTG 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTNAA 4 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGG 34 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGATAT 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCTT 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCTA 9 2
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTTTAA 11 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTAAA 26 1
mmu-let-7b_precursor NGAGGTAGTGGGTTGTGTGGTT 4 1
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTTT 63 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCGTTA 20 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCGTTG 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGA 8 2
mmu-let-7b_precursor TGAGTTAGTAGGTTTTGTGGTT 3 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTT 384 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTC 13 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTA 306 2
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTTA 5 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTTT 4 26
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTTTAA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAG 1088 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAC 205 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAT 1723 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTN 69 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTG 11887 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTC 4364 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTA 202035 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTT 246314 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTGT 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTGA 9 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTA 3429 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGGA 11 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTT 3426 2
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTT 33 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTA 59 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTANA 2 1
mmu-let-7b_precursor TGGGTTAGTAGGTTGTGTGGTT 2 4
mmu-let-7b_precursor AGTAGGTTGTGTGG 97 20
mmu-let-7b_precursor AACACGGACACCGCAGGG 36 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGA 2 24
mmu-let-7b_precursor AGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGGTTT 23 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTTTT 14 2
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTTA 68 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTTG 6 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTTC 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGGA 10 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGGT 36 1
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTT 502 1
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTA 16 3
mmu-let-7b_precursor GAGGTAGTAGGTTGTGGGGT 2 3
mmu-let-7b_precursor TGAAGTAGTAGGTTGTGTGG 8 2
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTA 2 3
mmu-let-7b_precursor TGAGGTATTAGGTTTTGTGGTT 2 2
mmu-let-7b_precursor TGGTAGTAGGTTGTGTGGT 17 3
mmu-let-7b_precursor TGTAGTAGGTTGTGTGGTTT 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAG 83 3
mmu-let-7b_precursor GAGGTAGTAGGTTGTATGGTTTC 6 3
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGT 50 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGTT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCGA 8 2
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGT 45 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGATTT 23 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGATTA 21 1
mmu-let-7b_precursor GGAGGTAGTAGGTTGTGTGGTTTT 2 3
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTTTT 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGGTTGGTT 7 10
mmu-let-7b_precursor GAGGTAGTAGGTTGTTTGGTT 6 3
mmu-let-7b_precursor NGAGGTAGCAGGTTGTGTGGTT 2 2
mmu-let-7b_precursor TGTGGTAGTAGGTTGTGTGGTT 78 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGTTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGGT 26 1
mmu-let-7b_precursor TGAGGTAGAAGGTTGTGTGG 7 2
mmu-let-7b_precursor GAGGTAGCAGGTTGTGTGGT 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGGTTTA 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTCAA 2 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGTTT 48 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGTTG 3 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGTTA 31 1
mmu-let-7b_precursor GAGGTAGTAGGTTATGTGGT 2 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGTTTT 5 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGAT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTTAC 2 1
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTTTAA 5 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTAT 8 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGA 80 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGG 946 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGT 14 3
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTA 92 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTC 2 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTT 100 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTG 13 3
mmu-let-7b_precursor GGCAGTAGGTTGTGTGGTT 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTTTAAG 2 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTAT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCTTAA 2 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGT 49 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTTA 7 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTTG 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGTT 8 8
mmu-let-7b_precursor TGAGGTAGTAGGTGGTGTGGTTTT 3 2
mmu-let-7b_precursor GTGAGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTTT 71 1
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTTA 57 1
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTTG 4 1
mmu-let-7b_precursor NTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTAAAG 11 1
mmu-let-7b_precursor GAGGTAGTAGTTTGTGTGGTT 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGTAT 3 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGAAG 118 1
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGGTAT 8 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGG 17 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGA 2 13
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGGTTTT 6 2
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTG 2 1
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGTTA 30 1
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGGT 37 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTA 91 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTG 3 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTAT 8 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGT 38 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGT 158 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGA 4 5
mmu-let-7b_precursor TGAGGTAGTAGGTGGTGTGGTTT 15 1
mmu-let-7b_precursor TGAGGTAGTAGGTGGTGTGGTTA 9 1
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGGTTTA 3 2
mmu-let-7b_precursor TAGGTTGTGTGGTT 407 27
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGG 6 2
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGGTTT 53 1
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGGTTG 2 1
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGGTTA 25 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTTTT 4 3
