id_rna sequence raw_count mapping_loci
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTT 2145578 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTT 295671 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGT 270630 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTT 1287 3
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGGTT 384 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTGT 2 2
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGGTA 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTTGTTTT 13 3
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGG 22 3
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGT 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTG 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTA 16 3
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTT 684 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTA 10 3
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATG 9 3
mmu-let-7c-2_precursor TGAGGTTGTAGGTTGTATG 3 4
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGTGT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTAGG 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGATAT 5 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGGTT 152 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGGTA 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTGTGGTTTT 10 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTT 669 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTA 12 2
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATGGTTT 27 2
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATGGTTA 25 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGG 6 2
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATGGTT 492 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGTAT 4 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTNT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGN 11 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGG 59 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGC 211 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGA 6076 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGTTAT 5 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTAT 7 3
mmu-let-7c-2_precursor TGAGATAGTAGGTTGTATGGTTT 31 2
mmu-let-7c-2_precursor TGAGATAGTAGGTTGTATGGTTA 25 3
mmu-let-7c-2_precursor TGAGATAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTACGGTT 12 2
mmu-let-7c-2_precursor TAGTAGGTTGTATGG 27 4
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTGTGGTTTT 4 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTTTTT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTGTA 79 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTGTC 2 1
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTAT 7 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTAT 7 3
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTTT 135 2
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTTA 62 2
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTTG 12 3
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGGT 2 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATTTTT 5 11
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGTTTT 7 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGTTTA 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATAGTTATG 3 4
mmu-let-7c-2_precursor NGATGTAGTAGGTTGTATGGTT 5 3
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTT 1020 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTA 13 4
mmu-let-7c-2_precursor GTAGTAGGTTGTATGTTT 2 7
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTC 59 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTG 98 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGGATGGTTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGGATGGTTA 5 4
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTG 15 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTA 449 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTC 7 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTN 2 2
mmu-let-7c-2_precursor TATTAGGTTGTATGGTT 2 29
mmu-let-7c-2_precursor GTAGGTTGTATGGTT 4462 5
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTAAGGTT 3 2
mmu-let-7c-2_precursor TGTAGTAGGTTGTATGGTTA 6 12
mmu-let-7c-2_precursor GGTATTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGTTTT 5 1
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTGTGGTTTT 5 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGCATGGTT 10 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGGTTT 5 2
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGATTT 2 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATG 2 5
mmu-let-7c-2_precursor TGTAGTAGGTTGTATGGT 25 7
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTGTGGTTTT 12 2
mmu-let-7c-2_precursor TGACGTAGTAGGTTGTATGGTTA 28 3
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGTA 8 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGCT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTGGTATGGTTT 6 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTGGTATGGTTG 2 2
mmu-let-7c-2_precursor GGTAGCAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTATGGTTT 31 2
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTATGGTTA 15 2
mmu-let-7c-2_precursor NGAGGTAGTAGTTTGTATGGTT 3 3
mmu-let-7c-2_precursor TTATGTAGTAGGTTGTATGGTT 6 4
mmu-let-7c-2_precursor TGAGGTAGTAGGATGTATGGT 15 2
mmu-let-7c-2_precursor TTAGGTAATAGGTTGTATGGTT 3 3
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTGTGGTTTT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTAGTATGGT 6 2
mmu-let-7c-2_precursor CGAGGCAGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGGTAGTAGGTTGTATGGTTAT 2 1
mmu-let-7c-2_precursor TGAGGGAGTCGGTTGTATGGTT 5 2
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTATGGTTT 13 2
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTATGGTTA 7 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTGTAG 11 2
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATG 3 2
mmu-let-7c-2_precursor GGTAGTAGGTTGT 3 43
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTA 8 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTT 701 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGAATT 3 1
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTA 2 25
mmu-let-7c-2_precursor GGAGGTAGTAGGTTGTATGGTTA 21 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGGGTTT 11 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGGGTTA 6 3
mmu-let-7c-2_precursor TATACAATCTACTGTCTTTCTT 2 2
mmu-let-7c-2_precursor TGATCTAGTAGGTTGTATGGTTT 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGATGTATGGTTA 13 2
mmu-let-7c-2_precursor TGAGGTTGTAGGTTGTATGG 5 2
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGG 33 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTTTATGGT 2 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATG 23 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTTT 67 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTTG 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTTA 57 2
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGA 2 9
mmu-let-7c-2_precursor TGAGATAGTAGGTTGTATGGTT 245 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGT 183 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGA 4 7
mmu-let-7c-2_precursor TGAGGTAGTAGGTGGTATGGTTA 5 4
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATG 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGG 19 2
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATGGT 32 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTGTT 3 1
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTAT 4 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGTT 22 2
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTATGGTAT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGT 109 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGA 3 5
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTTTT 3 1
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGT 27 2
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGA 2 4
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTGT 5 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTGA 11 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGA 31 9
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTA 1990 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGGTT 2 4
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGGT 17 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGT 20 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGG 874 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGA 32 4
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATGGTA 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTAGTATGGTT 61 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGTT 896 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGTA 11 4
mmu-let-7c-2_precursor TGAGGTAGAAGGTTGTATGGTT 156 2
mmu-let-7c-2_precursor TGAGGTAGAAGGTTGTATGGTA 5 3
mmu-let-7c-2_precursor GAGGTCGTAGGTTGTATGGTT 4 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGTTGT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTTTT 5 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCTTT 5 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTTTTT 4 4
mmu-let-7c-2_precursor NAGGTAGTAGGTTGTAT 2 4
mmu-let-7c-2_precursor AGTAGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor AAGGTAGTAGGTTGTATGGTT 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTGAT 12 1
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGT 45 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGA 4 7
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATGGTTTT 5 1
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGTT 651 2
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGTG 2 2
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGTA 6 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGG 13 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGG 30 2
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGTTA 47 2
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGTTT 88 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGAAT 20 3
