id_rna sequence raw_count mapping_loci
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTT 70396 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGA 1814 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTA 1026 2
mmu-let-7e-5p TGAGATAGGAGGTTGTATAGTTG 9 1
mmu-let-7e-5p TGAGATAGGAGGTTGTATAGTTT 4 3
mmu-let-7e-5p TGGGGTAGGAGGTTGTATAGTTGA 4 1
mmu-let-7e-5p TGAGATAGGAGGTTGTATAGTTA 2 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTC 63 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTG 101 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTNG 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTCTATAGTT 13 1
mmu-let-7e-5p TAGTAGGTTGTATAGTTG 8 6
mmu-let-7e-5p CGAGGTAGGAGGTTGTATAGTTG 8 1
mmu-let-7e-5p CGAGGTAGGAGGTTGTATAGTTA 5 1
mmu-let-7e-5p CGAGGTAGGAGGTTGTATAGTTT 2 3
mmu-let-7e-5p TAAGGTAGGAGGTTGTATAGTTG 6 1
mmu-let-7e-5p TAAGGTAGGAGGTTGTATAGTTA 6 1
mmu-let-7e-5p TAAGGTAGGAGGTTGTATAGTTT 6 3
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGCTG 4 4
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGT 65 2
mmu-let-7e-5p TGAGGTAGGCGGTTGTATAG 2 2
mmu-let-7e-5p GAGGGAGGAGGTTGTATAGTTG 6 1
mmu-let-7e-5p GAGGGAGGAGGTTGTATAGTTT 2 4
mmu-let-7e-5p TGAGGTAAGAGGTTGTATAG 2 1
mmu-let-7e-5p TGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e-5p TGAGCTAGGAGGTTGTATAGTTG 5 1
mmu-let-7e-5p TGAGGTGGGAGGTTGTATAGTTGA 2 1
mmu-let-7e-5p GAGGTAGTAGGTTGCATAGTTGA 15 3
mmu-let-7e-5p TGAGATAGGAGGTTGTATAGT 2 2
mmu-let-7e-5p TAGGTAGGAGGTTGTATAGT 6 1
mmu-let-7e-5p AGGTAGGAGGTTGTATAGTTAA 4 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTAG 959 4
mmu-let-7e-5p GTAGGAGGTTGTATAGTT 41 1
mmu-let-7e-5p TGATGTAGGAGGTTGTATA 2 4
mmu-let-7e-5p TGAGGGAGGAGGTTGTATAGTTG 12 1
mmu-let-7e-5p TGAGGGAGGAGGTTGTATAGTTT 6 3
mmu-let-7e-5p TGAGGGAGGAGGTTGTATAGTTA 4 1
mmu-let-7e-5p TGAAGTAGGAGGTTGTATAGTTG 4 1
mmu-let-7e-5p TGAAGTAGGAGGTTGTATAGTTA 4 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAAAA 5 1
mmu-let-7e-5p TAGGAGGTTGTATAGTT 48 1
mmu-let-7e-5p TGATAGGAGGTTGTATAGTT 3 8
mmu-let-7e-5p TAAGGTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGTTG 55 1
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGTTC 2 1
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGTTT 20 5
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTAGT 4 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTACAGTT 17 1
mmu-let-7e-5p TCAGGTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e-5p TCAGGTAGGAGGTTGTATAGTTT 3 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGATT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGCATAGTTAA 4 1
mmu-let-7e-5p TGAGGCAGGAGGTTGTATAGTT 29 1
mmu-let-7e-5p TGAGGCAGGAGGTTGTATAGTA 2 1
mmu-let-7e-5p TGAGGTACGAGGTTGTATAGTTGT 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAGAGTTA 2 2
mmu-let-7e-5p TGAGGTAGGAGGTTATATAGTTG 10 1
mmu-let-7e-5p TGAGGTAGGAGGTTATATAGTTA 2 2
mmu-let-7e-5p TGAGGTAGGAGGTTTTATAG 2 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTAA 396 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATCGTTG 3 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTTGT 17 1
mmu-let-7e-5p GAGGGAGGAGGTTGTATAGTT 14 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAGG 3 1
mmu-let-7e-5p TGAGGTAGGCGGTTGTATAGTTGT 2 1
mmu-let-7e-5p TGAGGTAGGCGGTTGTATAGTTGA 5 1
mmu-let-7e-5p GCGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e-5p ATGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTTTAGTTG 2 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAT 2 24
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAC 2 9
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAA 4 24
mmu-let-7e-5p TGAGGGAGTAGGTTGTATAGTTG 8 4
mmu-let-7e-5p TGAGGTAGGAGGTTATATAGTTGA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTATATAGTTGT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATTA 9 13
mmu-let-7e-5p TGAGGAGGTTGTATAGTTG 2 28
mmu-let-7e-5p GTAGGAGGTTGTATAGTTG 5 1
mmu-let-7e-5p GTAGGAGGTTGTATAGTTT 10 6
mmu-let-7e-5p TGAGGTAGGAGGGTGTATAGT 3 1
mmu-let-7e-5p TCAGGTAGGAGGTTGTATAGT 3 1
mmu-let-7e-5p TGAGGTAGGAGGGTGTATAGTTG 4 1
mmu-let-7e-5p TGAGGTAGGAGGGTGTATAGTTT 2 4
mmu-let-7e-5p GGTAGGAGGTTGTATAGTTG 8 1
mmu-let-7e-5p GGTAGGAGGTTGTATAGTTA 4 1
mmu-let-7e-5p GAGTAGGAGGTTGTATAGTT 2 11
mmu-let-7e-5p TGAGCTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAGTTG 25 1
mmu-let-7e-5p GAGTAGGAGGTTGTATAGTTG 2 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAGAA 2 1