mmu-let-7b_precursor TCTGAGGTAGTAGGTTGTGTGGTT 11 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCTGTTT 20 3
mmu-let-7b_precursor GGTAGTAGCTTGTGTGGTTT 2 2
mmu-let-7b_precursor GGTAGTAGGTTTTGTGGTT 3 8
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTTAA 4 1
mmu-let-7b_precursor TGAGGGGGTAGGTTGTGTGGTT 2 2
mmu-let-7b_precursor TGCTAGTAGGTTGTGTGGTTT 2 5
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTT 94 1
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTGGTAT 2 1
mmu-let-7b_precursor NAGGTAGTAGGTTGTGTGGTTT 10 1
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTGGT 23 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTT 489 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTA 8 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTG 8 4
mmu-let-7b_precursor TGAGGTAGTAGATTGTGTGGTTTT 6 4
mmu-let-7b_precursor TTAGGTAGTAGGTTTTGTGGTT 2 10
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTA 5 3
mmu-let-7b_precursor TGAGGTAATAGGTTGTGTGG 8 1
mmu-let-7b_precursor CTGAGGCGCCCAGGGACACA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAGGTTG 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTAT 13 3
mmu-let-7b_precursor TGAGGTAGTAGGTGTTGTGGT 2 5
mmu-let-7b_precursor GAGGTAGTAGGTTGT 25 11
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGTA 3 2
mmu-let-7b_precursor TGAGGTAGTAGGATGTGTGGT 10 2
mmu-let-7b_precursor NGAGGTAGTAGTTTGTGTGGT 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAA 103 16
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGGTTT 28 1
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGGTTG 3 2
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGGTTA 13 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTTAT 12 4
mmu-let-7b_precursor TCAGGTAGTAGGTTGTGTGG 6 1
mmu-let-7b_precursor GTAGGTTGTGTGGT 694 15
mmu-let-7b_precursor GTAGTAGGTTGTATGGTTTAAG 2 5
mmu-let-7b_precursor TGAGGGAGTAGGTGGTGTGGTT 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTACG 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGGTTA 4 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTAA 349 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTAC 18 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTAT 214 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTAG 30 3
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTAC 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGAA 1767 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTGT 5 9
mmu-let-7b_precursor TGAGGTAGTAGGTAGTGTGGTT 22 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTG 2 1
mmu-let-7b_precursor TGAGCTAGTAGGTTGTGTGGTA 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATTAG 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTTTGGTTA 4 3
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGG 18 2
mmu-let-7b_precursor TGATAGTAGGTTGTGTGGT 2 32
mmu-let-7b_precursor TGGTAGTAGGTTGTGTGGTTT 6 1
mmu-let-7b_precursor TGGTAGTAGGTTGTGTGGTTA 7 1
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTAT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTN 7 1
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTAT 25 4
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTAA 17 2
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTAG 10 2
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTT 262 1
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCG 19 1
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTGGTTT 29 1
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTGGTTA 27 1
mmu-let-7b_precursor AGTAGGTTGTGTGGTAT 6 19
mmu-let-7b_precursor GAGGTAGTAGGTTGTCTGGTT 6 3
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTGGTA 2 1
mmu-let-7b_precursor AGTAGGTTGTGTGGTTTT 23 9
mmu-let-7b_precursor AGTAGGTTGTGTGGTTTA 9 10
mmu-let-7b_precursor GAGGTAGTAGGTTTTGTGG 3 5
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTAC 21 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTAG 120 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTAT 1278 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTTTA 2 3
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTAT 5 3
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTTT 129 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTTG 4 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTTA 101 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTTC 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGTAG 32 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTC 5 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTA 131 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTG 15 3
mmu-let-7b_precursor TGACGTAGTAGGTTGT 2 15
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTAGT 82 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTAGC 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTAGA 92 1
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGG 20 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCTC 2 1
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTTTAA 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTTTAA 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCTTA 2 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTG 5 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTC 5 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTT 9423 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGGTT 3 2
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGTTA 34 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTTACA 2 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTAC 3 1
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTTTT 11 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGTTT 2 1
mmu-let-7b_precursor AGTAGGTTGTGTGGTTG 7 19
mmu-let-7b_precursor AGTAGGTTGTGTGGTTC 3 14
mmu-let-7b_precursor AGTAGGTTGTGTGGTTA 158 20
mmu-let-7b_precursor TGAGGTAGTAGGTAGTGTGGTTT 4 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGGTT 2 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGA 4 5
mmu-let-7b_precursor GAGGTAGTAGGTTTTGTGGTTT 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACAGT 5 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTGA 6 6
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTGT 5 16
mmu-let-7b_precursor NGAGGTAGTAGGTTGTG 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTTAA 24 2
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGT 49 1
mmu-let-7b_precursor TGGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCT 118 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCC 24 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCG 63 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCA 98 2
mmu-let-7b_precursor TAAGTAGTAGGTTGTGTGGTT 3 4
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTAT 5 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTATAG 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTGA 352 4
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTTT 110 1
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTTG 3 2
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTTA 84 1
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTTC 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTTTC 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTTTA 11 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTTTT 19 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTTTTA 4 3