mmu-let-7c-2_precursor TACAATCTACTGTCTTT 2 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGAA 8 17
mmu-let-7c-2_precursor TGAGGTAGTAGGGTGTATGGTA 2 3
mmu-let-7c-2_precursor TGAGGTAGAAGGTTGTATGG 4 3
mmu-let-7c-2_precursor GAGGTAGTATGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTGGTATGGT 17 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTTTT 15 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTGT 34 1
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGTTA 24 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGTTT 46 2
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGA 3 3
mmu-let-7c-2_precursor GAGGTAGTACGTTGTATGGTT 2 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTTA 135 2
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAAGTTGTATGG 6 3
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGTT 670 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGTA 11 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTAGG 14 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGTT 8 3
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGTTT 44 2
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGTTG 3 2
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGTTA 40 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTTGT 4 1
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGGTT 6 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGGTA 3 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGNTT 18 2
mmu-let-7c-2_precursor TGATGAGGTAGTAGGTTGTATGGT 2 3
mmu-let-7c-2_precursor GAGGTAGCAGGTTGTATGGTT 10 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTA 19 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTG 2 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTT 2476 2
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTTA 82 5
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTGTGGTTTT 10 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTT 287 3
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATGG 6 2
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATTGTT 2 6
mmu-let-7c-2_precursor TAGTAGGTTGTATG 7 11
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGCTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTGG 41 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTTC 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTTG 7 3
mmu-let-7c-2_precursor CGAGGTAATAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGG 22 3
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTTGT 3 1
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATGG 9 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATG 2 4
mmu-let-7c-2_precursor TTGGGCTCTGCCCCGCTCTGCGGTAT 2 1
mmu-let-7c-2_precursor TAGTAGGATGTATGGTT 2 12
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGTTAT 11 1
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTGTGGTTTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTA 826 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTT 1175 1
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTTC 6 2
mmu-let-7c-2_precursor AGTAGGTTGTATGGTT 530 3
mmu-let-7c-2_precursor TGAGATAGTAGGTTGTATGG 8 3
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGTTGT 3 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTTTGGTT 6 3
mmu-let-7c-2_precursor TGAGGAAGTAGGTTGTATGGTTAT 6 1
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTAT 2 12
mmu-let-7c-2_precursor AGGGAGTAGGTTGTATGGTT 3 2
mmu-let-7c-2_precursor TGAGGTAGAAGGTTGTATGGT 16 2
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGTTTT 7 1
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTAT 3 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTTGG 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTGC 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTGG 16 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTGT 28 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTTGT 2 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTAAT 4 2
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATGG 9 3
mmu-let-7c-2_precursor NGAGGTAGTATGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGCTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTGTT 46 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGGATGGTT 9 3
mmu-let-7c-2_precursor TGAGGAAGTAGGTTGTATGGTT 176 2
mmu-let-7c-2_precursor TGAGGAAGTAGGTTGTATGGTA 2 3
mmu-let-7c-2_precursor NAGGTAGTAGGTTGTATGG 8 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATG 3 2
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGT 28 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTGT 6178 2
mmu-let-7c-2_precursor GTGAGGTAGTAGGTTGTATTGTT 2 2
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCCT 4 2
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCCA 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTGA 24 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTCG 7 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTCC 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTCT 6 3
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGGTTAT 5 1
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGA 4 3
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATG 3 2
mmu-let-7c-2_precursor ACGTAGTAGGTTGTATGGT 3 3
mmu-let-7c-2_precursor GCGGTAGTAGGTTGTATGGT 5 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATG 417 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTTT 245 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTTA 170 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTTC 6 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTTG 18 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTC 20 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTCGTATGGTT 5 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATG 8 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGA 2 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGT 73 2
mmu-let-7c-2_precursor NAAGGTAGTAGGTTGTATGGTT 3 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTTTGGT 2 3
mmu-let-7c-2_precursor NGAGGTCGTAGGTTGTATGGTT 3 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGT 7 11
mmu-let-7c-2_precursor GAGGTAGTAGGCTGTATGGT 2 2
mmu-let-7c-2_precursor NGTAGTAGGTTGTATGGTT 17 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTATG 180 1
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATGGTTAT 4 1
mmu-let-7c-2_precursor GAGGTAGTAGGATGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTCTT 5 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATCGTT 3 5
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATG 2 2
mmu-let-7c-2_precursor TGAAGTAGTAGGTTGTATGGTTT 28 2
mmu-let-7c-2_precursor TGAAGTAGTAGGTTGTATGGTTA 20 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTT 1123 2
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATGGTTT 31 2
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATGGTTA 22 2
mmu-let-7c-2_precursor TGAGGTAGTAGGGTGTATGG 3 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGTT 2 6
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTGTGGTTTT 384 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGGTTAT 8 1
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTAT 3 10
mmu-let-7c-2_precursor GAGGTAGTAGGTCGTATGGTT 6 2
mmu-let-7c-2_precursor TAGTAGGTTGTGTGGTTTTT 4 26
mmu-let-7c-2_precursor TGAGGTAGTAGGATGTATGG 3 2
mmu-let-7c-2_precursor GAGGTAGCAGGTTGTATGGT 2 2
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGTTGT 2 2
mmu-let-7c-2_precursor TGATCTAGTAGGTTGTATGGTT 4 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTTT 3426 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGG 14 2
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATGGTTAT 5 1
mmu-let-7c-2_precursor GGGAGTAGGTTGTATGGTT 2 4
mmu-let-7c-2_precursor GGTACTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATGGTTT 44 2
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor TGAAGTAGTAGGTTGTATGGTT 178 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTA 6 15
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTGTGGTTTT 14 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGTTGT 3 3
mmu-let-7c-2_precursor TGGTAGTAGGTTGTATGGTT 210 2
mmu-let-7c-2_precursor TGGTAGTAGGTTGTATGGTA 3 14
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATAT 2 7
mmu-let-7c-2_precursor GTGAGGTAGTAGGTTGTATGGTT 9 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGGTT 25 2
mmu-let-7c-2_precursor TAGTAGGTTGTATGGT 101 4
mmu-let-7c-2_precursor TAGTAGGTTGTATGGA 9 42
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTG 11 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTT 203 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTC 6 3
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATG 5 5
mmu-let-7c-2_precursor GAGGGAGGAGGTTGTATGGTT 4 9
mmu-let-7c-2_precursor GGAGGTAGTAGGTTGTGTGGTTTT 2 3
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTGTGGTTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGGTTGGTT 7 10
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTTTGGTT 6 3
mmu-let-7c-2_precursor ATGTAGTAGGTTGTATGGTT 6 3
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTTGT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGAATGGTT 67 2
mmu-let-7c-2_precursor TGTGGTAGTAGGTTGTATGGTTAT 3 1
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATGGTTAT 10 1
mmu-let-7c-2_precursor TGGGGTATTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGGTTTT 6 1
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTAT 4 3
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGT 58 3
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATGGTTT 12 2
mmu-let-7c-2_precursor TGACTTAGTAGGTTGTATGGTT 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTAT 3 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTTAT 39 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGT 3984 2
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGGTTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTTAT 7 1
mmu-let-7c-2_precursor TCTGGTAGTAGGTTGTATGGTT 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATAGTTCTGG 3 3
mmu-let-7c-2_precursor GACGTAGTAGGTTGTATGGTT 6 2
mmu-let-7c-2_precursor TATACAATCTACTGTCTT 2 2
mmu-let-7c-2_precursor GAGGTAGCAGGTTGTATGGGT 2 4