mmu-let-7e-5p TAGGTAGGAGGTTGTATAG 3 3
mmu-let-7e-5p NAGGTAGGAGGTTGTATAGTTAA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTTTATAGTT 7 1
mmu-let-7e-5p TGGGGTAGGAGGTTGTATAGTTG 17 1
mmu-let-7e-5p TGGGGTAGGAGGTTGTATAGTTA 9 2
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTTA 30 2
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTTC 2 4
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTTG 2 4
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTCG 2 4
mmu-let-7e-5p TCAGGTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e-5p TGAGGTAGGAGGTGGTATAGTT 6 1
mmu-let-7e-5p TGAGGTAGGGGGTTGTATAGTTA 7 3
mmu-let-7e-5p TGAGGTACGAGGTTGTATAGTTG 6 1
mmu-let-7e-5p TGAGGTACGAGGTTGTATAGTTA 2 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGAG 6 2
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGAC 7 2
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGAA 76 3
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGAT 16 2
mmu-let-7e-5p TGAGGTAGGAGGTTCTATAGT 4 1
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTAAG 3 1
mmu-let-7e-5p NAGGTAGGAGGTTGTATAGTT 7 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTTTAGTTG 5 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTA 448 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTC 15 1
mmu-let-7e-5p TGTAGGAGGTTGTATAGT 4 5
mmu-let-7e-5p TGAGGTAAGAGGTTGTATAGTT 11 1
mmu-let-7e-5p TGAAGTAGGAGGTTGTATAGTT 10 1
mmu-let-7e-5p GGTTGTATAGTTGA 8 15
mmu-let-7e-5p TGAGGCAGTAGGTTGTATAGTTG 12 4
mmu-let-7e-5p AGGAGGTTGTATAGTTAA 2 4
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTT 19 3
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTC 2 1
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTA 13 2
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAGTTGT 2 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGC 71 4
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGG 21 4
mmu-let-7e-5p GAGGTAGGAGGTTGTATAA 6 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGGTTGA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGGTTGT 3 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTAGAA 6 30
mmu-let-7e-5p TGAGGTAGGAGGTTGTAGAT 2 9
mmu-let-7e-5p TGAGGTAGAAGGTTGTATAGTT 63 3
mmu-let-7e-5p TGGGGTAGTAGGTTGTATAGTTG 4 4
mmu-let-7e-5p TGAGGTAGGAGCTTGTATAGT 10 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAGA 6 1
mmu-let-7e-5p TGAGGTAGGAGGTAGTATAGTT 3 1
mmu-let-7e-5p GAGGTATGAGGTTGTATAGTT 3 1
mmu-let-7e-5p GAGGTTGTATAGTTGA 2 2
mmu-let-7e-5p GAGGTTGTATAGTTGT 2 47
mmu-let-7e-5p TGAAGTAGGAGGTTGTATAGT 4 1
mmu-let-7e-5p TGAGGTAGAAGGTTGTATAGTTAA 3 2
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTTAA 4 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTACAGTTG 10 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTACAGTTT 3 5
mmu-let-7e-5p TGAGGTAGGAGGTTGTACAGTTA 6 1
mmu-let-7e-5p TGAGGTAAGAGGTTGTATAGTTGA 2 1
mmu-let-7e-5p TGAGGTCGGAGGTTGTATAGTT 9 1
mmu-let-7e-5p CTGAGGTAGGAGGTTGTATAGTTG 3 1
mmu-let-7e-5p TCTGAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7e-5p TGAGGTAGCAGGTTGTATAGTTGA 3 1
mmu-let-7e-5p CTGAGGTAGTAGGTTGTATAGTT 22 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTAAGA 2 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTAAA 8 1
mmu-let-7e-5p AGGTAGGAGGTTGTATAGTTA 5 1
mmu-let-7e-5p AGGTAGGAGGTTGTATAGTTT 2 3
mmu-let-7e-5p AGGTAGGAGGTTGTATAGTTG 14 1
mmu-let-7e-5p TGAGGTGGTAGGTTGTATAGTTG 6 4
mmu-let-7e-5p GAGGTAGGAGGTTGT 5 39
mmu-let-7e-5p TGAGGGAGGAGGTTGTATAGT 5 1
mmu-let-7e-5p GAGGTAGGAGATTGTATAGTTA 3 4
mmu-let-7e-5p AGAGGTAGTAGGTTGTATAGTTG 3 5
mmu-let-7e-5p AGGTTGTATAGTTGA 4 6
mmu-let-7e-5p TGAGGGAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e-5p TGTGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e-5p GGAGGTTGTATAGTT 48 3
mmu-let-7e-5p GAGGGAGTAGGTTGTATAGTTG 6 4
mmu-let-7e-5p GTAGGAGGTTGTATAGT 9 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGAA 5 5
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGCTA 3 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGCTT 4 4
mmu-let-7e-5p AGGTAGGAGGTTGTATAGT 5 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGGTG 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGGTT 3 3
mmu-let-7e-5p TGAGGTAGTAGGTTGCATAGTTG 3 5
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTN 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTG 59 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTA 833 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATA 189 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATG 5 5