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTG 31 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGT 55 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGAGTGGT 12 1
mmu-let-7b_precursor TCAGGTAGTAGGTTGTGTGGTTTA 6 2
mmu-let-7b_precursor TGAGGGAGGAGGTTGTGTGGTT 4 3
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTTG 3 1
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTTA 40 1
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTTT 41 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGCT 2 1
mmu-let-7b_precursor TGTAGTAGGTTGTGTGG 12 16
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTGT 10 4
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTGA 9 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTAG 299 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTAC 22 1
mmu-let-7b_precursor ACACGGACACCGCAGGG 195 1
mmu-let-7b_precursor GAGGTAGTAGGGTGTGTGGTT 3 1
mmu-let-7b_precursor TGAGGTAGTAGGGTGTGTGGTTT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGGTGTGTGGTTA 9 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTTGA 2 2
mmu-let-7b_precursor TGAGGTATTAGGTTGTTTGGTT 2 6
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTTGT 3 3
mmu-let-7b_precursor TGTAGTAGGTTGTGTGGTTTA 3 9
mmu-let-7b_precursor GAGGTAGCAGGTTGTGTGGTTT 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCGTTT 39 1
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGGTTA 18 1
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b_precursor GAGGTCGTAGGTTGTGTGGTTA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTTG 12 2
mmu-let-7b_precursor AGTAGGTTGTGTGGTT 617 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTG 13 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTTT 72 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTTA 65 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATC 33 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATA 221 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATG 34 1
mmu-let-7b_precursor TGAGGGAGTCGGTTGTGTGGTT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCT 33 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATTA 25 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTCTG 8 37
mmu-let-7b_precursor GAGGTAGTAGGTTATGTGGTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGCA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAA 5260 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTTAG 4 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGT 98 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTT 252 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTC 2 2
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTA 124 1
mmu-let-7b_precursor GCGGTAGTAGGTTGTGTGGTTA 2 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTTTT 7 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGT 1390 8
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTGGTTT 38 1
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTGGTTA 41 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCT 157 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCG 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCA 6 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTGAA 27 1
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGT 31 1
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGA 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTTAA 13 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAAT 3 4
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTGC 4 1
mmu-let-7b_precursor TGATGTAGTAGGTTGTTTGGTT 2 4
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTGT 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTC 119 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTTTA 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTGGTGTGGT 7 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGCGGTTAC 2 1
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGGTTTA 4 2
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTT 493 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTA 7 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTGGGTT 3 7
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTTC 3 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTG 2 2
mmu-let-7b_precursor TAGGTTGTGTGGTTT 85 13
mmu-let-7b_precursor TGTGGTAGTAGGTTGTGTG 2 4
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTA 214 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTAC 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTGA 90 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTGT 23 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTTG 8 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTTA 128 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGG 52 3
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTT 196 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTG 7 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTA 153 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGGT 9 4
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGT 8 2
mmu-let-7b_precursor TCTGAGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b_precursor TGGTAGTAGGTTGTGTGGTTTT 2 5
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTAT 5 4
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTAA 20 28
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGT 51 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGAT 2 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCGA 27 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTTT 121 1
mmu-let-7b_precursor GAGGCAGTAGGTTGTGTGGT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAGG 31 1
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGG 14 1
mmu-let-7b_precursor GGTAGTAGGTTGTG 2 9
mmu-let-7b_precursor TGAGGTAGTAGGTTGGGTGGT 10 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGCAT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCG 3 1
mmu-let-7b_precursor TGAGGTAATAGGTTGTGTGGTT 97 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTCGTT 2 1
mmu-let-7b_precursor GTAGGTTGTGTGGTTTT 54 41
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCGT 29 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTCTGGTT 2 4
mmu-let-7b_precursor NGAGGTAGTATGTTGTGTGGTT 4 1
mmu-let-7b_precursor TGTAGTAGGTTGTGTGGTT 142 3
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTAGA 12 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAC 2423 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAT 109468 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAA 113693 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAN 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTAC 2 1
mmu-let-7b_precursor GAGGTAGGAGGTTGTGTGGTTT 2 2
mmu-let-7b_precursor GAGGTAGGAGGTTGTGTGGTTA 3 5
mmu-let-7b_precursor TGAAGTAGTAGGTTGTGTGGTTA 10 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGATT 99 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGATA 9 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTATA 19 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGGGTGGTT 30 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTT 314 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTG 2 10
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTA 15 4
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGGTT 60 1
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGG 23 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGG 10 1
mmu-let-7b_precursor GAGGTAGTAGGTTG 38 26
mmu-let-7b_precursor TGAGGTAGTAGGTTGGGTGG 2 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCAAG 12 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATT 45 2