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATG 9 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATG 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTAT 232 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTAA 280 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTTAT 10 1
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGTT 225 2
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGTA 7 2
mmu-let-7c-2_precursor GTAGTAGGTTGTAT 4 20
mmu-let-7c-2_precursor TGAGGTAGTAGGTGGTGTGGTTTT 3 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGT 94 2
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGA 2 10
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTT 28956 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTA 10 4
mmu-let-7c-2_precursor NTAGGTTGTATGGTT 24 18
mmu-let-7c-2_precursor NGAGGTATTAGGTTGTATGGTT 6 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGAG 2 33
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATTGTT 3 5
mmu-let-7c-2_precursor TGGTAGTAGGTTGTATGGT 17 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATGTGGTTTT 6 2
mmu-let-7c-2_precursor TGAGGAAGTAGGTTGTATGGTTA 33 2
mmu-let-7c-2_precursor TGAGGAAGTAGGTTGTATGGTTT 15 2
mmu-let-7c-2_precursor GGTAGTAGGCTGTATGGTT 4 2
mmu-let-7c-2_precursor CAGGTAGTAGGTTGTATGGTT 21 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGG 22 3
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGA 3 3
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTTC 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGT 158 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGA 4 5
mmu-let-7c-2_precursor GTAGTAGGTTGTGTGGTTTTT 4 3
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGGTAT 4 2
mmu-let-7c-2_precursor TCTGAGGTAGTAGGTTGTATGGT 10 2
mmu-let-7c-2_precursor NAGGTAGTAGGTTGTATGGTTT 20 2
mmu-let-7c-2_precursor NAGGTAGTAGGTTGTATGGTTA 11 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGAATGGT 11 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTTGT 2 1
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTGT 2 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTATATGGTT 7 2
mmu-let-7c-2_precursor GTAGTAGGTTGTATGG 31 2
mmu-let-7c-2_precursor GAGTAGTAGGTTGTATGGTT 21 9
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATTGTT 8 5
mmu-let-7c-2_precursor TTAGTAGGTTGTATGGTT 6 8
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATGG 8 2
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGGT 2 2
mmu-let-7c-2_precursor TGAGGGGGTAGGTTGTATGGTT 3 3
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCGT 2 2
mmu-let-7c-2_precursor TGGTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTG 8 4
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATGGTTA 25 2
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATGGTTT 29 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCGTTC 3 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCGTTA 61 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCGTTT 53 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCGTTG 4 7
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTTT 74 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTTA 54 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTTC 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTTN 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTTG 6 2
mmu-let-7c-2_precursor TCACGTAGTAGGTTGTATGGT 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGATT 15 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGATA 14 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGATC 4 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTTAT 12 1
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGGTTT 32 3
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTGTGGTTTT 6 4
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGTTTT 4 1
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTATGGTTAT 2 1
mmu-let-7c-2_precursor GGAGGTAGTAGGTTGTATGGT 16 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTTTT 6 1
mmu-let-7c-2_precursor GAGGTACTAGGTTGTATGGTT 8 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTAT 13 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTGC 17 2
mmu-let-7c-2_precursor GAGGTATTAGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTAAGG 12 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGT 25 11
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGTT 2 6
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGTTT 2 3
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTT 571 2
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTA 4 3
mmu-let-7c-2_precursor TATGTAGTAGGTTGTATGGT 2 20
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGT 98 2
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTTTAAG 2 5
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGA 2 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTATAG 50 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGTTT 47 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGTTA 7 5
mmu-let-7c-2_precursor NGTAGTAGGTTGTATGGTTA 2 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGG 16 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTTTGGTTA 4 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGC 17 2
mmu-let-7c-2_precursor TGAGGAGGTAGGTTGTATGGTT 22 3
mmu-let-7c-2_precursor TGGGTAGTAGGTTGTATGGTT 47 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTCAT 8 1
mmu-let-7c-2_precursor AGGTAGTAGGTTGTGTGGTTAT 25 4
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGTTTT 3 1
mmu-let-7c-2_precursor NGAGTTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTT 824 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTA 11 5
mmu-let-7c-2_precursor TGTGGTAGTAGGTTGTATGG 7 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGGGTT 76 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTGT 15 1
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATCGTTT 4 5
mmu-let-7c-2_precursor TGAGGTAGTAGGGTGTATGGTTAT 4 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTCTGGTT 6 3
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTTTA 4 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTTAT 9 1
mmu-let-7c-2_precursor AGTAGGTTGTGTGGTTTT 23 9
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGTT 7 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGAA 1549 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGG 45 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGT 95 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGA 2 2
mmu-let-7c-2_precursor TGTAGTAGGTTGTATGGTTT 5 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTGTGGTTAT 1278 3
mmu-let-7c-2_precursor GAGGTTGTAGGTTGTATGGTTA 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTTTT 8 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTTTA 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTAGT 131 1
mmu-let-7c-2_precursor TGAAGTAGTAGGTTGTATG 2 5
mmu-let-7c-2_precursor TGAGGTAGTAAGTTGTATGGTTT 25 2
mmu-let-7c-2_precursor TGAGGTAGTAAGTTGTATGGTTA 14 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTC 5 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTA 131 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTG 15 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGT 89 2
mmu-let-7c-2_precursor TGACGTAGTAGGTTGT 2 15
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTTT 74 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGT 116 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTTA 60 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTTAT 10 1
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGA 7 5
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGG 8 2
mmu-let-7c-2_precursor TGAGGAAGTAGGTTGTATGG 3 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGA 3 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTATG 36 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTATC 175 1
mmu-let-7c-2_precursor NAGGTAGTAGGTTGTATG 3 2
mmu-let-7c-2_precursor TTGAGGTAGTAGGTTGTATGGTTTT 14 2
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTGTGGTTTT 11 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATG 4 2
mmu-let-7c-2_precursor GGAGGTAGTAGGTTGTATGG 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTAT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGGTTTTT 2 1
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGT 48 2
mmu-let-7c-2_precursor NGAGGCAGTAGGTTGTATGGTT 3 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTAG 28 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTAC 5 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTAT 129 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTAA 207 3
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTTAG 5 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTA 12 2
mmu-let-7c-2_precursor GTAGTAGGTTGTGTGGTTGT 5 16
mmu-let-7c-2_precursor TGTAGTAGGTTGTATGG 3 14
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTATGG 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGTTT 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGTTT 6 2
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTTA 66 2
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTTG 3 3
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTTT 92 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGCATGGTT 4 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGG 20 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGT 3 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTCT 118 2
mmu-let-7c-2_precursor TGGTAGTAGGTTGTATGGTTT 7 2
mmu-let-7c-2_precursor TGGTAGTAGGTTGTATGGTTA 6 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTGG 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTGT 222 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTGA 352 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTGT 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATTGTT 4 12
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTA 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGCGGTTTT 19 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTTTTA 4 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTA 41 3
mmu-let-7c-2_precursor GGTAGTAGGTTGTATTGTT 3 9
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTTGT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTTAT 43 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATCGTT 7 4
