id_rna sequence raw_count mapping_loci
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTT 31918 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGT 7204 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTA 3805 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTAG 476 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTT 136 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTA 105 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTG 50 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCCTAGTT 23 1
mmu-let-7d-5p TAGGTTGCATAGTT 6 19
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTAG 4 2
mmu-let-7d-5p AGAGGTAGTAGGCTGCATAGTTT 5 1
mmu-let-7d-5p AGAGGTAGTACGTTGCATAGTT 5 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTC 5 1
mmu-let-7d-5p GTAGTAGGTTGCATAGTT 46 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCGTAGTT 8 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTGT 5 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTGA 15 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCAAAG 8 1
mmu-let-7d-5p AGAGGTAGTAGGTTACATAGTTT 3 2
mmu-let-7d-5p CGAGGTAGTAGGTTGCATAGTT 3 1
mmu-let-7d-5p AGACGTAGTAGGTTGCATAG 2 1
mmu-let-7d-5p AGACGTAGTAGGTTGCATAGTT 12 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTACA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTAG 4 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTAA 5 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTAT 3 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATGGTT 10 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTGAA 12 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTAA 134 1
mmu-let-7d-5p ACAGGTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTAC 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTC 167 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTN 3 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCACAG 3 1
mmu-let-7d-5p AGAGGTGGTAGGTTGCATAGTT 8 1
mmu-let-7d-5p AGAGGTAGTAGGTTCCATAG 2 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGG 4 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGA 57 1
mmu-let-7d-5p AGAGGTAGTAGGCTGCATAGTT 19 1
mmu-let-7d-5p AGAGGTAGTAGGTTGC 67 1
mmu-let-7d-5p NGAGGTAGTAGGTTGCATAG 14 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTAAA 146 1
mmu-let-7d-5p AGAGGTAGTAGGTTACATAGT 4 2
mmu-let-7d-5p AGAGGTAGTAGGTCGCATAG 2 1
mmu-let-7d-5p AGAGGCAGTAGGTTGCATAGTTT 4 1
mmu-let-7d-5p AGAGGCAGTAGGTTGCATAGTTA 3 1
mmu-let-7d-5p AGTAGGTTGCATAGTT 7 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTCT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTCG 2 1
mmu-let-7d-5p AGGGGTAGTAGGTTGCATAGT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTAAT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTAAA 10 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATCGTT 3 1
mmu-let-7d-5p GGTAGTAGGTTGCATAGTTT 4 1
mmu-let-7d-5p AGACGTAGTAGGTTGCATAGT 4 1
mmu-let-7d-5p AGTAGGTTGCATAGT 3 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTG 9 1
mmu-let-7d-5p AGAGGTAGTAGGTTGTAT 2 12
mmu-let-7d-5p AGAGGTATTAGGTTGCATAGTT 4 1
mmu-let-7d-5p GTAGGTTGCATAGT 60 10
mmu-let-7d-5p AGAGGTAGTAGGTTGCGTAGTTT 2 1
mmu-let-7d-5p GAGGTAGTAGATTGCATAGTTA 2 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCAAAGTT 4 1
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAG 12 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTG 1726 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGG 3 1
mmu-let-7d-5p AGAGGTAGTAGTTTGCATAGT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGTATAGTTT 4 3
mmu-let-7d-5p AGAGGTAGTAGGTTGTATAGTTG 3 5
mmu-let-7d-5p AGAGGTAGTAGGTTGTATAGTTA 5 3
mmu-let-7d-5p GAGGTAGTAGATTGCATAGTT 2 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTAT 432 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTAG 303 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTAC 20 1
mmu-let-7d-5p NGAGGTAGTAGGTTGCATAGTTAT 2 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTAGA 138 2
mmu-let-7d-5p AGAGGTAGTAAGTTGCATAGTTT 2 1
mmu-let-7d-5p AGAGGGAGTAGGTTGCATAGTTA 7 1
mmu-let-7d-5p AGAGGGAGTAGGTTGCATAGTTT 5 1
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGTTC 2 3
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGTTA 38 3
