id_rna sequence raw_count mapping_loci
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTT 31918 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGT 7204 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTA 3805 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAG 476 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTT 136 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTA 105 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTT 63 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTAG 4 2
mmu-let-7d_precursor CTGTACGACCTGCTGCCTTTCT 2 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCTGA 3 1
mmu-let-7d_precursor NTATACGACCTGCTGCCTTTC 4 1
mmu-let-7d_precursor TAGGTTGCATAGTT 6 19
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGTTT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCCTAGTT 23 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTCT 3 1
mmu-let-7d_precursor AGAGGTAGTACGTTGCATAGTT 5 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTG 50 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTC 5 1
mmu-let-7d_precursor GTAGTAGGTTGCATAGTT 46 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCGTAGTT 8 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTGT 5 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTGA 15 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAAAG 8 1
mmu-let-7d_precursor AGAGGTAGTAGGTTACATAGTTT 3 2
mmu-let-7d_precursor CGAGGTAGTAGGTTGCATAGTT 3 1
mmu-let-7d_precursor AGACGTAGTAGGTTGCATAG 2 1
mmu-let-7d_precursor AGACGTAGTAGGTTGCATAGTT 12 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTACA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTAG 4 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTAA 5 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTAT 3 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATGGTT 10 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGAA 12 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAA 134 1
mmu-let-7d_precursor ACAGGTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAC 2 1
mmu-let-7d_precursor ACGACCTGCTGCCTTTCT 4 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTC 167 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTN 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCACAG 3 1
mmu-let-7d_precursor AGAGGTGGTAGGTTGCATAGTT 8 1
mmu-let-7d_precursor AGAGGTAGTAGGTTCCATAG 2 2
mmu-let-7d_precursor TACGACCTGCTGCCTTTCT 7 1
mmu-let-7d_precursor ATACGACCTGCTGCCTTTCTT 2 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCAT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGG 4 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGA 57 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGTT 19 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTACT 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTC 910 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTG 3 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTA 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTGA 13 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGC 67 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAG 14 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAAA 146 1
mmu-let-7d_precursor AGAGGTAGTAGGTTACATAGT 4 2
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAG 2 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAGTTT 4 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAGTTA 3 1
mmu-let-7d_precursor AGTAGGTTGCATAGTT 7 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTCT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTCG 2 1
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTAAT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTAAA 10 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATCGTT 3 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAGTTT 4 1
mmu-let-7d_precursor AGACGTAGTAGGTTGCATAGT 4 1
mmu-let-7d_precursor AGTAGGTTGCATAGT 3 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTG 9 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTAT 2 12
mmu-let-7d_precursor TATACGACCTGC 5 16
mmu-let-7d_precursor AGAGGTATTAGGTTGCATAGTT 4 1
mmu-let-7d_precursor GTAGGTTGCATAGT 60 10
mmu-let-7d_precursor AGAGGTAGTAGGTTGCGTAGTTT 2 1
mmu-let-7d_precursor GAGGTAGTAGATTGCATAGTTA 2 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAAAGTT 4 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAG 12 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTG 1726 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGG 3 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTTT 4 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTTG 3 5
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTTA 5 3
mmu-let-7d_precursor GAGGTAGTAGATTGCATAGTT 2 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAT 432 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAG 303 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAC 20 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTAT 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCGT 3 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAGA 138 2
mmu-let-7d_precursor AGAGGTAGTAAGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTTA 7 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTTT 5 1
mmu-let-7d_precursor ATACGACCTGCTGCCTTTCT 3 1
mmu-let-7d_precursor ATACGACCTGCTGCCTTTCA 2 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTC 2 3
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTA 38 3
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTT 35 3
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTG 3 5
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTA 13 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTC 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTT 18 1
mmu-let-7d_precursor GACCTGCTGCCTTTCT 2 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTGTT 2 1
mmu-let-7d_precursor AGAGGTAGTAAGTTGCATAGTT 5 1
mmu-let-7d_precursor AGAGGTACTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGAGGTACTAGGTTGCATAGTTG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATGA 22 7
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAG 2 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAGA 4 5
mmu-let-7d_precursor AGAGGTAGTAGGTTGCCTAGT 7 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCG 13 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCA 60 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGT 151 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGA 16 2
mmu-let-7d_precursor GTAGGTTGCATAGTT 304 5
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAG 190 1
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAGTT 11 1
mmu-let-7d_precursor ATGTAGTAGGTTGCATAGT 2 2
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTAT 13 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGT 33 3
mmu-let-7d_precursor AGAGGTAGTAGGTTTCATAG 3 2