mmu-let-7b_precursor TGTAGTAGGTTGTGTGGT 30 7
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGTAT 5 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTTGT 2 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTTT 14 2
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTTA 7 2
mmu-let-7b_precursor NAGGTAGTAGGTTGTGTGGTT 36 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTAAA 531 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTATAG 352 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTTT 20 2
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTTA 18 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGAT 57 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGAC 13 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGAA 449 5
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGAG 43 2
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGT 24 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTGA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCTAG 2 1
mmu-let-7b_precursor GATGTAGTAGGTTGTGTGGTT 12 1
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGG 40 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGA 4 3
mmu-let-7b_precursor NGTAGGTTGTGTGGTT 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCGT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGT 42 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGA 2 3
mmu-let-7b_precursor GTAGTAGGTTGTGTG 2 5
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTNT 13 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTNA 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGAT 224 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGAG 89 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGAC 21 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGAA 1205 2
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGT 33 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGTAT 3 1
mmu-let-7b_precursor TGAGGTAGTAGGGTGTGTGG 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTTTT 8 2
mmu-let-7b_precursor TGAAGTAGTAGGTTGTGTGGT 17 1
mmu-let-7b_precursor NAGGTAGTAGGTTGTGTGG 12 1
mmu-let-7b_precursor NAGGTAGTAGGTTGTGTGA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGT 128 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGAGTGGTT 36 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTTAA 3 5
mmu-let-7b_precursor TAGTAGGTTGTGTGGTA 12 16
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTAG 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTTT 222 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTTC 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTTA 166 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCTGGTTG 12 3
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGTTTA 4 2
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b_precursor TGAGGTAGTAGGTT 5169 17
mmu-let-7b_precursor NGAGGTACTAGGTTGTGTGGTT 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTTAC 4 1
mmu-let-7b_precursor NGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTA 4 1
mmu-let-7b_precursor AGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGT 95 1
mmu-let-7b_precursor TGTAGTAGGTTGTGTGGTTA 7 13
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTT 11 15
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTT 54 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTC 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTA 53 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTG 7 2
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGGTTTA 4 2
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGGTTTA 4 2
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGGTTTT 5 2
mmu-let-7b_precursor GAGGTAGTAGGTTGCGTGGTTT 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGG 21 2
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGG 21 1
mmu-let-7b_precursor GAGGTAGTATGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTTGT 2 2
mmu-let-7b_precursor TTGAGGTAGTAGGTTGTGTGGTT 2 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTCGTT 2 1
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGG 15 1
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTGGTTTT 4 3
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGT 774 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGC 2 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGA 9 1
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b_precursor TGAGGAAGTAGGTTGTGTGGTT 66 1
mmu-let-7b_precursor TGGTAGTAGGTTGTGTGGTT 96 1
mmu-let-7b_precursor TGAGGTAGAAGGTTGTGTGGT 6 2
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7b_precursor TGGGGTAGTAGGTTGTTTGGTT 2 4
mmu-let-7b_precursor TGAGGTCGTCGGTTGTGTGGTTT 2 1
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTAGTTT 2 6
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTG 8 4
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGG 37 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGA 4 5
mmu-let-7b_precursor TGAGGTAGTAGGTGGTGTGG 8 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGNT 39 1
mmu-let-7b_precursor AGGGAGTAGGTTGTGTGGTT 2 2
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGG 39 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTAT 3 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTAG 3 17
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTAA 22 11
mmu-let-7b_precursor TCAGGTAGTAGGTTGTGTGGT 20 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTG 110 1
mmu-let-7b_precursor NGAGGTAGCAGGTTGTGTGGTTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTG 3 24
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTT 260 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGTA 12 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTCA 4 2
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b_precursor GGAGGTAGTAGGTTGTGTGGTTT 22 1
mmu-let-7b_precursor GGAGGTAGTAGGTTGTGTGGTTA 8 1
mmu-let-7b_precursor GGAGGTAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b_precursor GCGGTAGTAGGTTGTGTGG 2 2
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTTTA 3 2
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTTTT 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGAC 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTAAA 76 3
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTA 9 1
mmu-let-7b_precursor TGATAGTAGGTTGTGTGGTT 6 14
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGT 59 1
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTT 325 1
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTA 4 4
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTCT 3 3
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGGTTTC 2 1
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGGTTTT 6 2
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b_precursor GTAGGTTGTGTGGTT 4403 3
mmu-let-7b_precursor CTATACAACCTACTGCCT 6 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTTAA 73 1
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGA 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTTGTT 3 9
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTT 157 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAGG 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAGA 237 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAGT 190 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAGC 12 1
mmu-let-7b_precursor NTAGGTTGTGTGGTT 20 27
mmu-let-7b_precursor GGGGTAGTAGGTTGTGTGGTT 8 1
