id_rna sequence raw_count mapping_loci
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTT 70396 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGA 1814 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTA 1026 2
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGTTG 9 1
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGTTT 4 3
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTGA 4 1
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGTTA 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTC 63 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTG 101 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTNG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTT 13 1
mmu-let-7e_precursor TAGTAGGTTGTATAGTTG 8 6
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTTG 8 1
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTTA 5 1
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTTT 2 3
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTG 6 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTA 6 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTT 6 3
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGCTG 4 4
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGT 65 2
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAG 2 2
mmu-let-7e_precursor GAGGGAGGAGGTTGTATAGTTG 6 1
mmu-let-7e_precursor GAGGGAGGAGGTTGTATAGTTT 2 4
mmu-let-7e_precursor TGAGGTAAGAGGTTGTATAG 2 1
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTG 5 1
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor GAGGTAGTAGGTTGCATAGTTGA 15 3
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGT 2 2
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGT 6 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTAA 4 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTC 6 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTAG 959 4
mmu-let-7e_precursor GTAGGAGGTTGTATAGTT 41 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATA 2 4
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTG 12 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTT 6 3
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTA 4 1
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGTTG 4 1
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGTTA 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAAA 5 1
mmu-let-7e_precursor TAGGAGGTTGTATAGTT 48 1
mmu-let-7e_precursor TGATAGGAGGTTGTATAGTT 3 8
mmu-let-7e_precursor TAAGGTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTG 55 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTC 2 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTT 20 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAGT 4 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGTT 17 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTTT 3 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGATT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTAA 4 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTT 29 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTA 2 1
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGTTGT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGAGTTA 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTTG 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTTA 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAG 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAA 396 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATCGTTG 3 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTGT 17 1
mmu-let-7e_precursor GAGGGAGGAGGTTGTATAGTT 14 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAGG 3 1
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTGA 5 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTCCT 9 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTCCA 2 1
mmu-let-7e_precursor GCGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor ATGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTTTAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAT 2 24
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAC 2 9
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAA 4 24
mmu-let-7e_precursor TGAGGGAGTAGGTTGTATAGTTG 8 4
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATTA 9 13
mmu-let-7e_precursor TGAGGAGGTTGTATAGTTG 2 28
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTG 5 1
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTT 10 6
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGT 3 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTTG 4 1
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTTT 2 4
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTTG 8 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTTA 4 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTCT 36 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTCC 49 1
mmu-let-7e_precursor GAGTAGGAGGTTGTATAGTT 2 11
mmu-let-7e_precursor TGAGCTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTG 25 1
mmu-let-7e_precursor GAGTAGGAGGTTGTATAGTTG 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAGAA 2 1
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAG 3 3
mmu-let-7e_precursor NAGGTAGGAGGTTGTATAGTTAA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGTT 7 1
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTG 17 1
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTA 9 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTA 30 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTC 2 4
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTG 2 4
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTCG 2 4
mmu-let-7e_precursor TCAGGTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTT 6 1
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTTA 7 3
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGTTG 6 1
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGTTA 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAG 6 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAC 7 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAA 76 3
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAT 16 2
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGT 4 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTAAG 3 1
mmu-let-7e_precursor NAGGTAGGAGGTTGTATAGTT 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTTTAGTTG 5 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTA 448 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTC 15 1
mmu-let-7e_precursor TGTAGGAGGTTGTATAGT 4 5
mmu-let-7e_precursor TGAGGTAAGAGGTTGTATAGTT 11 1
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGTT 10 1
mmu-let-7e_precursor GGTTGTATAGTTGA 8 15
mmu-let-7e_precursor TGAGGCAGTAGGTTGTATAGTTG 12 4
mmu-let-7e_precursor AGGAGGTTGTATAGTTAA 2 4
mmu-let-7e_precursor TATACGGCCTCCTAGCTTTCCT 5 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTT 19 3
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTC 2 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTA 13 2
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGC 71 4
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGG 21 4
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAA 6 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTGT 3 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGAA 6 30
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGAT 2 9
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGTT 63 3
mmu-let-7e_precursor TGGGGTAGTAGGTTGTATAGTTG 4 4
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGT 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAGA 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTT 3 1
mmu-let-7e_precursor GAGGTATGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor GAGGTTGTATAGTTGA 2 2
mmu-let-7e_precursor GAGGTTGTATAGTTGT 2 47
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGT 4 1
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGTTAA 3 2
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTAA 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGTTG 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGTTT 3 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGTTA 6 1
mmu-let-7e_precursor TGAGGTAAGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTT 9 1
mmu-let-7e_precursor CTGAGGTAGGAGGTTGTATAGTTG 3 1
mmu-let-7e_precursor TCTGAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTATAGTT 22 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAAGA 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAAA 8 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTA 5 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTT 2 3