mmu-let-7e-5p GAGGGAGGAGGTTGTATGGTT 4 9
mmu-let-7e-5p TGAGGTAGTAGGTTGTATCGTTGA 2 3
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGTTGT 7 2
mmu-let-7e-5p AGGAGGTTGTATAGTTGT 5 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATTTAA 3 1
mmu-let-7e-5p TGAGGTAGGAGATTGTATAGTT 58 3
mmu-let-7e-5p TGAGGTAGGATGTTGTATAG 7 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAGAA 13 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAGAT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAAAG 8 1
mmu-let-7e-5p TGTAGGAGGTTGTATAGTT 40 3
mmu-let-7e-5p TGTGGTAGGAGGTTGTATAGT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTATATAGTTT 2 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGGT 58 3
mmu-let-7e-5p GAGGTAGTAGGTTGTATAGTAG 4 5
mmu-let-7e-5p TGAGGTAGGAGGTTGAAT 4 7
mmu-let-7e-5p TAGGTAGGAGGTTGTATAGTT 36 1
mmu-let-7e-5p TAGGAGGTTGTATAGTTGT 7 2
mmu-let-7e-5p TAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e-5p TGGTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGAAG 3 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGT 101 1
mmu-let-7e-5p TGATCTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e-5p TGAGGTATGAGGTTGTATAGT 15 1
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTTGT 11 1
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTAA 3 1
mmu-let-7e-5p TAAGGTAGGAGGTTGTATAGT 6 1
mmu-let-7e-5p TAAGGTAGGAGGTTGTATAGA 2 4
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTGAAG 2 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTGAAA 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTGTAGTT 32 1
mmu-let-7e-5p TGAGGTAGGAGGTCGTATAGTTA 7 1
mmu-let-7e-5p TGAGGTAGGAGGTCGTATAGTTT 2 3
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGTTT 30 3
mmu-let-7e-5p TGAGGTAGTAGGTTGTATTGTTGA 4 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAGAGA 2 1
mmu-let-7e-5p TGACGTAGGAGGTTGTATAGTTT 9 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGG 54 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGC 44 1
mmu-let-7e-5p TGAGGTAGGAGGTTGT 93 7
mmu-let-7e-5p TGAGGGAGGAGGTTGTATAGTTAA 3 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATCGTTG 4 7
mmu-let-7e-5p TGCGGTAGGAGGTTGTATAGTTA 4 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTAG 6 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGTAG 22 2
mmu-let-7e-5p TGAGGTAAGAGGTTGTATAGTTG 6 1
mmu-let-7e-5p TGAGGTATTAGGTTGTATAGTTG 5 4
mmu-let-7e-5p TGAGGTCGGAGGTTGTATAGTTGA 2 1
mmu-let-7e-5p CGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e-5p TGAGCTAGGAGGTTGTATAGTTGT 3 1
mmu-let-7e-5p AGGTAGGAGGTTGTATAGTTGA 5 1
mmu-let-7e-5p TGAGGTAAGAGGTTGTATAGT 4 1
mmu-let-7e-5p CGAGGTAGTAGGTTGTATAGTTG 3 4
mmu-let-7e-5p AGAGGTAGGAGGTTGTATAGTT 5 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGNTG 2 1
mmu-let-7e-5p TAGGAGGTTGTATAGTTAA 3 2
mmu-let-7e-5p TGAGGTAGTATGTTGTATAGTTGA 2 2
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTGG 7 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGTG 6 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGTT 51 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGTC 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGTA 73 2
mmu-let-7e-5p TGACGTAGGAGGTTGTATAGT 11 1
mmu-let-7e-5p TGTAGGAGGTTGTATAGTTG 10 2
mmu-let-7e-5p TGTAGGAGGTTGTATAGTTA 3 7
mmu-let-7e-5p TGTAGGAGGTTGTATAGTTT 11 21
mmu-let-7e-5p TGAGGTATGAGGTTGTATAGTT 39 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGA 19 3
mmu-let-7e-5p TGAGGTAGGAGCTTGTATAG 2 1
mmu-let-7e-5p TGAGGTGGGAGGTTGTATAGTTG 5 1
mmu-let-7e-5p TGAGGTGGGAGGTTGTATAGTTA 2 1
mmu-let-7e-5p TGAGGTGGGAGGTTGTATAGTTT 5 3
mmu-let-7e-5p AGGAGGTTGTATAGTTT 7 21
mmu-let-7e-5p TGAGGAAGGAGGTTGTATAGTTG 2 1
mmu-let-7e-5p TGAGGAAGGAGGTTGTATAGTTT 2 3
mmu-let-7e-5p TGAGGAAGGAGGTTGTATAGTTA 2 1
mmu-let-7e-5p GGTAGGAGGTTGTATAGTT 11 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTGTGGTTGA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATCGTTA 6 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATCGTTT 4 5
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTTGA 35 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAGA 22 3
mmu-let-7e-5p GAGTTAGGAGGTTGTATAGTT 4 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAAA 2 19