mmu-let-7b_precursor TGAGGTAGTTGGTTGTGTGGTT 60 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTAGA 38 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGAAT 40 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGN 7 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGG 30 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGA 2683 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGC 141 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGT 149476 1
mmu-let-7b_precursor TTATGTAGTAGGTTGTGTGGTT 3 3
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGG 40 2
mmu-let-7b_precursor GAGGCAGTAGGTTGTGTGG 2 2
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGT 46 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTG 2 1
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGT 62 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTACA 6 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTTAA 10 1
mmu-let-7b_precursor GAGGTAGTAGGCTGTGTGGT 2 1
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGT 3 6
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTTTA 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTTTT 8 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGTTTAA 4 3
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTTTAA 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTAT 2 4
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGTT 125 1
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGGTT 114 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGGGTGGTTTAA 2 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTTTA 9 3
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTTTT 19 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGNTT 13 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGNTA 10 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTG 5 5
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGT 108 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGGA 3 4
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGGTTT 18 1
mmu-let-7b_precursor CTATACAACCTACTGCCTTCC 35 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTAT 10 1
mmu-let-7b_precursor CCAGAACACGGACACCGCAGGG 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGTTA 5 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGTTT 48 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGTTA 40 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGTTG 3 1
mmu-let-7b_precursor GGAGGTAGTAGGTTGTGTGGT 5 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGTTT 17 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTAT 2 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTG 19 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTAAG 61 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTTAC 2 1
mmu-let-7b_precursor NAGTAGGTTGTGTGGTT 3 1
mmu-let-7b_precursor TGAGGTAGTAGATTGTGTGG 9 2
mmu-let-7b_precursor TGAGGTCGTAGGTTGTCTGGTT 2 3
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTA 8 3
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTT 506 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTTA 54 2
mmu-let-7b_precursor GAGCTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGT 94 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTGGGTTT 2 5
mmu-let-7b_precursor TGAGGTAGTAGGTTGAGTGGTTT 10 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGAGTGGTTA 8 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGG 8 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTCTGGTT 2 3
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTG 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCTT 16 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCTA 10 1
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGGT 43 1
mmu-let-7b_precursor TGAGGTAGTAGGTTG 1284 10
mmu-let-7b_precursor TGAAGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGGTGTGTGGTT 42 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTAT 85 12
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTAG 20 12
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTAA 93 5
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTATC 2 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTATA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTTGA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGC 5 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGA 177 6
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGG 72 7
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGT 2299 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTT 320 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTA 9 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor GGAGGTAGTAGGTTGTGTGG 2 2
mmu-let-7b_precursor AATGAGGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTAGA 5 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTTC 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTTA 29 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTTG 7 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGGGGTT 2 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCTT 60 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCTA 39 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCTG 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCTA 44 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTAT 5 1
mmu-let-7b_precursor TGAGGTAATAGGTTGTGTGGTTTA 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGA 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTTT 2 2
mmu-let-7b_precursor AGTAGGTTGTGTGGTTGAA 2 37
mmu-let-7b_precursor NGTAGTAGGTTGTGTGGTT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACAAG 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGT 54 1
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTAT 5 1
mmu-let-7b_precursor GCGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b_precursor TGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b_precursor NAGGTAGTAGGTTGTGTGGT 8 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGGGTGGTAT 2 1
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGT 19 9
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTAG 24 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTAA 84 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTAT 97 6
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTAT 7 1
mmu-let-7b_precursor GAGGTAGTACGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTTTAA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGTTT 72 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGTTG 15 5
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGTTA 90 3
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTAAC 9 2
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTTGA 11 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTC 7 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTGC 195 3
mmu-let-7b_precursor TGAGCTAGTAGGTTGTGTGG 7 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTTT 153 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGG 27 1
mmu-let-7b_precursor TGAGGTAATAGGTTGTGTGGTTT 19 1
mmu-let-7b_precursor TGAGGTAATAGGTTGTGTGGTTA 18 1
mmu-let-7b_precursor GAGGTAATAGGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGGTT 143 1
mmu-let-7b_precursor TGAGGTAGTATGTTGTGTGGTA 4 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTG 2 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTA 15 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTTTGG 3 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTNT 8 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTNA 12 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGTT 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGTA 10 2