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTTT 22 1
mmu-let-7c-2_precursor TGAGGCAGTCGGTTGTATGGTT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTTTT 5 1
mmu-let-7c-2_precursor AGGTTGTATGGTTT 11 34
mmu-let-7c-2_precursor NGGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor GTGAGGTAGTAGGTTGTATGGT 5 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTN 109 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTC 702 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTA 27776 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTG 1098 2
mmu-let-7c-2_precursor CGATGTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTCT 51 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTCG 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTCA 61 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTCC 2 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTGTGGTTGT 10 4
mmu-let-7c-2_precursor GAGGTTGTAGGTTGTATGGTT 12 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGTTT 50 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGTTG 7 3
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGTTA 31 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGT 132 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGA 2 4
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTTT 23 2
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTTG 4 2
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATTG 2 8
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTTTGGTT 2 6
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATTGTT 2 5
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATG 5 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTTT 79 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTTG 10 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTTC 3 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTTA 64 2
mmu-let-7c-2_precursor GTGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATGGTTT 38 2
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATGGTTA 45 2
mmu-let-7c-2_precursor AGTAGGTTGTATGG 34 13
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTTTG 12 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGG 25 3
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTTA 88 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTTC 3 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTTG 7 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTTT 140 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATG 7 2
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGTT 206 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTTA 67 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTTG 11 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTTC 3 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTTT 121 2
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTTTT 7 1
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATG 3 2
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGG 10 4
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGA 9 18
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTAAGGTT 2 2
mmu-let-7c-2_precursor TGAAGTAGTAGGTTGTATGG 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTCTG 8 37
mmu-let-7c-2_precursor TCAGGTAGTCGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGT 1335 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGA 28 3
mmu-let-7c-2_precursor TGTAGTAGGTCGTATGGTT 2 12
mmu-let-7c-2_precursor TGATTTAGTAGGTTGTATGGTT 11 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGCATGGTTT 3 3
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTTAT 13 1
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGTAT 3 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTGTGGTTTT 7 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTTAT 28 1
mmu-let-7c-2_precursor GAGGTAGTAGCTTGTATGGT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGT 1390 8
mmu-let-7c-2_precursor TGAGGTAGTAGGATGTATGGTTT 18 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTTT 87 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGTTT 7 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGTTA 48 3
mmu-let-7c-2_precursor GAGGTAGGAGGTTGTATAGTTTTG 2 4
mmu-let-7c-2_precursor NGAGGTAGTAGGCTGTATGGTT 4 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGTTA 46 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTTTGGTT 2 4
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTAT 2 2
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTAG 2 5
mmu-let-7c-2_precursor AGGTAGTAGGTTGTGTGGTTGT 2 3
mmu-let-7c-2_precursor GCGGTAGTAGGTTGTATGGTT 7 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTTG 174 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTTC 119 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTTTT 8 1
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTTTT 2 1
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGA 7 4
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGTAT 2 2
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGTTT 30 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATGGTTAT 4 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTGGGTT 3 7
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTT 589 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTA 5 2
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTTA 20 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTTAT 18 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTAGTATGGTTT 7 2
mmu-let-7c-2_precursor CTAGGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTATA 139 2
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTATGGT 24 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTATT 52 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTAT 119 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTGTGGTTGT 23 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTTGA 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGG 52 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATG 4 2
mmu-let-7c-2_precursor TGAGGAAGTAGGTTGTATGGT 27 2
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor TGGTAGTAGGTTGTGTGGTTTT 2 5
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTTT 167 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTCTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTAT 24 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGCT 8 3
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGTTAT 8 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTATTT 13 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTATTA 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTCTTGA 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGTTTT 5 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTGGTATGGTT 105 2
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTAAG 3 38
mmu-let-7c-2_precursor GAGGTAGTAGCTTGTATGGTT 4 2
mmu-let-7c-2_precursor TGTGGTAGTAGGTTGTATGGTT 145 2
mmu-let-7c-2_precursor TGAGGTCGTCGGTTGTATGGTT 8 2
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGG 13 4
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGA 4 11
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGT 4 16
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATGGT 45 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTCTT 2 1
mmu-let-7c-2_precursor GAGGTAGTAGGCTGTATGGTTT 3 2
mmu-let-7c-2_precursor TCCGGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor GTAGGTTGTGTGGTTTT 54 41
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTTT 37 1
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATGGT 42 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTCTGGTT 2 4
mmu-let-7c-2_precursor GGAGGTAGTAGGTTGTATGGTT 110 2
mmu-let-7c-2_precursor TCGTAGTAGGTTGTATGGTT 6 6
mmu-let-7c-2_precursor TGAGGGAGTGGGTTGTATGGTT 2 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTAT 109468 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTATATGGTTAT 2 1
mmu-let-7c-2_precursor NTAGGTAGTAGGTTGTATGGTT 8 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTGTGGTTATG 4 1
mmu-let-7c-2_precursor NGGGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-2_precursor GAGGTAGAAGGTTGTATGGTT 4 2
mmu-let-7c-2_precursor TGACGTAGTAGGTTGTATGGTTAT 2 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTTAT 15 1
mmu-let-7c-2_precursor GAGGTAATAGGTTGTATGGTT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTACG 12 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTTA 72 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTTT 105 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTTG 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTTC 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATAGTTCTG 6 4
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGG 4 2
mmu-let-7c-2_precursor TTGAGGTAGTAGGTTGTATGGTTAT 56 2
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGT 3 23
mmu-let-7c-2_precursor GAGGTAGTAGGTTG 38 26
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTCGT 2 1
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATGGT 51 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTATT 45 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTAT 8352 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTAC 538 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTAA 14746 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTAG 3397 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTAN 3 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTTA 39 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTTG 3 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTTT 50 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor TGATAGTAGGTTGTATGGTT 11 9
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTT 1434 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTG 90 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTA 1159 2
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATG 5 4
mmu-let-7c-2_precursor GAGGTAGGAGGTTGTATGGT 9 4
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTATGG 3 4
mmu-let-7c-2_precursor TGAGGTTGTAGGTTGTATGGTT 110 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGATTT 2 1
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTA 5 2
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTT 562 2