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGCTG 9 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTG 708 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTT 193 3
mmu-let-7e-5p TGAGGTAGCAGGTTGTATAGTTAA 5 2
mmu-let-7e-5p GAGGGAGGAGATTGTATAGTT 5 10
mmu-let-7e-5p GAGGTAGGAGGTTGTATAG 71 1
mmu-let-7e-5p GAGGTTGTATAGTTG 3 2
mmu-let-7e-5p GTAGTAGGTTGTATAGTTG 7 4
mmu-let-7e-5p TGAGATAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAGTTG 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAGTTA 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAGTTT 2 6
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAAG 106 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAAT 89 1
mmu-let-7e-5p GAGGTAGGAGATTGTATAGTT 15 3
mmu-let-7e-5p GTAGGAGGTTGTATAGTTGT 3 2
mmu-let-7e-5p TGAGGTAGGACGTTGTATAGTT 43 1
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGTTG 44 1
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGTTA 36 2
mmu-let-7e-5p TGAGGTAGCAGGTTGTATGGTTG 3 3
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTAT 8 5
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTAA 60 4
mmu-let-7e-5p TGAGGTAGGAGGTCGTATAGTTAA 2 1
mmu-let-7e-5p TCTGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTGTAGTTA 6 1
mmu-let-7e-5p TGAGGTAGGACGTTGTATAGT 11 1
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGTTA 22 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTA 25 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTT 1351 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAA 4885 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAC 22 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAT 1792 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAG 1043 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTACAGT 5 1
mmu-let-7e-5p GAGGTAGGATGTTGTATAGTT 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAAG 7 3
mmu-let-7e-5p TGAGGTAGGAGGGTGTATAGTTAA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGG 10 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGA 9 18
mmu-let-7e-5p NGAGGTAGGAGGTTGTATA 3 1
mmu-let-7e-5p TGAGGTAGCAGGTTGTATAGTTG 9 1
mmu-let-7e-5p TGAGGTAGCAGGTTGTATAGTTA 39 4
mmu-let-7e-5p TGAGGTAGCAGGTTGTATAGTTC 2 3
mmu-let-7e-5p TGAGGAAGGAGGTTGTATAGTT 8 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTGTAGTTGT 4 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATT 8 1
mmu-let-7e-5p TGAGGTATGAGGTTGTATAGTTT 3 3
mmu-let-7e-5p AGGTAGGAGGTTGTATAGTAA 4 5
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTGGA 2 2
mmu-let-7e-5p TGAGGTTGGAGGTTGTATAGTT 3 1
mmu-let-7e-5p TGAGGCAGGAGGTTGTATAGT 12 1
mmu-let-7e-5p TGAGGAAGGAGGTTGTATAGT 3 1
mmu-let-7e-5p TGAGGTGGGAGGTTGTATAGTT 18 1
mmu-let-7e-5p TGAGTTAGGAGGTTGTAT 2 4
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTTTG 2 4
mmu-let-7e-5p TGAGGTAGTAGGTTATATAGTTG 2 4
mmu-let-7e-5p TGAGGTAGGAGGCTGTATAGTT 30 1
mmu-let-7e-5p TGAGGTAGCAGGTTGTATAG 4 3
mmu-let-7e-5p AGTAGGTTGTATAGTTG 11 19
mmu-let-7e-5p CGAGGTAGGAGGTTGTATAGTT 14 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTTA 80 1
mmu-let-7e-5p TGAGGTAGGAGATTGTATAGTTA 12 3
mmu-let-7e-5p TGAGGTAGGAGGTTCTATAGTTAA 2 1
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGA 2 8
mmu-let-7e-5p TGAGGTAGGAGGTTGTAGAAT 2 9
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTG 10887 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAT 41 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAA 436 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGT 449 1
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGT 39 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATA 4 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGGTTAA 5 2
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTTAG 2 2
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTTAA 12 3
mmu-let-7e-5p AGGTAGGAGGTTGTATAGTT 23 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAATTG 2 5
mmu-let-7e-5p TGACGTAGGAGGTTGTATAGTTG 16 1
mmu-let-7e-5p TGACGTAGGAGGTTGTATAGTTA 6 1
mmu-let-7e-5p TGAGGTAGGAGGTGGTATAGTTG 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTC 26 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAAAT 5 2
mmu-let-7e-5p GTAGGAGGTTGTATAGTTGAGG 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAGT 4 1
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGT 34 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTNAA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTCTAGTTGT 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAGAGTTG 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATTT 43 1