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGTT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGT 94 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGA 474 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGG 9 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAG 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAAT 4 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTT 379 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTA 11 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTG 2 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTTT 3 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAG 8 8
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAG 2 1
mmu-let-7d_precursor CTATACGACCTG 4 18
mmu-let-7d_precursor AGAGGTAGTAGGTTACATAGTT 14 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCA 119 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAA 882 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGAA 4 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTAT 3 2
mmu-let-7d_precursor AGAGGTAGTATGTTGCATAGTT 3 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTT 49 1
mmu-let-7d_precursor AGAGATAGTAGGTTGCATAGTT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTA 2 5
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCGA 3 1
mmu-let-7d_precursor GTAGGTTGCATAG 7 33
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAGAGTT 3 2
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTTAGA 2 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGA 4 2
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTTT 4 1
mmu-let-7d_precursor AGAGGTAGTAGCTTGCATAGTTT 2 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATGGTT 4 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAAAG 7 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGTTAT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAT 92 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGT 38 1
mmu-let-7d_precursor CGAGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor TAGTAGGTTGCATAGT 2 2
mmu-let-7d_precursor AGGTAGTAGGTTGCATAGT 8 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTAT 2 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTAG 8 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAG 2 3
mmu-let-7d_precursor AGAGGTAGTAGGGTGCATAGT 2 1
mmu-let-7d_precursor AGGTAGTAGGTTGCATAGTT 9 1
mmu-let-7d_precursor AGAGGTAGTCGGTTGCATAGTT 8 1
mmu-let-7d_precursor CTATACGATCTGCTGCCTTTCT 4 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATGGTTT 3 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGAC 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGAG 7 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATCG 2 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTG 7 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTT 36 1
mmu-let-7d_precursor AGAGGTAGTAGGTTTCATAGTT 22 1
mmu-let-7d_precursor TTATACGACCTGCTGCCTTTCT 2 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCAT 7 1
mmu-let-7d_precursor CTATACGACCTGC 54 2
mmu-let-7d_precursor CTATACGACCTGCTGC 5 1
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGTT 11 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTT 337 3
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTA 2 4
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTAAA 6 1
mmu-let-7d_precursor GAGGTAGTAGGTTG 38 26
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCACAGTT 10 1
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAGT 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTGT 6 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGT 15 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGA 2 4
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAGT 3 1
mmu-let-7d_precursor AGGTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGGTAGTAGGTTGCATAGTTA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGA 785 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGC 3 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAT 8 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAG 3119 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAA 16 1
mmu-let-7d_precursor GTAGTAGGTTGCATAGTTA 11 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCAT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAGTTA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAGTTT 2 1
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAGT 5 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTGCT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTNT 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCCT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTT 5306 1
mmu-let-7d_precursor AGATGTAGTAGGTTGCATAGTTA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTG 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTT 12 9
mmu-let-7d_precursor AGAGGTAGTGGGTTGCATAGTT 6 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAGTT 15 1
mmu-let-7d_precursor GGAGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTTT 3 4
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGNT 4 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAGTT 28 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTTT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTTA 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTTG 3 1
mmu-let-7d_precursor GTAGTAGGTTGCATAGTTT 9 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTT 18 1
mmu-let-7d_precursor GGAGGTAGTAGGTTGCATAGTTT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAGT 5 1
mmu-let-7d_precursor AGAGTTAGTAGGTTGCATAGT 3 1
mmu-let-7d_precursor AGAGGTAGAAGGTTGCATAGTT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAATAG 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTA 19 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTG 41 1
mmu-let-7d_precursor AGAGGTAGTAGGTGGCATAGTT 6 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCATT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTA 201 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTC 13 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTG 120 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTT 285 1
mmu-let-7d_precursor GGAGGTAGTAGGTTGCATAGTT 8 1
mmu-let-7d_precursor AGATGTAGTAGGTTGCATAGTT 3 1
mmu-let-7d_precursor TAGTAGGTTGCATAGTT 22 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTATG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTT 71 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTA 2 4
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTT 162 1
mmu-let-7d_precursor AGAGGTAGCAGGTTGCATAGTTT 4 1
mmu-let-7d_precursor AGAGGTAGCAGGTTGCATAGTTG 5 1
mmu-let-7d_precursor NAGGTAGTAGGTTGCATAGTT 4 1
mmu-let-7d_precursor AGAGGTCGTAGGTTGCATAG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTGA 31 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCACAGT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGGTGCATAGTT 2 1
mmu-let-7d_precursor TGAGGTAGGAGGTTGCATAGTTT 4 4
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCAA 7 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCACAGTTA 2 2
mmu-let-7d_precursor AGGTTGCATAGTTT 2 21
mmu-let-7d_precursor GAGGTAGTAGGTTGCATGGT 2 3
mmu-let-7d_precursor GAGGGAGTAGGTTGCATAGTT 6 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTA 9 1
mmu-let-7d_precursor AGATGTAGTAGGTTGCATAGT 5 1
mmu-let-7d_precursor AGAGGTAGTCGGTTGCATAGT 2 1