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGTTT 35 3
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGTTG 3 5
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTA 13 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTC 3 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTT 18 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATTGTT 2 1
mmu-let-7d-5p AGAGGTAGTAAGTTGCATAGTT 5 1
mmu-let-7d-5p AGAGGTACTAGGTTGCATAGTTT 2 1
mmu-let-7d-5p AGAGGTACTAGGTTGCATAGTTG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATGA 22 7
mmu-let-7d-5p ATAGGTAGTAGGTTGCATAG 2 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCAGA 4 5
mmu-let-7d-5p AGAGGTAGTAGGTTGCCTAGT 7 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGT 151 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGA 16 2
mmu-let-7d-5p GTAGGTTGCATAGTT 304 5
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAG 190 1
mmu-let-7d-5p ATAGGTAGTAGGTTGCATAGTT 11 1
mmu-let-7d-5p ATGTAGTAGGTTGCATAGT 2 2
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTAT 13 1
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGT 33 3
mmu-let-7d-5p AGAGGTAGTAGGTTTCATAG 3 2
mmu-let-7d-5p AGCGGTAGTAGGTTGCATAGTT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTGT 94 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTGA 474 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTGG 9 1
mmu-let-7d-5p AGAGGGAGTAGGTTGCATAG 3 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTAAT 4 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTT 379 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTA 11 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTG 2 1
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGTTTT 3 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCAG 8 8
mmu-let-7d-5p AGCGGTAGTAGGTTGCATAG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTACATAGTT 14 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCA 119 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTAA 882 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGAA 4 1
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGTTAT 3 2
mmu-let-7d-5p AGAGGTAGTATGTTGCATAGTT 3 1
mmu-let-7d-5p AGAGATAGTAGGTTGCATAGTT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATTA 2 5
mmu-let-7d-5p GTAGGTTGCATAG 7 33
mmu-let-7d-5p AGAGGTAGTAGGTTGCAGAGTT 3 2
mmu-let-7d-5p NGAGGTAGTAGGTTGCATAGA 4 2
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTTT 4 1
mmu-let-7d-5p AGAGGTAGTAGCTTGCATAGTTT 2 1
mmu-let-7d-5p NGAGGTAGTAGGTTGCATGGTT 4 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTAAAG 7 1
mmu-let-7d-5p AGAGGTAGTAGTTTGCATAGTTAT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTAT 92 1
mmu-let-7d-5p NGAGGTAGTAGGTTGCATAGT 38 1
mmu-let-7d-5p CGAGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d-5p TAGTAGGTTGCATAGT 2 2
mmu-let-7d-5p AGGTAGTAGGTTGCATAGT 8 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTAT 2 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTAG 8 1
mmu-let-7d-5p AGAGGTAGTAGGTTGTATAG 2 3
mmu-let-7d-5p AGAGGTAGTAGGGTGCATAGT 2 1
mmu-let-7d-5p AGGTAGTAGGTTGCATAGTT 9 1
mmu-let-7d-5p AGAGGTAGTCGGTTGCATAGTT 8 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATGGTTT 3 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGAC 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGAG 7 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATCG 2 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTG 7 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTT 36 1
mmu-let-7d-5p AGAGGTAGTAGGTTTCATAGTT 22 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCAT 7 1
mmu-let-7d-5p AGGGGTAGTAGGTTGCATAGTT 11 1
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGTT 337 3
mmu-let-7d-5p TGAGGTAGTAGGTTGCATAGTA 2 4
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTAAA 6 1
mmu-let-7d-5p GAGGTAGTAGGTTG 38 26
mmu-let-7d-5p AGCGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCACAGTT 10 1
mmu-let-7d-5p AGAGGTAGTAGGTCGCATAGT 4 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTGT 6 2
mmu-let-7d-5p AGAGGTAGTAGGTTGTATAGT 15 3
mmu-let-7d-5p AGAGGTAGTAGGTTGTATAGA 2 4
mmu-let-7d-5p AGAGGCAGTAGGTTGCATAGT 3 1