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATGGTT 135 2
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGA 3 14
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTAT 188 1
mmu-let-7c-2_precursor GATGTAGTAGGTTGTATGGT 3 3
mmu-let-7c-2_precursor TGCGGGAGTAGGTTGTATGGTT 3 3
mmu-let-7c-2_precursor GGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTGTGGTTTT 14 2
mmu-let-7c-2_precursor GAGGTAGTTGGTTGTATGGTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTGTGGTTTT 20 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATG 84 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTGTTATGGT 2 4
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGT 99 3
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGA 2 3
mmu-let-7c-2_precursor NGAGGGAGTAGGTTGTATGGTT 5 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTTAT 14 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGGT 50 2
mmu-let-7c-2_precursor TGAGGTAGTAGGATGTATGGTA 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTCTG 5 1
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTTGT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTG 17 5
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATGGTTA 24 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTC 3 16
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTA 18 15
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTT 601 23
mmu-let-7c-2_precursor TGAGGTGGTGGGTTGTATGGTT 5 2
mmu-let-7c-2_precursor GAGGTAGTGGGTTGTATGGTT 6 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTTAT 8 1
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGATT 186 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGATA 5 3
mmu-let-7c-2_precursor TCAAGTAGTAGGTTGTATGGTT 2 4
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGG 9 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTNT 13 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGCTT 14 2
mmu-let-7c-2_precursor CGATGAGGTAGTAGGTTGTATGGTT 2 3
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGGTTAT 11 1
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATGG 11 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTGTGGTTTT 8 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGATTA 23 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGATTT 11 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGT 128 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGG 15 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTTTT 72 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTTT 222 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTTC 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTTA 166 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTTG 12 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTT 512 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTTGT 3 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTT 5169 17
mmu-let-7c-2_precursor GAGTTAGTAGGTTGTATGGT 9 2
mmu-let-7c-2_precursor NGTAGGTTGTATGGTT 5 5
mmu-let-7c-2_precursor NGAGGTAGTAGGTTTTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGT 162 2
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGG 3 5
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGA 3 7
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCGTT 625 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCGTA 6 5
mmu-let-7c-2_precursor AGTAGGTTGTATGGTAT 5 14
mmu-let-7c-2_precursor TGAGGTAGTAGGGTGGATGGTT 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGGTTT 58 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGGTTA 25 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGGTTG 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTT 11 15
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTT 852 3
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTGTGGTTTT 5 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTTT 89 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTTA 70 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTTG 5 2
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTTC 3 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCG 17 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCT 5 16
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTTGT 3 1
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGT 34 2
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGA 3 11
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATG 6 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGGATGGT 3 2
mmu-let-7c-2_precursor GAGGTAGTGGGTTGTATGGT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGGTTTT 2 1
mmu-let-7c-2_precursor TAGGTTGTATGGTTT 42 9
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTTTTT 3 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGT 68 2
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTGTGGTTTT 4 3
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGTTGT 2 1
mmu-let-7c-2_precursor GAGGTAGTAGTTTGTATGGTT 6 3
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATG 6 2
mmu-let-7c-2_precursor TGAGGTAGTATTTTGTATGG 2 10
mmu-let-7c-2_precursor TGAAGTAGTAGGTTGTATGGT 22 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTTTGGTT 2 4
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATG 3 2
mmu-let-7c-2_precursor AGTAGGTTGTATGGTTT 109 2
mmu-let-7c-2_precursor AGTAGGTTGTATGGTTA 72 16
mmu-let-7c-2_precursor AGTAGGTTGTATGGTTG 16 18
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTTAT 12 1
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCT 104 2
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCC 101 2
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCG 8 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGTTAT 5 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATAGTTTTGT 4 3
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGTTTT 8 1
mmu-let-7c-2_precursor TGAGGAGGTAGGTTGTATGGT 3 6
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGAATGG 7 2
mmu-let-7c-2_precursor NGACGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor AGTAGTAGGTTGTATGGTTA 2 11
mmu-let-7c-2_precursor GAGGTAGTAGGCTGTATGGTT 9 2
mmu-let-7c-2_precursor CAGGTGAGGTAGTAGGTTGTATGGTT 2 1
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTGTGGTTTT 2 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTAT 2 4
mmu-let-7c-2_precursor TGAGATAGTAGGTTGTATGGTTAT 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGATGTATGGTT 111 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGTTT 58 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGTTA 28 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTGA 497 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTGG 14 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTGC 21 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTGT 347 2
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTC 66 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTAAT 471 2
mmu-let-7c-2_precursor GTTAGTAGGTTGTATGGTT 2 4
mmu-let-7c-2_precursor GGTAGTAGGTTGTGTGGTTCT 3 3
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTAT 3 7
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGGTT 328 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGGTA 5 2
mmu-let-7c-2_precursor TGAGGTAGTAAGTTGTGTGGTTTT 6 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTTTATGG 2 29
mmu-let-7c-2_precursor GAGGTAGCAGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor GAGGTAGCAGGTTGTATGGTTA 2 3
mmu-let-7c-2_precursor GTAGGTTGTATGGTTGT 10 15
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGCTTT 3 1
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGTTT 66 2
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCTG 2 3
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCTA 4 3
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTTCTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTTGTT 3 9
mmu-let-7c-2_precursor TGAGGTAGAGGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGATT 3 2
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGTA 2 3
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATGGTTA 8 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTTAT 16 1
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTTTT 7 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGTT 820 5
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGG 26 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGT 2 10
mmu-let-7c-2_precursor TGAGGTAGGAGGGTGTATGGTT 2 6
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATGG 13 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTATGT 28 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTATGA 41 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTATGC 2 1
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATGGTT 229 2
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATGGT 30 2
mmu-let-7c-2_precursor GTAGGTTGTATGGT 431 15
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGGGT 14 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGT 104 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCGTGGTTTT 8 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGTAT 4 4
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGGTTG 4 2
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGGTTT 49 2
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGGTTA 35 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTA 12 3
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGTT 365 2
mmu-let-7c-2_precursor TGAGGTAGTAGGGTGTATGGTTT 14 2
mmu-let-7c-2_precursor TGAGGTAGTAGGGTGTATGGTTA 12 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTAAG 13 3
mmu-let-7c-2_precursor GAGGTAGTAGATTGTATGGTT 5 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGAGT 6 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGG 16 2
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTGTGGTTTT 19 2
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTTGA 129 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTTGT 84 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGCTAT 7 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTTTT 72 6
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTG 5 5
mmu-let-7c-2_precursor GAGGTGGTAGGTTGTATGGTT 9 2
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTTGT 3 1