mmu-let-7b_precursor TGCGGTAGTAGGTTGTCTGGT 2 3
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGTAT 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTTTGTGGT 4 3
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTTA 16 2
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTTT 20 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGT 65 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTAGA 4 4
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor TGAGGTAGAAGGTTGTGTGGTTAC 2 1
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTTTAA 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTATCA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGG 11 3
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGT 79 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTAGC 49 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGTT 6 1
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGG 35 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATGA 49 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTT 508 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGGTA 13 3
mmu-let-7b_precursor GTAGTAGGTTGTG 2 46
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTATTT 4 5
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGTTT 39 1
mmu-let-7b_precursor TGAGGTAGTCGGTTGTGTGGTTG 4 1
mmu-let-7b_precursor AGTAGGTTGTGTGGTTAAAG 2 14
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGTT 2 3
mmu-let-7b_precursor GTAGTAGGTTGTGTGGT 57 1
mmu-let-7b_precursor TGAGGTGGTGGGTTGTGTGGTT 3 4
mmu-let-7b_precursor CTAGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTT 276 1
mmu-let-7b_precursor GAGGTAGTAGGTTTTGTGGTT 10 2
mmu-let-7b_precursor TAGTAGGTTGTGTGCTT 2 14
mmu-let-7b_precursor TGAGGTAATAGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor GAGGTAGTAGTTTGTGTGGT 2 2
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTGCT 2 4
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTT 278 1
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGG 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTC 3 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTA 69 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTT 814 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTG 12 1
mmu-let-7b_precursor TGGGTAGTAGGTTGTGTGGTT 18 7
mmu-let-7b_precursor GAGGTAGTTGGTTGTGTGGTT 2 2
mmu-let-7b_precursor TGAGATAGTAGGTTGTGTGGTTTT 3 2
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTAT 7 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTTTAA 6 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGTTT 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTATC 23 3
mmu-let-7b_precursor TGCGGTAGTAGGTTGTGTGGA 2 2
mmu-let-7b_precursor CTATACAACCTACTGCCTTCCT 52 1
mmu-let-7b_precursor CTATACAACCTACTGCCTTCCA 7 1
mmu-let-7b_precursor GTACGTTGTGTGGTTT 2 34
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTAGTT 6 3
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTAAA 28 1
mmu-let-7b_precursor GGTAGTAGGTTGTTTGGTT 5 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAGT 15 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCAGA 4 1
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGG 23 1
mmu-let-7b_precursor TGAGGTAGTAGGTGTTGTGGTT 3 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTG 10 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTTTAA 8 1
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGGTT 170 1
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGGTA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGAGTGGTTTT 2 2
mmu-let-7b_precursor GGTAGTAGGTTGTTTGGTTT 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTTTT 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTTAAG 2 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b_precursor TATGTAGTAGGTTGTGTGGTT 8 3
mmu-let-7b_precursor TGAGGTAGTAGATTGTGTGGTTT 25 1
mmu-let-7b_precursor TGAGGTAGTAGATTGTGTGGTTA 17 2
mmu-let-7b_precursor GTAGTAGGTTCTGTGGTTT 2 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTTAAA 7 3
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTGG 19 1
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTTA 22 2
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTTT 23 3
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTGT 6 1
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGGTTA 16 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b_precursor GGTAGTAGGTTGTGTGGTTTAAA 2 3
mmu-let-7b_precursor GAGGTAGTAGGTTGCGTGGTT 5 1
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGGTT 61 1
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGGTA 2 4
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTA 98 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTC 3 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTG 9 1
mmu-let-7b_precursor TCAGGTAGTAGGTTGTGTGGTT 109 1
mmu-let-7b_precursor TCAGGTAGTAGGTTGTGTGGTA 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGATTG 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAGA 11 13
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTAC 1159 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTGC 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTGGTGTGGTA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTGGTGTGGTT 44 1
mmu-let-7b_precursor TGAGCTAGTAGGTTGTGTGGTTT 36 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTTTA 8 2
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTTTT 21 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGCTTTAA 5 1
mmu-let-7b_precursor CGAGGTAGTAGGTTGTGTGGTT 292 1
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTAAA 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTGAAG 2 1
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGGTAT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTTTA 11 2
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTGGTTTT 10 2
mmu-let-7b_precursor TGAGGTCGTCGGTTGTGTGGTT 3 2
mmu-let-7b_precursor GGGAGTAGGTTGTGTGGTT 4 2
mmu-let-7b_precursor CTATACAACCTACTGCCTTC 9 1
mmu-let-7b_precursor GTAGGTTGTGTGGTTTA 32 24
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGCAA 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGTT 252 1
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGGTAT 2 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTAC 4 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTTGTTTA 3 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTCG 3 2
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTT 186 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTAGTT 2 4
mmu-let-7b_precursor GAGGTAGTAGGTTGTGT 43 2
mmu-let-7b_precursor TGAGGTAGTTGGTTGTGTGGT 18 1
mmu-let-7b_precursor TGAGGAGGTAGGTTGTGTGGT 8 3
mmu-let-7b_precursor GACGTAGTAGGTTGTGTGGTT 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTAAC 292 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTC 545 3
mmu-let-7b_precursor GAGGGAGTAGGTTGTGTGGT 3 3
mmu-let-7b_precursor GAGGTAGTAGGTCGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTCGGTT 2 3
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTG 2 1
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTGG 3 4
mmu-let-7b_precursor TGAGATAGTAGGTTGTGTGGT 19 1
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTTTA 6 2
mmu-let-7b_precursor TGAGGTAGTAGCTTGTGTGGTTTT 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGAGT 25 1