mmu-let-7d-5p AGGTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d-5p AGGTAGTAGGTTGCATAGTTA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGA 785 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGC 3 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAT 8 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAG 3119 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAA 16 1
mmu-let-7d-5p GTAGTAGGTTGCATAGTTA 11 1
mmu-let-7d-5p GAGGTAGTAGGTTGCAT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTCGCATAGTTA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTCGCATAGTTT 2 1
mmu-let-7d-5p ATAGGTAGTAGGTTGCATAGT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTNT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTT 5306 1
mmu-let-7d-5p AGATGTAGTAGGTTGCATAGTTA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATTG 3 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATTT 12 9
mmu-let-7d-5p AGAGGTAGTGGGTTGCATAGTT 6 1
mmu-let-7d-5p AGAGGCAGTAGGTTGCATAGTT 15 1
mmu-let-7d-5p GGAGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATTTT 3 4
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGNT 4 1
mmu-let-7d-5p GGTAGTAGGTTGCATAGTT 28 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATATTTT 3 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATATTTA 4 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATATTTG 3 1
mmu-let-7d-5p GTAGTAGGTTGCATAGTTT 9 1
mmu-let-7d-5p AGAGGGAGTAGGTTGCATAGTT 18 1
mmu-let-7d-5p GGAGGTAGTAGGTTGCATAGTTT 3 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTAGT 5 1
mmu-let-7d-5p AGAGTTAGTAGGTTGCATAGT 3 1
mmu-let-7d-5p AGAGGTAGAAGGTTGCATAGTT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTAATAG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTGGCATAGTT 6 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTA 201 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTC 13 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTG 120 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTT 285 1
mmu-let-7d-5p GGAGGTAGTAGGTTGCATAGTT 8 1
mmu-let-7d-5p AGATGTAGTAGGTTGCATAGTT 3 1
mmu-let-7d-5p TAGTAGGTTGCATAGTT 22 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTATG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGTATAGTT 71 3
mmu-let-7d-5p AGAGGTAGTAGGTTGTATAGTA 2 4
mmu-let-7d-5p NGAGGTAGTAGGTTGCATAGTT 162 1
mmu-let-7d-5p AGAGGTAGCAGGTTGCATAGTTT 4 1
mmu-let-7d-5p AGAGGTAGCAGGTTGCATAGTTG 5 1
mmu-let-7d-5p NAGGTAGTAGGTTGCATAGTT 4 1
mmu-let-7d-5p AGAGGTCGTAGGTTGCATAG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTGA 31 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCACAGT 3 1
mmu-let-7d-5p AGAGGTAGTAGGGTGCATAGTT 2 1
mmu-let-7d-5p TGAGGTAGGAGGTTGCATAGTTT 4 4
mmu-let-7d-5p AGAGGTAGTAGGTTGCACAGTTA 2 2
mmu-let-7d-5p AGGTTGCATAGTTT 2 21
mmu-let-7d-5p GAGGTAGTAGGTTGCATGGT 2 3
mmu-let-7d-5p GAGGGAGTAGGTTGCATAGTT 6 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTA 9 1
mmu-let-7d-5p AGATGTAGTAGGTTGCATAGT 5 1
mmu-let-7d-5p AGAGGTAGTCGGTTGCATAGT 2 1
mmu-let-7d-5p AGATGTAGTAGGTTGCATAG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGGATAGT 2 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTAAA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTG 140 4
mmu-let-7d-5p AGAGGTAGTAGGTTTCATAGTTT 2 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTGT 2 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTGA 2 1
mmu-let-7d-5p NTAGGTTGCATAGTT 3 19
mmu-let-7d-5p AAAGGTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d-5p AGAGGTAGCAGGTTGCATAGTT 9 1
mmu-let-7d-5p AGAGGAAGTAGGTTGCATAGTT 6 1
mmu-let-7d-5p AGAGGTGGTAGGTTGCATAGT 4 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGAAT 4 2
mmu-let-7d-5p ATAGGTAGTAGGTTGCATAGTTT 3 1
mmu-let-7d-5p ATAGGTAGTAGGTTGCATAGTTA 2 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCAAAGA 3 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCATATTT 7 1
mmu-let-7d-5p AGAGGTAGTGGGTTGCATAGTTT 2 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTAG 3 1
mmu-let-7d-5p ACAGGTAGTAGGTTGCATAGTT 5 1
mmu-let-7d-5p AGAGGTAGTATGTTGCATAGTTT 2 1
mmu-let-7d-5p GGTAGTAGGTTGCATAG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTAA 59 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTAG 9 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAAA 11 5