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTTA 46 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTTC 5 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTTG 4 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTTT 74 2
mmu-let-7c-2_precursor GGTTGTATGGTTTT 2 28
mmu-let-7c-2_precursor GGGGTAGTAGGTTGTATGGTTA 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGNTG 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGNTA 5 2
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGG 32 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGG 3 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGTA 19 7
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTA 24 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGNTAT 2 1
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGTTT 2 3
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTTAT 2 1
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTTAT 11 1
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTCTGGTT 2 3
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGG 19 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTGGGTTT 2 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGNTT 7 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGTT 1239 3
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGTA 17 6
mmu-let-7c-2_precursor TGAGGTAGTAGGATGTATGGTTAT 3 1
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTCTGGTT 2 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGAT 7 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGAA 20 4
mmu-let-7c-2_precursor CGATGTAGTAGGTTGTATGGTT 2 3
mmu-let-7c-2_precursor NTGAGGTAGTAGGTTGTATGGTT 7 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATG 8 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAATGT 2 14
mmu-let-7c-2_precursor GAGGTAGTAGGTTTTATGGTT 9 2
mmu-let-7c-2_precursor GAGGTGGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor GAGGTGGTAGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor GAGGCAGTAGGTTGTATGGT 6 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTG 1284 10
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTAT 5 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGCATGGT 2 3
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGT 53 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGA 4 6
mmu-let-7c-2_precursor GTAGTAGGTTGTGTGGTTAT 85 12
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATGGTA 3 2
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATGGTT 270 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTA 126 3
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTT 1247 2
mmu-let-7c-2_precursor TGAGGGCGTAGGTTGTATGGTT 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTT 548 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTA 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTAG 55 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTGTT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTTTT 3 1
mmu-let-7c-2_precursor TTAGGTAGTAGGTTCTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGAAGTAGGTTGTATG 2 8
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTAGG 54 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGGGGTTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTGTTATGGTT 6 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTTC 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTTA 53 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTTT 62 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTTG 8 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTTG 12 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTTC 3 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTTT 254 2
mmu-let-7c-2_precursor TGACGTAGTAGGTTGTATGGTTT 24 2
mmu-let-7c-2_precursor GAGGCAGTAGGTTGTATGGTTT 8 2
mmu-let-7c-2_precursor TATACAATCTACTGTCTTTCC 3 2
mmu-let-7c-2_precursor TATACAATCTACTGTCTTTCT 4 3
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGTT 362 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGTA 6 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTGTGGTTAT 97 6
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTATG 2 6
mmu-let-7c-2_precursor GACGTAGTAGGTTGTATGGT 3 3
mmu-let-7c-2_precursor ATCTACTGTCTTTCC 2 16
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGTTT 2 4
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGGTT 3 3
mmu-let-7c-2_precursor TGGTAGTAGGTTGTATGG 4 7
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGTTG 6 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATTGT 3 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTTT 107 10
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTACGGTT 2 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTGT 4583 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTGC 195 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTTAT 17 1
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATG 6 2
mmu-let-7c-2_precursor TGACGTAGTAGGTTGTATGG 10 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTTTGG 3 4
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGGTT 475 4
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGGTA 3 5
mmu-let-7c-2_precursor GAGGTAGTAGGTTCTATGGTT 7 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTAT 42 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTGTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATG 7 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTTTT 3 1
mmu-let-7c-2_precursor TGTGGTAGTAGGTTGTATGGTTT 16 2
mmu-let-7c-2_precursor TGTGGTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor TGTGGTAGTAGGTTGTATGGTTA 20 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTCTGGT 2 3
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATGGT 19 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAATGTT 4 11
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGCT 3 3
mmu-let-7c-2_precursor GGGGTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTGTGGTTTT 20 2
mmu-let-7c-2_precursor GAGCTAGTAGGTTGTATGGTT 7 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGTT 2 3
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTTT 117 2
mmu-let-7c-2_precursor GATGTAGTAGGTTGTATGGTT 36 3
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGG 17 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTGG 11 3
mmu-let-7c-2_precursor TGTAGTAGGTTGTATGGTT 267 5
mmu-let-7c-2_precursor TGTAGTAGGTTGTATGGTA 5 45
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTA 2 18
mmu-let-7c-2_precursor TGAGCTAGTAGGTTGTATG 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTGGA 2 1
mmu-let-7c-2_precursor TGAGGTTGTAGGTTGTATGGTTT 21 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCTTTT 3 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTAT 18 2
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATGGTAT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTTT 183 1
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGA 4 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGT 139 2
mmu-let-7c-2_precursor GAGGTAGGAGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor GAGGTAGGAGGTTGTATGGTTA 3 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTGT 11 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGT 103 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGA 3 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGA 5 6
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAG 74 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAC 10 30
mmu-let-7c-2_precursor GGAGGTAGTAGGTTGTATGGTTT 13 2
mmu-let-7c-2_precursor TTGGGCTCTGCCCCGCTCTGCGGT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAAGTTGTATGGTT 147 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGT 799 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGA 1413 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGG 53666 2
mmu-let-7c-2_precursor NTGAGGTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor NTGAGGTAGTAGGTTGTATGGTTA 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATG 7 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTTG 7 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTTA 17 2
mmu-let-7c-2_precursor GGCAGTAGGTTGTATGGTT 3 3
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTTG 13 3
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTTT 98 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTTA 96 2
mmu-let-7c-2_precursor TGAGCTCGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTT 782 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTA 12 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTC 2 2
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGCTT 2 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGTTT 8 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGAT 47 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGAA 160 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGAG 18 4
mmu-let-7c-2_precursor TGACGTAGTAGGTTGTATGGA 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGNT 64 2
mmu-let-7c-2_precursor NAGGTAGTAGGTTGTATGGTT 122 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGGTA 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGTCT 2 4
mmu-let-7c-2_precursor AGTAGGTTGTATGGTTAT 14 9
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGCAT 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTATATGG 16 2
mmu-let-7c-2_precursor TATACAATCTACTGTCTTTC 2 2
mmu-let-7c-2_precursor TGAGATAGTAGGTTGTGTGGTTTT 3 2
mmu-let-7c-2_precursor TGTGGTAGTAGGTTGTATGGTA 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATG 13720 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATC 4 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATT 17 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTATC 23 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTATG 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTATT 13 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGGATGGTT 41 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGGTAT 3 2
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTAT 2 5
mmu-let-7c-2_precursor NTGAGGTAGTAGGTTGTATGGT 12 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTTTGGTT 5 3
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTTTT 8 1