mmu-let-7e-5p TGAGGTAGAAGGTTGTATAGTTG 2 1
mmu-let-7e-5p TGAGATAGGAGGTTGTATAGTT 15 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTAAG 7 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGT 3 23
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTCA 11 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTCT 2 2
mmu-let-7e-5p GAGGTAGGAGGTTGTATGGT 9 4
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGTTGT 6 1
mmu-let-7e-5p TGAGCTAGGAGGTTGTATAGT 7 1
mmu-let-7e-5p TGAGGTAGGAGGTCGTATAGTT 17 1
mmu-let-7e-5p TGATGTAGGATGTTGTATAGTT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAG 3047 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAA 98 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAT 27 1
mmu-let-7e-5p TGATTTAGGAGGTTGTATAGTT 2 1
mmu-let-7e-5p GAGGTAGCAGGTTGTATAGTT 5 3
mmu-let-7e-5p CGAGGTAGGAGGTTGTATAGT 12 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTA 4 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTT 352 1
mmu-let-7e-5p TAGGTAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e-5p GGAGGTAGGAGGTTGTATAGTT 4 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATT 15 3
mmu-let-7e-5p TGAGGTAGTAGGTTTTATAGTTG 4 4
mmu-let-7e-5p TGAGGTAGGAAGTTGTATAGTT 8 1
mmu-let-7e-5p GGTAGGAGGTTGTATAGTAA 2 12
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATA 2 8
mmu-let-7e-5p TGAGGTAGGAGGTTGTATTGTT 9 1
mmu-let-7e-5p GATGTAGGAGGTTGTATAGTT 4 1
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTTG 32 1
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTTC 2 1
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTTA 8 1
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTTT 11 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAATT 6 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAATA 2 2
mmu-let-7e-5p AGGAGGTTGTATAGTTG 6 1
mmu-let-7e-5p AGGAGGTTGTATAGTTA 6 11
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATTTGA 11 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATTTGT 8 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGAGT 4 2
mmu-let-7e-5p TGAGGTAGGCGGTTGTATAGTT 29 1
mmu-let-7e-5p CCTGAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7e-5p TGAGGTAGGACGTTGTATAG 3 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTAAA 2 3
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGTT 136 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGGA 2 2
mmu-let-7e-5p TGAGGTAGGCGGTTGTATAGT 10 2
mmu-let-7e-5p TGATCTAGGAGGTTGTATAGTT 4 1
mmu-let-7e-5p TGACGTAGGAGGTTGTATAGTT 44 1
mmu-let-7e-5p TGAGGTAGCAGGTTGTATAGT 32 3
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTGA 163 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAGA 91 1
mmu-let-7e-5p GAGGTAGGAGGTTGTAT 13 2
mmu-let-7e-5p GAGGTAGGAGGTTGTAA 2 36
mmu-let-7e-5p TGAGGTAGTGGGTTGTATAGTTGA 2 2
mmu-let-7e-5p GAGGCAGGAGGTTGTATAGTT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTGTAGTTG 15 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTGTAGTTT 2 6
mmu-let-7e-5p TAGGTAGGAGGTTGTATAGTTG 20 1
mmu-let-7e-5p TAGGTAGGAGGTTGTATAGTTA 13 3
mmu-let-7e-5p TAGGTAGGAGGTTGTATAGTTT 8 4
mmu-let-7e-5p TGGGGTAGGAGGTTGTATAGTT 27 2
mmu-let-7e-5p TGAGGTAGGACGTTGTATAGTTGA 5 1
mmu-let-7e-5p TGAGGTAGGACGTTGTATAGTTGT 5 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTTG 191 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTTT 49 3
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTTC 7 1
mmu-let-7e-5p TGAGTTAGTAGGTTGTATAGTTG 6 4
mmu-let-7e-5p GGAGGTTGTATAGTTGA 3 1
mmu-let-7e-5p GGAGGTTGTATAGTTGT 3 9
mmu-let-7e-5p TGAGGTAGAAGGTTGTATAGTTA 7 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATTTTT 3 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTACAGTTGA 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTACAGTTGT 2 1
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e-5p GGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTCTAGTT 45 1
mmu-let-7e-5p AGGTTGTATAGTTG 15 10
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTTTA 2 2
mmu-let-7e-5p TGAGGTACGAGGTTGTATAGTT 14 1
mmu-let-7e-5p TGAGGTAGGCGGTTGTATAGTTT 6 4
mmu-let-7e-5p TGAGGTAGGCGGTTGTATAGTTA 3 1
mmu-let-7e-5p TGAGGTAGGCGGTTGTATAGTTG 20 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTGG 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTGA 106 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAGTT 5 1