mmu-let-7d_precursor AGATGTAGTAGGTTGCATAG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGGATAGT 2 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTAAA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTG 140 4
mmu-let-7d_precursor AGAGGTAGTAGGTTTCATAGTTT 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCAT 5 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTGT 2 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTGA 2 1
mmu-let-7d_precursor NTAGGTTGCATAGTT 3 19
mmu-let-7d_precursor AAAGGTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGAGGTAGCAGGTTGCATAGTT 9 1
mmu-let-7d_precursor AGAGGAAGTAGGTTGCATAGTT 6 1
mmu-let-7d_precursor AGAGGTGGTAGGTTGCATAGT 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGAAT 4 2
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAGTTT 3 1
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAGTTA 2 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAAAGA 3 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTT 7 1
mmu-let-7d_precursor TACGACCTGCTGCCTTTC 2 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCT 263 1
mmu-let-7d_precursor AGAGGTAGTGGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTAG 3 1
mmu-let-7d_precursor ACAGGTAGTAGGTTGCATAGTT 5 1
mmu-let-7d_precursor AGAGGTAGTATGTTGCATAGTTT 2 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAG 2 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCTT 7 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTAA 59 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTAG 9 2
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTTT 3 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTTG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAAA 11 5
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTTTT 4 3
mmu-let-7d_precursor GTAGTAGGTTGCATAGT 12 1
mmu-let-7d_precursor AGAGGTCGTAGGTTGCATAGTT 11 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTAG 8 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTAC 5 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTAA 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTC 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTT 19 1
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGTTT 4 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTG 6 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTA 18 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTT 20 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCCTAGTTT 2 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAGT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCCTAGTTA 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATACTT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAAG 7 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTTA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATGGTT 7 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTG 47 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTA 283 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTC 9 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAAT 2 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTA 9 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTG 2 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTT 759 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCGTAGTT 2 4
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGCT 5 2
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTTAA 4 1
mmu-let-7d_precursor AGAGGTAGGAGGTTGCATAGTT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTCTA 2 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGTTT 6 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTC 87 1
mmu-let-7d_precursor NTATACGACCTGCTGCCTTTCA 2 1
mmu-let-7d_precursor NTATACGACCTGCTGCCTTTCT 8 1
mmu-let-7d_precursor AGAGCTAGTAGGTTGCATAGTT 13 2
mmu-let-7d_precursor AGAGGTAGTCGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAG 2 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTAA 23 2
mmu-let-7d_precursor AGAGGTAGTAGGTTCCATAGTT 22 1
mmu-let-7d_precursor AGAGGTAGCAGGTTGCATAG 2 1
mmu-let-7d_precursor CGACCTGCTGCCTTTC 4 2
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTGT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATA 38 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATG 6 3
mmu-let-7d_precursor AGAGGTAGTAGCTTGCATAGTT 7 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGT 523 1
mmu-let-7d_precursor NAGAGGTAGTAGGTTGCATAGT 3 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTAA 7 1
mmu-let-7d_precursor GAGGGAGTAGGTTGCATAG 3 2
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAGTT 20 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGTT 11 1
mmu-let-7d_precursor AGAGTTAGTAGGTTGCATAGTT 9 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATT 8 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCA 2 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCACAGTTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTAA 8 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTAT 7 1
mmu-let-7d_precursor AGAGGTTGTAGGTTGCATAGTT 4 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTAG 2 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGAT 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGAA 52 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTATAT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTAGCATAGTT 3 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTTT 11 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTTA 6 2
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAT 2 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAG 59 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGTTG 3 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTAA 7 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCA 3 2
mmu-let-7d_precursor GAGGTAGTAGGTTGCATA 2 1
mmu-let-7d_precursor CTATACTACCTGCTGCCTTTCT 2 2
mmu-let-7d_precursor GAGGTAGTAGATTGCATAGT 2 3
mmu-let-7d_precursor NGAGGTAGTAGGTTG 3 26
mmu-let-7d_precursor AGAGGTAGTAGGTTGCTTAGTT 4 1
mmu-let-7d_precursor AGAGGTACTAGGTTGCATAGTT 4 1
mmu-let-7d_precursor CTATACGACCTGCT 7 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTTCATAGT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTAT 18 1
mmu-let-7d_precursor CTATACGACCTGCTGCC 6 1
mmu-let-7d_precursor AGAGGTAGTTGGTTGCATAGTT 4 1
mmu-let-7d_precursor TAGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCC 36 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAT 180 1
mmu-let-7d_precursor AGAGGTAATAGGTTGCATAGTT 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTGT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTGA 33 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTGG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTT 37 16
mmu-let-7d_precursor CTATACGACCTGCTG 3 1
mmu-let-7d_precursor AGGTAGTAGGTTGCATAG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTGA 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCG 111 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCA 416 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCT 1994 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGGT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGGA 3 2
mmu-let-7d_precursor GTAGGTTGCATAGTTT 42 1