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGTTT 2 2
mmu-let-7c-2_precursor TGAAGTAGTAGGTTGTATGGTTAT 4 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGTTTT 7 2
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGGTTAT 4 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGAGTGGTTTT 2 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTTTGGTTT 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGCTTTT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGAATGGTTT 5 2
mmu-let-7c-2_precursor TTGAGGTAGTAGGTTGTATGGTTGT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGGTGTATGGTT 93 2
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGTT 2 3
mmu-let-7c-2_precursor GTAGTAGGTTGTGTGGTTTT 23 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTGGTATGG 5 2
mmu-let-7c-2_precursor TGAGGAAGTCGGTTGTATGGTT 3 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTACGGTT 2 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGGT 80 2
mmu-let-7c-2_precursor GAGTTAGTAGGTTGTATGGTT 16 2
mmu-let-7c-2_precursor TGAGATAGTAGGTTGTATGGT 31 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTTTT 2 1
mmu-let-7c-2_precursor NAGGTAGTAGGTTGTATGGT 25 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTTG 14 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTTA 55 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTTC 2 2
mmu-let-7c-2_precursor AGTAGGTTGTATGGT 51 6
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATGG 22 3
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATCGTT 2 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTGGT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTAT 37896 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTAG 10518 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTAC 1159 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTAN 4 2
mmu-let-7c-2_precursor TGAGGTTGTAGGTTGTATGGTTA 12 3
mmu-let-7c-2_precursor GAGGTATTAGGTTGTATGGTT 9 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGGTTT 19 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGGTTA 23 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGGTTG 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTTG 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTTC 7 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTTA 54 2
mmu-let-7c-2_precursor GGAGGTAGTAGGTTGTATGGTTG 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTATT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGTTAT 16 3
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATGGTTAT 6 1
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTGTGGTTTT 21 2
mmu-let-7c-2_precursor GAGATAGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTAT 3 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTAA 9 11
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTAG 4 6
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGGC 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTGTGGTTTT 10 2
mmu-let-7c-2_precursor TGAGGTTGTAGGTTGTATGGTTAT 3 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGGT 101 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGGA 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCGT 79 4
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGTAT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGGGTT 3 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTTCG 3 2
mmu-let-7c-2_precursor GTAGTAGGTTGTATG 6 4
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTTA 126 2
mmu-let-7c-2_precursor TGAGGTAGTAAGTTGTATGGTTAT 3 2
mmu-let-7c-2_precursor TGGGGTAGTAGGTTGTATGGTTAT 14 1
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGGT 65 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTAAG 5 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACTGTT 4 7
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTC 545 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTG 582 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTT 14318 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTN 9 2
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATG 9 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTCGGTT 2 3
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGTT 10 2
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGTTT 71 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACG 5 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTATC 3 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTATA 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTGTGGTTTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGTTT 2 4
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTAT 2 11
mmu-let-7c-2_precursor GTAGGTTGTATGGTTT 461 3
mmu-let-7c-2_precursor GTAGGTTGTATGGTTA 226 32
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGAAT 139 2
mmu-let-7c-2_precursor TGAGTTATTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTA 145 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTC 4 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTT 10672 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGGTG 5 2
mmu-let-7c-2_precursor TGATGTAGTAGGTTGTATGGTTAT 13 1
mmu-let-7c-2_precursor NTAGGTTGTATGGTTT 3 9
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGAA 4 15
mmu-let-7c-2_precursor GAGGTAGTAGGTTGGATGGT 2 3
mmu-let-7c-2_precursor GAGGTAGTAGTTTGTATGGT 3 3
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGT 77 2
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGTTA 40 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTAGTATGGTTAT 2 1
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGG 233 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTATGCTT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGCT 54 2
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTAT 2 10
mmu-let-7c-2_precursor NGAGGTACTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATGGGT 4 7
mmu-let-7c-2_precursor TGAGGTAGTCGGTTGTATGGTTAT 6 1
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTA 10 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGTAT 4 5
mmu-let-7c-2_precursor AGTAGGTTGTATGGTTGT 2 5
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTGAG 4 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGAAT 4 5
mmu-let-7c-2_precursor TGGGTAGTAGGTTGTATGGTTT 3 3
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTGTGGTTTT 134 2
mmu-let-7c-2_precursor TGAGGTAGTAAGTTGTATGGT 23 3
mmu-let-7c-2_precursor TGAGGTTGTAGGTTGTATGGT 11 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTATATGGTTT 2 2
mmu-let-7c-2_precursor TGTGGTAGTAGGTTGTATGGT 19 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGTT 482 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGT 54 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGTTGT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAAGTTGTATG 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTAT 3 6
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGTAT 2 2
mmu-let-7c-2_precursor GAGGTATTAGGTTGTATGGT 2 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTTTT 11 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGGTTT 8 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCT 3 10
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTT 1175 2
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTA 19 3
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGG 16 2
mmu-let-7c-2_precursor GTGAGGTAGTAGGTTGTATGGTTA 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGTT 12 7
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGTAT 3 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTAT 479 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTAG 120 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTAC 24 3
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATG 6 5
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTTAT 3 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTTGC 8 1
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGTTT 2 3
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTTA 72 2
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTATGGTTG 7 2
mmu-let-7c-2_precursor CTATACAATCTACT 2 25
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGT 59 2
mmu-let-7c-2_precursor AAGGTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATGGTT 300 2
mmu-let-7c-2_precursor TCAGGTAGTAGGTTGTATGGTA 5 3
mmu-let-7c-2_precursor GCGGTAGTAGGTTGTATGG 2 2
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGA 2 3
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTATGGT 17 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGCTA 62 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGCTG 4 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGCTT 68 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTTT 76 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTTA 46 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTTC 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTTG 6 2
mmu-let-7c-2_precursor TGAGGCAGTGGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor GTAGGTTGTATGGTTAT 43 12
mmu-let-7c-2_precursor TCTGAGGTAGTAGGTTGTATGGTTT 6 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTAGTATGGTTA 7 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTTAT 16 1
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTCTGGTT 2 3
mmu-let-7c-2_precursor NAGTAGGTTGTATGGTT 5 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTAT 60 4
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTAG 2 20
mmu-let-7c-2_precursor TGACGTAGTCGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor GAGCTAGTAGGTTGTATGGT 2 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGG 5 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGC 7 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGA 80 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGG 12 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTCT 49 1
mmu-let-7c-2_precursor TCTGAGGTAGTAGGTTGTATGGTT 40 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTCC 3 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTCG 18 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGTTTTT 30 2
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTATGGTT 181 2
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTATGGTA 2 3
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGTTT 34 2