mmu-let-7e-5p TGGGGTAGGAGGTTGTATAGT 7 2
mmu-let-7e-5p TGAGGTAGGAGGTTGCATAGTT 18 1
mmu-let-7e-5p TGAGGTCGGAGGTTGTATAGTTAA 2 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTAG 6 1
mmu-let-7e-5p TGGTAGGAGGTTGTATAGTT 26 1
mmu-let-7e-5p TGAGGTAGGAGCTTGTATAGTT 36 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAAG 4 1
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGTT 179 1
mmu-let-7e-5p TGAGGTAGGAGGGTGTATGGTT 2 6
mmu-let-7e-5p AGGAGGTTGTATAGTT 22 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTGTAGTTGA 2 2
mmu-let-7e-5p TGAGGTAGGACGTTGTATAGTTA 7 1
mmu-let-7e-5p TGAGGTAGGACGTTGTATAGTTG 22 1
mmu-let-7e-5p TGAGGTAGGACGTTGTATAGTTT 3 3
mmu-let-7e-5p TGAGGTAGGGGGTTGTATAGTTGA 3 1
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTGA 9 1
mmu-let-7e-5p NGAGGTAGTAGGTTGTATAGTTG 59 4
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAG 5 2
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTTAA 26 1
mmu-let-7e-5p GAGGTAGTAGGTTGTATAGTTGA 35 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGC 5 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGA 657 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGT 21133 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAG 19 12
mmu-let-7e-5p TGAGGCAGGAGGTTGTATAGTTG 10 1
mmu-let-7e-5p TGAGGCAGGAGGTTGTATAGTTC 2 2
mmu-let-7e-5p TGAGGCAGGAGGTTGTATAGTTA 10 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATACTTG 9 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATACTTA 7 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGAT 8 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGAA 100 4
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTAA 136 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTAG 18 1
mmu-let-7e-5p TGAGGTAGGTGGTTGTATAGTTG 3 1
mmu-let-7e-5p TGAGGTAGGTGGTTGTATAGTTA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGCATAGTTG 9 1
mmu-let-7e-5p TGAGGTAGGAGGTTGCATAGTTA 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGCATAGTTT 4 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTAAA 17 1
mmu-let-7e-5p TGAGGTAGGAGGTCGTATAGT 9 1
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGTT 80 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATTGTTG 5 1
mmu-let-7e-5p TGAGGTAGGAGATTGTATAGTTG 9 2
mmu-let-7e-5p TGAGGTAGTAGGTTGTAGAGTTG 2 4
mmu-let-7e-5p AGGAGGTTGTATAGT 8 2
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTGA 2 3
mmu-let-7e-5p TGAGGTAGGGGGTTGTATAGTT 26 2
mmu-let-7e-5p TGAGGTAGGAGGTCGTATAGTTGT 3 1
mmu-let-7e-5p TGAGGTAGGAGGTCGTATAGTTGA 2 1
mmu-let-7e-5p TGAGCTAGGAGGTTGTATAGTTA 5 1
mmu-let-7e-5p TGAGCTAGGAGGTTGTATAGTTT 2 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAC 4 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAG 15 1
mmu-let-7e-5p GGTTGTATAGTTG 68 43
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAG 705 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAC 11 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAT 276 5
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAA 1262 2
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGTAG 2 2
mmu-let-7e-5p TGAGGTAGTAGGTTGTGTAGTTG 15 5
mmu-let-7e-5p TGAGGTAGGGGGTTGTATAGTTGT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTCAA 2 1
mmu-let-7e-5p TGAGGGAGGAGGTTGTATAGTT 34 1
mmu-let-7e-5p GAGGTAGTAGGTTCTATAGTTG 2 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGCTTA 2 2
mmu-let-7e-5p TGAGGTAGGAGGTTGCATAGT 3 1
mmu-let-7e-5p TAGGAGGTTGTATAGT 14 1
mmu-let-7e-5p TGTGGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAGT 37 1
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTG 43 1
mmu-let-7e-5p TGATGTAGGAGGTTGTATAG 5 2
mmu-let-7e-5p TGAGGTAGTAGGTCGTATAGTTG 2 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTGTAGT 8 1
mmu-let-7e-5p TGAGGTAGGAGGCTGTATAGTTGA 4 1
mmu-let-7e-5p TGAGGTAGGAGGCTGTATAGTTGT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTATATAGTT 19 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGGA 6 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATGGTTA 3 3
mmu-let-7e-5p TGAGGTAGTAGGCTGTATAGTTG 4 4
mmu-let-7e-5p GTAGGAGGTTGTATAGTTA 6 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAAA 564 1
mmu-let-7e-5p TGACGTAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e-5p TGACGTAGGAGGTTGTATAGTTGT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAAC 12 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTGTAG 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGCT 14 1