mmu-let-7b_precursor AGTAGGTTGTGTGGT 99 7
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAGA 9007 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCAT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCTTA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGCAG 2 1
mmu-let-7b_precursor CACGGACACCGCAGGG 11 1
mmu-let-7b_precursor TGAGGAAGTAGGTTGTGTGGTTT 16 1
mmu-let-7b_precursor GTAGGTTGTGTGGTTA 484 41
mmu-let-7b_precursor TGAGGAAGTAGGTTGTGTGGTTA 10 2
mmu-let-7b_precursor TGAGGAAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b_precursor TGAGGTAGAAGGTTGTGTGGTT 41 1
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTTG 11 1
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTTA 65 2
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGTTT 67 1
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTTC 3 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGG 27 1
mmu-let-7b_precursor TGAGGTGGTAGGTTGTGTGT 2 28
mmu-let-7b_precursor AGTAGGTTGTGTGGTTAAA 36 36
mmu-let-7b_precursor AAGGTAGTAGGTTGTGTGGTTA 3 1
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGTAT 8 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTG 4969 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTC 3 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTT 26 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTGAG 4 3
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTAA 9 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTAT 6 14
mmu-let-7b_precursor TGAGATAGTAGGTTGTGTGGTT 98 1
mmu-let-7b_precursor TGAGATAGTAGGTTGTGTGGTA 2 3
mmu-let-7b_precursor TGCTAGTAGGTTGTGTGGTT 9 10
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTAT 14122 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTAC 1164 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTAA 27337 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTAN 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTC 75 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTA 2840 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTT 2963 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAA 14760 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAC 251 2
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTTT 134 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGT 2138 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAT 10311 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGA 20 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGC 2 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTTA 74 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCGTT 117 1
mmu-let-7b_precursor TGAGGTATTAGGTTGTGTGGTTTA 7 2
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTAT 2 1
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTTG 2 3
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTTA 31 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTCT 3 10
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTT 508 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTA 6 2
mmu-let-7b_precursor GTAGGTTGTGTGGTTAAAG 4 38
mmu-let-7b_precursor GAGGTAGGAGGTTGTGTGGT 2 3
mmu-let-7b_precursor TGATGTAGTAGGTTGTGTGGT 138 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTGA 8 23
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTTAAG 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTTG 10 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTTT 79 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTATGGTTAC 24 3
mmu-let-7b_precursor TGGTAGTAGGTTGTGTGG 2 5
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTGGT 50 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b_precursor NAGGTAGTAGGTTGTGTGGTTA 14 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAG 22504 1
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGTTC 2 1
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGTTT 25 1
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGGTTA 26 1
mmu-let-7b_precursor TGAGGTAGGAGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor GAGGTAGTAAGTTGTGTGGTTA 2 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGT 87 1
mmu-let-7b_precursor GAGGCAGTAGGTTGTGTGGTT 14 1
mmu-let-7b_precursor AAGGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b_precursor TGACGTAGTAGGTTGTGTGG 17 1
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTTG 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTTA 83 2
mmu-let-7b_precursor TGAGGTAGTAGGTTCTGTGGTTT 104 1
mmu-let-7b_precursor TAAGGTAGTAGGTTGTGTGGTAT 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTA 2 6
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTAT 133 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTAA 195 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTAC 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTAAAG 1493 1
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTTA 37 1
mmu-let-7b_precursor TAGGTTGTGTGGTTAC 4 35
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGTTG 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTT 374 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGCGTGGTA 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGG 28 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTCTGGTT 2 3
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTTTAA 2 3
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTTTAT 3 2
mmu-let-7b_precursor GGTAGTAGGTTCTGTGGTT 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACAT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACAA 31 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTACAG 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTCC 3 3
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGGT 19 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTTT 30 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTTA 12 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTTTTT 6 3
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b_precursor NAGGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b_precursor GGTAGTAGGTTGTGCGGTT 2 1
mmu-let-7b_precursor ATGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b_precursor TGAGGTAGAAGGTTGTGTGGTTTA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGGTTGGT 2 10
mmu-let-7b_precursor TGAGGTAGTAGATTGTGTGGTAT 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAAG 7 13
mmu-let-7b_precursor TGAGGTAGTAGGTAGTGTGGTTA 5 1
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGCT 2 14
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTCTAG 3 1
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTT 303 1
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTA 6 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATAA 170 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTTA 53 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTTT 59 2
mmu-let-7b_precursor TGAGGTAGTAGGATGTGTGGTTTT 2 2
mmu-let-7b_precursor TGAGGTAGTAGGATGTGTGGTTTA 2 2
mmu-let-7b_precursor CTGAGGTAGTAGGTTGTGTGG 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTTAA 1304 1
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGT 3 6
mmu-let-7b_precursor GTAGGTTGTGTGGTTTAA 21 3
mmu-let-7b_precursor NTAGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTTGTT 182 1
mmu-let-7b_precursor TGAGGTAATAGGTTGTGTGGT 33 1
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTTA 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTACC 8 1
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTAT 8 2