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGTTC 2 2
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGTTG 2 2
mmu-let-7c-2_precursor TGAGGTAATAGGTTGTATGGTTA 11 3
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTAT 2 12
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTT 3816 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTA 3471 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTC 94 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTG 272 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGAATGGTTA 2 2
mmu-let-7c-2_precursor GAGGTAGGAGGTTGTATGGTT 24 3
mmu-let-7c-2_precursor TGAGGTAGTAGGGTGTATGGT 12 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTAT 6 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTATGGTTTT 7 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGGTTGGT 2 10
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTTAG 3 9
mmu-let-7c-2_precursor GAGGTAGTAGTTTGTATGGTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGAT 401 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGAC 20 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGAG 102 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTN 97 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTG 16774 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTA 226149 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTC 4407 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTT 699 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTA 11 2
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGGT 43 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTAT 2 6
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTAGA 18 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTTAGT 10 2
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGGTTA 51 4
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTGTGGTTTTT 59 2
mmu-let-7c-2_precursor ACGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTT 451 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATTGTT 2 5
mmu-let-7c-2_precursor TGAGGTAGTAGGATGTGTGGTTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTTATG 8 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGGAT 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGT 79 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGA 3 4
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTTAT 14 2
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTTAG 7 33
mmu-let-7c-2_precursor TGAGGTAGTGGGTTGTATGGTAT 4 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTCTATGGTTAT 4 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTTCATGGTT 2 5
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGTTTT 8 1
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTTAT 6 2
mmu-let-7c-2_precursor TGCTAGTAGGTTGTATGGTT 16 8
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGNTTA 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGGG 3 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGGT 2 16
mmu-let-7c-2_precursor TGACGTAGTAGGTTGTATGGT 54 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGCT 530 2
mmu-let-7c-2_precursor CTATACAATCTACTGTCTTT 52 2
mmu-let-7c-2_precursor GAGGGAGGAGGTTGTATGGTTT 2 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTNT 12 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTNA 8 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTA 13 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTT 744 3
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTTAAG 221 4
mmu-let-7c-2_precursor GTAGTAGGTTGTATGGTAT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATAGTTTTG 23 3
mmu-let-7c-2_precursor GGGGTAGTAGGTTGTATGGTT 14 2
mmu-let-7c-2_precursor TGAGGTAGTTGGTTGTGTGGTTTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGATTAT 6 1
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGTTG 2 3
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGTTT 39 2
mmu-let-7c-2_precursor CTGAGGTAGTAGGTTGTATGGTTA 42 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTTTT 18 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAGGTT 29 6
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTATGGTT 137 2
mmu-let-7c-2_precursor AGAGGTAGTAGGTTGTATGGTA 3 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTTT 26844 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTGTG 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTCTT 21 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTTCTA 7 2
mmu-let-7c-2_precursor GTTGAGGTAGTAGGTTGTATGGTTAT 8 2
mmu-let-7c-2_precursor TGAGGCAGTAGGTTGTATGGTAT 7 3
mmu-let-7c-2_precursor TGAGGTACTAGGTTGTATGG 12 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTT 615 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTACGGTA 6 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTATGG 13 2
mmu-let-7c-2_precursor GGTAGTAGGTTGTAT 8 7
mmu-let-7c-2_precursor TGACGTAGTAGGTTGTATGGTT 462 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGGT 20 2
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGGA 2 4
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor TGAGGTGGTAGGTTGTATGGTTTT 2 1
mmu-let-7c-2_precursor GTATTAGGTTGTATGGTT 2 4
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTT 315 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTA 3 2
mmu-let-7c-2_precursor TAAGGTAGTAGGTTGTATGG 9 2
mmu-let-7c-2_precursor GAGGTATTAGGTTGTATGGTTA 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGTTGTG 4 1
mmu-let-7c-2_precursor GAGGTAGTCGGTTGTATGGTT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATG 8 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGGTTTG 2 5
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTTG 5 6
mmu-let-7c-2_precursor TAGTAGGTTGTATGGTTT 137 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAT 4080 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAA 325 9
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAG 118 12
mmu-let-7c-2_precursor NGAGGTAGTGGGTTGTATGGTT 5 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGTAT 2 2
mmu-let-7c-2_precursor TAGGTTGTATGGTT 218 18
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTT 2622 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGTTG 14 2
mmu-let-7c-2_precursor NTAGTAGGTTGTATGGTT 2 3
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTGA 6 4
mmu-let-7c-2_precursor TAGGTAGTAGGTTGTATGGGT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGTAATG 4 1
mmu-let-7c-2_precursor GAGGCAGTAGGTTGTATGGTTA 4 3
mmu-let-7c-2_precursor TTAGGTAGTAGGTTGTATGGT 106 2
mmu-let-7c-2_precursor CGAGGTAGTAGGTTGTATGG 16 2
mmu-let-7c-2_precursor CAGGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTCTGGTTGT 8 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTAAGGT 28 2
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTTGT 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTTTGG 43 3
mmu-let-7c-2_precursor NGAGGTAGTAGGTTG 3 26
mmu-let-7c-2_precursor TGAGGTATTAGGTTGTATGGTTTT 5 1
mmu-let-7c-2_precursor TCACGTAGTAGGTTGTATGGTT 5 2
mmu-let-7c-2_precursor GAGGTAGTAGGTGGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTAGTATGG 3 2
mmu-let-7c-2_precursor TTGAGGTAGTAGGTTGTATGGTTTTT 4 2
mmu-let-7c-2_precursor TTGAGGTAGTAGGTTGTATGGTTTTA 2 3
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGT 38 2
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATGGTTAT 2 1
mmu-let-7c-2_precursor TGCGGTAGTGGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGTTT 147 4
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATTGTTA 97 5
mmu-let-7c-2_precursor GAGGCAGTAGGTTGTATGGTT 46 2
mmu-let-7c-2_precursor TGAGGTAGTAAGTTCTATGGTT 2 4
mmu-let-7c-2_precursor GAGGGAGTAGGTTGTATG 6 8
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTGGCTTT 5 2
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTCTGGTT 5 3
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTAT 19 4
mmu-let-7c-2_precursor NGAGGTAGTAGGTTGTAA 3 14
mmu-let-7c-2_precursor TGAGGTAGTAGGTCGTATGGTAT 4 2
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATG 3 2
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTT 1173 2
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGTA 5 3
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTA 15 2
mmu-let-7c-2_precursor TGAGGTAGTAGTTTGTATGGTTAT 6 1
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATAGTTTTG 14 4
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTTG 6 3
mmu-let-7c-2_precursor TGAGGGAGTAGGTTGTATGGTTC 3 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTTC 2 2
mmu-let-7c-2_precursor TAGTAGGTTGTGTGGTTTT 22 3
mmu-let-7c-2_precursor TGAGGTAGTAGGCTGTCTGGTT 3 3
mmu-let-7c-2_precursor TGAGGTAGCAGGTTGTATGGTT 609 2
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGGT 51 4
mmu-let-7c-2_precursor TGAGGTAGTAGATTGTATGGA 2 6
mmu-let-7c-2_precursor TATGTAGTAGGTTGTATGGTT 7 6
mmu-let-7c-2_precursor TGAGGTAGAAGGTTGTATGGTTT 15 2
mmu-let-7c-2_precursor TGAGGTAGAAGGTTGTATGGTTA 19 2
mmu-let-7c-2_precursor TGAGGTAGTACGTTGTATG 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCGTTAT 8 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGGTTT 5 1
mmu-let-7c-2_precursor TGTTAGTAGGTTGTATGGTT 9 15
mmu-let-7c-2_precursor GAGGTAGTAGGTTGTATGGTTTTGGGA 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGTCGTTTT 6 3
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATTGTT 2 8
mmu-let-7c-2_precursor GAGGAAGTAGGTTGTATGGTTA 2 2
mmu-let-7c-2_precursor TGAGGTAGTATGTTGTATGGTTAT 4 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATCTT 23 6
mmu-let-7c-2_precursor GAGGTAGTAGGGTGTATGGTT 4 2
mmu-let-7c-2_precursor GAGGAAGTAGGTTGTATGGTT 10 2
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTATGGCA 17 2
mmu-let-7c-2_precursor TGCGGTAGTAGGTTGTATGGTAT 2 2
mmu-let-7c-2_precursor TGAGTTAGTAGGTTGTGTGGTTTT 2 2
mmu-let-7c-2_precursor GTAGGTTGTATGGTTTT 17 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGTGAGGTTTT 2 2
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATGGTT 269 2
mmu-let-7c-2_precursor TGAGGTAGTAGCTTGTATGGTA 5 2
mmu-let-7c-2_precursor TGAGGTCGTAGGTTGTGTGGTTTT 5 2
mmu-let-7c-2_precursor CGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-2_precursor TGAGGTAGGAGGTTGTATGGTT 636 3
mmu-let-7c-2_precursor AGGTAGTAGGTTGTATGGTTTTGG 2 1
mmu-let-7c-2_precursor TGAGGTAGTAGGTTGCATGGTAT 3 2