id_rna sequence raw_count mapping_loci
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTCC 49 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTCT 36 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTCCT 9 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTC 6 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTCCA 2 1
mmu-let-7e-3p TATACGGCCTCCTAGCTTTCCT 5 1