mmu-let-7d-5p AGAGGTAGTAGGTTGCATTTTT 4 3
mmu-let-7d-5p GTAGTAGGTTGCATAGT 12 1
mmu-let-7d-5p AGAGGTCGTAGGTTGCATAGTT 11 1
mmu-let-7d-5p AGGGGTAGTAGGTTGCATAGTTT 4 1
mmu-let-7d-5p NGAGGTAGTAGGTTGCATAGTTG 6 1
mmu-let-7d-5p NGAGGTAGTAGGTTGCATAGTTA 18 1
mmu-let-7d-5p NGAGGTAGTAGGTTGCATAGTTT 20 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCCTAGTTT 2 1
mmu-let-7d-5p GGTAGTAGGTTGCATAGT 6 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCCTAGTTA 4 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATACTT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAAG 7 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTTA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATGGTT 7 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTG 47 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTA 283 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTC 9 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAAT 2 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTA 9 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTG 2 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTT 759 1
mmu-let-7d-5p TGAGGTAGTAGGTTGCGTAGTT 2 4
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGCT 5 2
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTTAA 4 1
mmu-let-7d-5p AGAGGTAGGAGGTTGCATAGTT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTCTA 2 1
mmu-let-7d-5p AGAGGTAGTAGTTTGCATAGTTT 6 1
mmu-let-7d-5p AGAGCTAGTAGGTTGCATAGTT 13 2
mmu-let-7d-5p AGAGGTAGTCGGTTGCATAGTTT 2 1
mmu-let-7d-5p AGAGGTAGTAGGCTGCATAG 2 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTAA 23 2
mmu-let-7d-5p AGAGGTAGTAGGTTCCATAGTT 22 1
mmu-let-7d-5p AGAGGTAGCAGGTTGCATAG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATT 6 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATA 38 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATG 6 3
mmu-let-7d-5p AGAGGTAGTAGCTTGCATAGTT 7 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGT 523 1
mmu-let-7d-5p NAGAGGTAGTAGGTTGCATAGT 3 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTAA 7 1
mmu-let-7d-5p GAGGGAGTAGGTTGCATAG 3 2
mmu-let-7d-5p AGAGGTAGTAGGTCGCATAGTT 20 1
mmu-let-7d-5p AGAGGTAGTAGTTTGCATAGTT 11 1
mmu-let-7d-5p AGAGTTAGTAGGTTGCATAGTT 9 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATATT 8 1
mmu-let-7d-5p NGAGGTAGTAGGTTGCA 2 2
mmu-let-7d-5p AGAGGTAGTAGGTTGCACAGTTT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTAA 8 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTAT 7 1
mmu-let-7d-5p AGAGGTTGTAGGTTGCATAGTT 4 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGAT 4 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGAA 52 3
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTATAT 3 1
mmu-let-7d-5p AGAGGTAGTAGGTAGCATAGTT 3 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTTT 11 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAGTTTA 6 2
mmu-let-7d-5p GAGGTAGTAGGTTGCATAT 2 1
mmu-let-7d-5p GAGGTAGTAGGTTGCATAG 59 1
mmu-let-7d-5p AGAGGTAGTAGTTTGCATAGTTG 3 1
mmu-let-7d-5p AAGAGGTAGTAGGTTGCATAGTTAA 7 1
mmu-let-7d-5p GAGGTAGTAGGTTGCA 3 2
mmu-let-7d-5p GAGGTAGTAGGTTGCATA 2 1
mmu-let-7d-5p GAGGTAGTAGATTGCATAGT 2 3
mmu-let-7d-5p NGAGGTAGTAGGTTG 3 26
mmu-let-7d-5p AGAGGTAGTAGGTTGCTTAGTT 4 1
mmu-let-7d-5p AGAGGTACTAGGTTGCATAGTT 4 1
mmu-let-7d-5p AGAGGTAGTAGGCTGCATAGT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTTCATAGT 5 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTAT 18 1
mmu-let-7d-5p AGAGGTAGTTGGTTGCATAGTT 4 1
mmu-let-7d-5p TAGTAGGTTGCATAGTTT 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCAT 180 1
mmu-let-7d-5p AGAGGTAATAGGTTGCATAGTT 4 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTGT 6 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTGA 33 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTGG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTT 37 16
mmu-let-7d-5p AGGTAGTAGGTTGCATAG 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGTTTTGA 2 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGGT 6 1
mmu-let-7d-5p AGAGGTAGTAGGTTGCATAGGA 3 2
mmu-let-7d-5p GTAGGTTGCATAGTTT 42 1