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTG 14 1
mmu-let-7e_precursor TGAGGTGGTAGGTTGTATAGTTG 6 4
mmu-let-7e_precursor GAGGTAGGAGGTTGT 5 39
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGT 5 1
mmu-let-7e_precursor GAGGTAGGAGATTGTATAGTTA 3 4
mmu-let-7e_precursor AGAGGTAGTAGGTTGTATAGTTG 3 5
mmu-let-7e_precursor AGGTTGTATAGTTGA 4 6
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor GGAGGTTGTATAGTT 48 3
mmu-let-7e_precursor GAGGGAGTAGGTTGTATAGTTG 6 4
mmu-let-7e_precursor GTAGGAGGTTGTATAGT 9 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGAA 5 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGCTA 3 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGCTT 4 4
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGT 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGGTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGGTT 3 3
mmu-let-7e_precursor TGAGGTAGTAGGTTGCATAGTTG 3 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTN 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTG 59 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTA 833 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATA 189 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATG 5 5
mmu-let-7e_precursor GAGGGAGGAGGTTGTATGGTT 4 9
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATCGTTGA 2 3
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTGT 7 2
mmu-let-7e_precursor AGGAGGTTGTATAGTTGT 5 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTAA 3 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTT 58 3
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAG 7 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGAA 13 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGAT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAAG 8 1
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTT 40 3
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTTT 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGT 58 3
mmu-let-7e_precursor GAGGTAGTAGGTTGTATAGTAG 4 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGAAT 4 7
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTT 36 1
mmu-let-7e_precursor TAGGAGGTTGTATAGTTGT 7 2
mmu-let-7e_precursor TAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e_precursor TGGTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGAAG 3 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGT 101 1
mmu-let-7e_precursor TGATCTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGT 15 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTGT 11 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTAA 3 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGT 6 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGA 2 4
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGAAG 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGAAA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGTT 32 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTA 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTT 2 3
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTT 30 3
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATTGTTGA 4 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGAGA 2 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTT 9 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGG 54 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGC 44 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGT 93 7
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTAA 3 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATCGTTG 4 7
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTA 4 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTAG 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTAG 22 2
mmu-let-7e_precursor TGAGGTAAGAGGTTGTATAGTTG 6 1
mmu-let-7e_precursor TGAGGTATTAGGTTGTATAGTTG 5 4
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor CGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTGT 3 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTGA 5 1
mmu-let-7e_precursor TGAGGTAAGAGGTTGTATAGT 4 1
mmu-let-7e_precursor CGAGGTAGTAGGTTGTATAGTTG 3 4
mmu-let-7e_precursor AGAGGTAGGAGGTTGTATAGTT 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGNTG 2 1
mmu-let-7e_precursor TAGGAGGTTGTATAGTTAA 3 2
mmu-let-7e_precursor TGAGGTAGTATGTTGTATAGTTGA 2 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTGG 7 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTG 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTT 51 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTC 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTA 73 2
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGT 11 1
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTTG 10 2
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTTA 3 7
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTTT 11 21
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTT 39 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGA 19 3
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAG 2 1
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGTTG 5 1
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGTTA 2 1
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGTTT 5 3
mmu-let-7e_precursor AGGAGGTTGTATAGTTT 7 21
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTT 2 3
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTA 2 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTT 11 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTGGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATCGTTA 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATCGTTT 4 5
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTGA 35 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGA 22 3
mmu-let-7e_precursor GAGTTAGGAGGTTGTATAGTT 4 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAAA 2 19
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGCTG 9 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTG 708 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTT 193 3
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTTAA 5 2
mmu-let-7e_precursor GAGGGAGGAGATTGTATAGTT 5 10
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAG 71 1
mmu-let-7e_precursor GAGGTTGTATAGTTG 3 2
mmu-let-7e_precursor GTAGTAGGTTGTATAGTTG 7 4
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAGTTA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAGTTT 2 6
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAG 106 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAT 89 1
mmu-let-7e_precursor GAGGTAGGAGATTGTATAGTT 15 3
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTGT 3 2
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTT 43 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTG 44 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTA 36 2
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATGGTTG 3 3
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTAT 8 5
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTAA 60 4
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTAA 2 1
mmu-let-7e_precursor TCTGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGTTA 6 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGT 11 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTA 22 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTA 25 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTT 1351 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAA 4885 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAC 22 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAT 1792 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAG 1043 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGT 5 1
mmu-let-7e_precursor GAGGTAGGATGTTGTATAGTT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAAG 7 3
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTTAA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGG 10 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGA 9 18
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATA 3 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTTG 9 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTTA 39 4
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTTC 2 3
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTT 8 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGTTGT 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATT 8 1