mmu-let-7e-5p TTAGGTAGTAGGTTGTATAGTTG 4 4
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAGT 4 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATTTG 50 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATTTT 8 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATTTA 9 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAGTTTA 4 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTCTAGTTGA 5 1
mmu-let-7e-5p CTGAGGTAGTAGGTTGTATAGTTAA 3 2
mmu-let-7e-5p TGAGGTAGGAGGGTGTATAGTT 4 1
mmu-let-7e-5p TGAGGTAGGAGGTTG 99 27
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAGT 30 1
mmu-let-7e-5p TGAGGTATGAGGTTGTATAGTTGT 3 1
mmu-let-7e-5p TTAGGAGGTTGTATAGTT 2 5
mmu-let-7e-5p TGAGGTAGGAGCTTGTATAGTTG 19 1
mmu-let-7e-5p TGAGGTAGGAGCTTGTATAGTTT 7 4
mmu-let-7e-5p GAGGTAGGAGGTTGTAAA 2 11
mmu-let-7e-5p TGAGGTAATAGGTTGTATAGTTG 2 4
mmu-let-7e-5p TGAGCTAGGAGGTTGTATAGTT 24 1
mmu-let-7e-5p TGAGGTAGGAGGTCGTATAGTTG 10 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTA 208 1
mmu-let-7e-5p AGGTAGTAGGTTGTATAGTTG 5 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTCG 14 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTCA 7 2
mmu-let-7e-5p GAGGTAGTAGGTTGTATAGTTG 187 4
mmu-let-7e-5p TGAGGTAGGTGGTTGTATAGTT 4 1
mmu-let-7e-5p TAGGAGGTTGTATAGTTGAGG 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAAGT 2 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATATTTGA 2 2
mmu-let-7e-5p TGCGGTAGGAGGTTGTATAGT 2 1
mmu-let-7e-5p TGAGCTAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGATG 3 1
mmu-let-7e-5p GTAGGAGGTTGTATAGTTTAT 2 3
mmu-let-7e-5p NGAGGTAGGAGGTTGTATAG 15 1
mmu-let-7e-5p GAGGTAGGAGGTTGTA 5 3
mmu-let-7e-5p TGTGGTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e-5p CTGAGGTAGTAGGTTGTATAGT 3 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGG 6 1
mmu-let-7e-5p TGAGGTAGTAGGTTCTATAGTTG 4 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTN 5 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTA 17479 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTT 9690 3
mmu-let-7e-5p TGAGGTAGGAGGCTGTATAGTTA 7 1
mmu-let-7e-5p TGAGGTAGGAGGCTGTATAGTTT 7 4
mmu-let-7e-5p TGAGGTAGGATTTTGTATAGTT 3 4
mmu-let-7e-5p TGAGGTACTAGGTTGTATAGTTG 5 4
mmu-let-7e-5p TGAGGTAGGAGGTTTTATAGT 6 1
mmu-let-7e-5p NGAGGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7e-5p GTAGGAGGTTGTATAGTTGAGGA 2 1
mmu-let-7e-5p GAGGTAGGAGTTTGTATAGTTA 2 1
mmu-let-7e-5p TGAGGTAGGAGATTGTATAGT 8 3
mmu-let-7e-5p TGGGTAGGAGGTTGTATAGTT 10 2
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTTGAAG 5 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATACT 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGGTTG 15 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTG 34792 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTC 448 1
mmu-let-7e-5p TGAGGTAGTATGTTGTATAGTTG 6 5
mmu-let-7e-5p TGAGGTCGGAGGTTGTATAGT 5 1
mmu-let-7e-5p NAGGTAGGAGGTTGTATAGTTG 3 1
mmu-let-7e-5p TGAGGTAGGAGGCTGTATAGTTG 6 1
mmu-let-7e-5p TGAGGCAGGAGGTTGTATAGTTT 2 6
mmu-let-7e-5p TGAGTTAGGAGGTTGTATAG 2 1
mmu-let-7e-5p TAAGGTAGGAGGTTGTATAGTT 11 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGGTTA 40 3
mmu-let-7e-5p GGTAGTAGGTTGTATAGTTGA 5 2
mmu-let-7e-5p TGATGTAGGAGGTTGTATAGTTAA 6 1
mmu-let-7e-5p TGAGGTAGGAGGTTCTATAGTTA 3 1
mmu-let-7e-5p TGAGGTAGCAGGTTGTAT 2 10
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTAAA 94 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATCGTT 9 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTATAGTAGA 53 2
mmu-let-7e-5p TGAGGTAGGAGGTTGCATAGTTGA 6 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTTTAGTT 3 1
mmu-let-7e-5p TGCGGTAGGAGGTTGTATAGTT 11 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGTGA 5 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTAG 46 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTAT 105 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTAC 2 2
mmu-let-7e-5p TGAGGTAGGAGGCTGTATAGT 11 1
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAGTTT 11 4
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAGTTA 7 2
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAGTTC 2 1
mmu-let-7e-5p TGGTAGGAGGTTGTATAGT 3 1
mmu-let-7e-5p GGTAGGAGGTTGTATAGTTAA 2 1
mmu-let-7e-5p GAGGTAGGGGGTTGTATAGTTG 4 1
mmu-let-7e-5p TGAGGTAGTAGCTTGTATAGTTGA 3 3
mmu-let-7e-5p TGGTAGGAGGTTGTATAGTTG 8 1
mmu-let-7e-5p TGGTAGGAGGTTGTATAGTTT 6 7