mmu-let-7b_precursor GAGGTAGGAGGTTGTGTGGTT 6 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTTGTT 2 1
mmu-let-7b_precursor GAGGAAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b_precursor GAGGTGGTAGGTTGTGTGGTT 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTA 13 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTT 744 3
mmu-let-7b_precursor TGAGGTAGTAGGCTGTGTG 4 3
mmu-let-7b_precursor NGAGTTAGTAGGTTGTGTGGT 2 2
mmu-let-7b_precursor GAGGTAGTAGGTTCTGTGGTT 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTAAG 221 4
mmu-let-7b_precursor TGAGGTAGTTGGTTGTGTGGTTTT 4 2
mmu-let-7b_precursor TGAGGTAGTTGGTTGTGTGGTTTA 3 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTT 26844 2
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTTTA 6 2
mmu-let-7b_precursor TGATTTAGTAGGTTGTGTGGTT 16 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTTTA 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTGG 56 2
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTTA 33 1
mmu-let-7b_precursor GAACACGGACACCGCAGGG 18 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGGGGGT 2 3
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTTTAA 2 1
mmu-let-7b_precursor TGTGGTAGTAGGTTGTGTGGTTT 22 1
mmu-let-7b_precursor TGTGGTAGTAGGTTGTGTGGTTA 13 1
mmu-let-7b_precursor TTAGGTAGTAGGTTGTGTGGT 103 1
mmu-let-7b_precursor GAGGTAGTAGGTTGGGTGGTT 3 1
mmu-let-7b_precursor TGAAGTAGTAGGTTGTGTGGTT 67 1
mmu-let-7b_precursor TGAAGTAGTAGGTTGTGTGGTA 4 2
mmu-let-7b_precursor TGAGGTAGTAGTTTGTGTTGTTT 11 2
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTGA 2 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCT 41 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCC 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCG 5 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCA 43 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGGTT 29 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGGTA 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCT 15 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTCG 12 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTGTA 270 1
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGGTAA 7 3
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTG 174 1
mmu-let-7b_precursor TGAGGTAGTACGTTGTGTG 2 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTG 16 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTA 95 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTTT 188 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTAAA 6 8
mmu-let-7b_precursor CTATACAACCTACTGCCTTCT 6 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGG 35 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTAAAG 106 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTTC 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGGTTTG 2 5
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTAAA 30 8
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTG 6 3
mmu-let-7b_precursor TCTGAGGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b_precursor TAGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTAA 113 24
mmu-let-7b_precursor TGAGCTAGTAGGTTGTGTGGT 51 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTAAGT 3 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTATGGTTTGA 6 4
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTTTA 10 2
mmu-let-7b_precursor TGAGGAAGTAGGTTGTGTGGT 13 1
mmu-let-7b_precursor TGAGGTTGTAGGTTGTGTGGT 11 1
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGTT 233 1
mmu-let-7b_precursor TGTGGTAGTAGGTTGTGTGGT 11 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTTTGG 43 3
mmu-let-7b_precursor NGAGGTAGTAGGTTG 3 26
mmu-let-7b_precursor TGAGGTAGTAGGTCGTGTGGA 2 1
mmu-let-7b_precursor TGAAGTAGTAGGTTGTGTGGTTT 18 1
mmu-let-7b_precursor CGTTGAGGTAGTAGGTTGTGTGGT 2 2
mmu-let-7b_precursor TGAGGTACTAGGTTGTGTGGTA 5 2
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGTTT 6 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGNA 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTAGTGTGGT 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAG 11 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGC 31 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAT 14 38
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGCGGTAT 10 1
mmu-let-7b_precursor GAGGTAGTGGGTTGTGTGGTT 9 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGCTTT 5 2
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTTAA 10 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTCTGGTT 5 3
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGTTTTA 2 2
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTAGC 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGTTAT 53 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTGTAA 14 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGAT 2 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGAA 12 5
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTA 174 4
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTC 4 5
mmu-let-7b_precursor GAGGTAGTAGGTTGTGA 2 24
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTT 22 3
mmu-let-7b_precursor TAGTAGGTTGTGTGGTTTA 13 3
mmu-let-7b_precursor TGAGGTAGTAGGCTGTCTGGTT 3 3
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAAGT 2 8
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTAT 7 1
mmu-let-7b_precursor TGGTAGTAGGTTGTGTTGTT 2 23
mmu-let-7b_precursor TGAGGTAGCAGGTTGTGTG 3 2
mmu-let-7b_precursor AGAGGTAGTAGGTTGTGTGGT 9 1
mmu-let-7b_precursor TGAGGTAGTAAGTTGTGTGG 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTCTAA 5 1
mmu-let-7b_precursor TTTGAGGTAGTAGGTTGTGTGG 4 4
mmu-let-7b_precursor NGATGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b_precursor TGAGGTAGTAGGTTTTGTG 2 4
mmu-let-7b_precursor GTAGTAGGTTGTGTGG 39 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTCGTTTT 6 3
mmu-let-7b_precursor TGAGGTAGTAGATTGTGTGGTT 107 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAGG 7 1
mmu-let-7b_precursor GTAGGTTGTGTGGTTT 749 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTC 856 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTG 1190 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTTTA 19068 2
mmu-let-7b_precursor AGGTAGTAGGTTGTGTGG 18 1
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTTTT 2 2
mmu-let-7b_precursor TGAGTTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGGTTT 46 1
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGGTTG 4 1
mmu-let-7b_precursor TGAGGTAGTAGGTTATGTGGTTA 33 1
mmu-let-7b_precursor TTAGTAGGTTGTGTGGTT 8 4
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGAGGTTTT 2 2
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGTGGTAT 9 1
mmu-let-7b_precursor TGAGATAGTAGGTTGTGTGGTTT 29 1
mmu-let-7b_precursor TGAGGTCGTAGGTTGTGTGGTTTT 5 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTCAA 4 2
mmu-let-7b_precursor TGAGGTAGTAGGTTGTATGGTTTCAT 2 1
mmu-let-7b_precursor TGAGGCAGTAGGTTGTGTGGTTTAA 9 1
mmu-let-7b_precursor GTAGGTTGTGTGGTTTCT 4 6
mmu-let-7b_precursor TGAGGTAGTTGGTTGTGTGGTTG 2 1
mmu-let-7b_precursor NGAGGTAGTAGGTTGTGTGGTTTTA 15 1
mmu-let-7b_precursor TGGGGTAGTAGGTTGTGGGGTT 6 1
mmu-let-7b_precursor GGAGGTAGTAGGTTGTGTGGTTTAA 2 2
mmu-let-7b_precursor TGAGGGAGTAGGTTGTGTGGTTTAA 5 2
mmu-let-7b_precursor GTAGTAGGTTGTGTGGTTG 10 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTTAT 23 1
mmu-let-7b_precursor GAGGTAGTAGGTTGTGTGGTTTTAA 26 1
mmu-let-7b_precursor TGAGGTAGTGGGTTGTGTGGTTTGA 3 1
mmu-let-7b_precursor TGAGGTAGTAGGTTGTGTGGTATAAG 11 1