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTT 3 3
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTAA 4 5
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTGGA 2 2
mmu-let-7e_precursor TGAGGTTGGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGT 12 1
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGTT 18 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTAT 2 4
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTTG 2 4
mmu-let-7e_precursor TGAGGTAGTAGGTTATATAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTT 30 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAG 4 3
mmu-let-7e_precursor AGTAGGTTGTATAGTTG 11 19
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTT 14 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTA 80 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTTA 12 3
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTTAA 2 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGA 2 8
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGAAT 2 9
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTG 10887 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAT 41 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAA 436 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGT 449 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGT 39 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATA 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTAA 5 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTAG 2 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTAA 12 3
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTT 23 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAATTG 2 5
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTG 16 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTA 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTC 26 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAAAT 5 2
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTGAGG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAGT 4 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGT 34 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTNAA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGTTGT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTT 43 1
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGTT 15 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAAG 7 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGT 3 23
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTCA 11 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTCT 2 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATGGT 9 4
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTGT 6 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGT 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTT 17 1
mmu-let-7e_precursor TGATGTAGGATGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAG 3047 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAA 98 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAT 27 1
mmu-let-7e_precursor TGATTTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor GAGGTAGCAGGTTGTATAGTT 5 3
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGT 12 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTA 4 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTT 352 1
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e_precursor GGAGGTAGGAGGTTGTATAGTT 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATT 15 3
mmu-let-7e_precursor TGAGGTAGTAGGTTTTATAGTTG 4 4
mmu-let-7e_precursor TGAGGTAGGAAGTTGTATAGTT 8 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTAA 2 12
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATA 2 8
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATTGTT 9 1
mmu-let-7e_precursor GATGTAGGAGGTTGTATAGTT 4 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTG 32 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTC 2 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTA 8 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTT 11 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAATT 6 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAATA 2 2
mmu-let-7e_precursor AGGAGGTTGTATAGTTG 6 1
mmu-let-7e_precursor AGGAGGTTGTATAGTTA 6 11
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTGA 11 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTGT 8 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAGT 4 2
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTT 29 1
mmu-let-7e_precursor CCTGAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAG 3 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTAAA 2 3
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTT 136 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGGA 2 2
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGT 10 2
mmu-let-7e_precursor TGATCTAGGAGGTTGTATAGTT 4 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTT 44 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGT 32 3
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGA 163 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGA 91 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTAT 13 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTAA 2 36
mmu-let-7e_precursor TGAGGTAGTGGGTTGTATAGTTGA 2 2
mmu-let-7e_precursor GAGGCAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGTTG 15 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGTTT 2 6
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTTG 20 1
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTTA 13 3
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTTT 8 4
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTT 27 2
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTGA 5 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTGT 5 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTG 191 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTT 49 3
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTC 7 1
mmu-let-7e_precursor TGAGTTAGTAGGTTGTATAGTTG 6 4
mmu-let-7e_precursor GGAGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor GGAGGTTGTATAGTTGT 3 9
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGTTA 7 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATTTTT 3 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGTTGT 2 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGTT 45 1
mmu-let-7e_precursor AGGTTGTATAGTTG 15 10
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTTA 2 2
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGTT 14 1
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTT 6 4
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTA 3 1
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTG 20 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTGG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTGA 106 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAGTT 5 1
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGT 7 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTT 18 1
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTTAA 2 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTAG 6 1
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGTT 26 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTT 36 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAG 4 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTT 179 1
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATGGTT 2 6
mmu-let-7e_precursor AGGAGGTTGTATAGTT 22 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTGTAGTTGA 2 2
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTA 7 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTG 22 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTT 3 3
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTGA 9 1
mmu-let-7e_precursor NGAGGTAGTAGGTTGTATAGTTG 59 4
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAG 5 2
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTAA 26 1
mmu-let-7e_precursor GAGGTAGTAGGTTGTATAGTTGA 35 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGC 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGA 657 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGT 21133 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAG 19 12
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTG 10 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTC 2 2
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTA 10 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTTG 9 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTTA 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGAT 8 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGAA 100 4