mmu-let-7e-5p TGGTAGGAGGTTGTATAGTTA 10 4
mmu-let-7e-5p TGAGGTAGTAGGTTGTATACTTG 2 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTATA 2 2
mmu-let-7e-5p TGAGGTATGAGGTTGTATAGTTAA 2 1
mmu-let-7e-5p TCAGGTAGGAGGTTGTATAGTT 10 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGA 7096 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGT 4790 1
mmu-let-7e-5p NGAGGTAGGAGGTTGTAT 3 2
mmu-let-7e-5p GTAGGTTGTATAGTTGA 4 15
mmu-let-7e-5p TGAGGTAGGAGGTTGTATATTG 3 3
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGTTGA 11 1
mmu-let-7e-5p TGAGGTAGTAGGTTGTCTAGTTG 9 4
mmu-let-7e-5p TGGGTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTATG 6 1
mmu-let-7e-5p TAGGAGGTTGTATAGTTAT 4 24
mmu-let-7e-5p TGAGGTAGGGGGTTGTATAGTTG 23 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTCTAGTTG 17 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTCTAGTTA 8 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTCTAGTTT 5 4
mmu-let-7e-5p TGAGGTCGGAGGTTGTATAGTTG 7 1
mmu-let-7e-5p TGAGGTAGGAAGTTGTATAGTTG 3 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATGGTT 24 3
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTAT 32 2
mmu-let-7e-5p TGAGGTAGGATTTTGTATAGT 2 8
mmu-let-7e-5p TGAGGTAGAAGGTTGTATAGT 12 3
mmu-let-7e-5p TGAGGTACGAGGTTGTATAGT 9 1
mmu-let-7e-5p CTGAGGTAGTAGGTTGTAT 2 6
mmu-let-7e-5p GGAGGTTGTATAGTTG 8 1
mmu-let-7e-5p GGAGGTTGTATAGTTA 5 38
mmu-let-7e-5p TAGGAGGTTGTATAGTTT 9 8
mmu-let-7e-5p TAGGAGGTTGTATAGTTA 7 4
mmu-let-7e-5p TAGGAGGTTGTATAGTTG 11 1
mmu-let-7e-5p AGAGGTAGGAGGTTGTATAGTTG 3 1
mmu-let-7e-5p AGAGGTAGGAGGTTGTATAGTTA 2 1
mmu-let-7e-5p TGAGGTAGCAGGTTGTATAGTT 243 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTCTAGT 12 1
mmu-let-7e-5p TGAGGTATGAGGTTGTATAGTTG 12 1
mmu-let-7e-5p TGAGGTATGAGGTTGTATAGTTA 2 1
mmu-let-7e-5p GGTAGTAGGTTGTATAGTTG 8 4
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGCTGT 2 1
mmu-let-7e-5p NAGGTAGGAGGTTGTATAGTTT 3 3
mmu-let-7e-5p TGCGGTAGGAGGTTGTATAGTTG 5 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAAT 8 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAAA 28 8
mmu-let-7e-5p TGAGGTAGGAGGATGTATAGTT 2 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTGAA 6 2
mmu-let-7e-5p TGAGGTGGGAGGTTGTATAGT 7 1
mmu-let-7e-5p CTGAGGTAGTAGGTTGTATGGTTG 2 3
mmu-let-7e-5p GGAGGTTGTATAGT 11 12
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTGT 97 1
mmu-let-7e-5p AGGTAGGAGGTTGTATAGTTGT 3 1
mmu-let-7e-5p TCTGAGGTAGTAGGTTGTATAGT 2 4
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTGT 7 1
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTTGC 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTAA 48 5
mmu-let-7e-5p TGAGGTAGGAGGTTGTAT 371 1
mmu-let-7e-5p GAGGTAGTAGGTTGTATAGTTGAA 2 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTAGAGTT 2 2
mmu-let-7e-5p TGAGGTAGTAGGTTGTACAGTTG 2 5
mmu-let-7e-5p TGAGGTAGGAGGTTTTATAGTTGA 2 1
mmu-let-7e-5p TGAGGTAGCAGGTTGTATGGTTGA 2 2
mmu-let-7e-5p TGATGTAGTAGGTTGTATAGTTG 4 5
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAAC 20 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAAG 13 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAAA 58 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTGAAT 21 1
mmu-let-7e-5p TGAGGTAGGAGCTTGTATAGTTA 2 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGNT 5 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGGTA 5 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTTTG 14 4
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAGTTAA 6 1
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTGAA 8 1
mmu-let-7e-5p TGAGGTAGGAGGTTTTATAGTTG 14 1
mmu-let-7e-5p TGAGGTAGGAGGTTTTATAGTTT 9 4
mmu-let-7e-5p TGAGGTAGGAGGTTTTATAGTTA 5 3
mmu-let-7e-5p TGAGGTTGGAGGTTGTATAGT 2 1
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTA 4 2
mmu-let-7e-5p TGAGGTAGGATGTTGTATAGTT 177 1
mmu-let-7e-5p TGAGGTAGGAGGTTCTATAGTTG 10 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATACTT 10 1
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAAGA 17 2
mmu-let-7e-5p TGAGGTAGGAGGTTGTATAGTTAAGT 12 1
mmu-let-7e-5p TGAGGTAGGAGTTTGTATAG 4 2
mmu-let-7e-5p TAGGAGGTTGTATAGTTGAGGA 3 1
mmu-let-7e-5p GAGGTTGTATAGTT 19 15
mmu-let-7e-5p TGAGGTAGTAGGTTGTATATTTG 16 4
mmu-let-7e-5p GGTAGCAGGTTGTATAGTT 3 3
mmu-let-7e-5p TGAGGTAGGAGGTTGTATGGTT 636 3
mmu-let-7e-5p TGAGGTAGTGGGTTGTATAGTTG 2 4
mmu-let-7e-5p GAGGTAGGAGGTTGTATAGTTGTA 2 2
mmu-let-7e-5p TTAGGTAGGAGGTTGTATAGTT 45 1