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAA 136 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAG 18 1
mmu-let-7e_precursor TGAGGTAGGTGGTTGTATAGTTG 3 1
mmu-let-7e_precursor TGAGGTAGGTGGTTGTATAGTTA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTG 9 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTT 4 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAA 17 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGT 9 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTT 80 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATTGTTG 5 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTTG 9 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTAGAGTTG 2 4
mmu-let-7e_precursor AGGAGGTTGTATAGT 8 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTGA 2 3
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTT 26 2
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTGT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTA 5 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTT 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAC 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAG 15 1
mmu-let-7e_precursor GGTTGTATAGTTG 68 43
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAG 705 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAC 11 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAT 276 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAA 1262 2
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTAG 2 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTGTAGTTG 15 5
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTCAA 2 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTT 34 1
mmu-let-7e_precursor GAGGTAGTAGGTTCTATAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGCTTA 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGT 3 1
mmu-let-7e_precursor TAGGAGGTTGTATAGT 14 1
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGT 37 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTG 43 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAG 5 2
mmu-let-7e_precursor TGAGGTAGTAGGTCGTATAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGT 8 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTGA 4 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTT 19 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGGA 6 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATGGTTA 3 3
mmu-let-7e_precursor TGAGGTAGTAGGCTGTATAGTTG 4 4
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTA 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAA 564 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAC 12 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGCT 14 1
mmu-let-7e_precursor TTAGGTAGTAGGTTGTATAGTTG 4 4
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGT 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTG 50 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTT 8 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTA 9 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTTA 4 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGTTGA 5 1
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTATAGTTAA 3 2
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTT 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTG 99 27
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGT 30 1
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTGT 3 1
mmu-let-7e_precursor TTAGGAGGTTGTATAGTT 2 5
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTG 19 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTT 7 4
mmu-let-7e_precursor GAGGTAGGAGGTTGTAAA 2 11
mmu-let-7e_precursor TGAGGTAATAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTT 24 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTG 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTA 208 1
mmu-let-7e_precursor AGGTAGTAGGTTGTATAGTTG 5 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTCG 14 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTCA 7 2
mmu-let-7e_precursor GAGGTAGTAGGTTGTATAGTTG 187 4
mmu-let-7e_precursor TGAGGTAGGTGGTTGTATAGTT 4 1
mmu-let-7e_precursor TAGGAGGTTGTATAGTTGAGG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAGT 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATATTTGA 2 2
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGT 2 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGATG 3 1
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTTAT 2 3
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAG 15 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTA 5 3
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTATAGT 3 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGG 6 1
mmu-let-7e_precursor TGAGGTAGTAGGTTCTATAGTTG 4 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTN 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTA 17479 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTT 9690 3
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTA 7 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTT 7 4
mmu-let-7e_precursor TGAGGTAGGATTTTGTATAGTT 3 4
mmu-let-7e_precursor TGAGGTACTAGGTTGTATAGTTG 5 4
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGT 6 1
mmu-let-7e_precursor NGAGGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTGAGGA 2 1
mmu-let-7e_precursor GAGGTAGGAGTTTGTATAGTTA 2 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGT 8 3
mmu-let-7e_precursor TGGGTAGGAGGTTGTATAGTT 10 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAAG 5 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTG 15 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTG 34792 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTC 448 1
mmu-let-7e_precursor TGAGGTAGTATGTTGTATAGTTG 6 5
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGT 5 1
mmu-let-7e_precursor NAGGTAGGAGGTTGTATAGTTG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTG 6 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTT 2 6
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAG 2 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTT 11 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTA 40 3
mmu-let-7e_precursor GGTAGTAGGTTGTATAGTTGA 5 2
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTAA 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTTA 3 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTAT 2 10
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAAA 94 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATCGTT 9 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTAGA 53 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTGA 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTTTAGTT 3 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTT 11 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTGA 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAG 46 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAT 105 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAC 2 2
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGT 11 1
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTT 11 4
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTA 7 2
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTC 2 1
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTTAA 2 1
mmu-let-7e_precursor GAGGTAGGGGGTTGTATAGTTG 4 1
mmu-let-7e_precursor TGAGGTAGTAGCTTGTATAGTTGA 3 3
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGTTG 8 1
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGTTT 6 7
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGTTA 10 4
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATACTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTATA 2 2
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTAA 2 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTT 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGA 7096 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGT 4790 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTAT 3 2
mmu-let-7e_precursor GTAGGTTGTATAGTTGA 4 15
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTG 3 3
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTGA 11 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTCTAGTTG 9 4
mmu-let-7e_precursor TGGGTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTATG 6 1
mmu-let-7e_precursor TAGGAGGTTGTATAGTTAT 4 24
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTTG 23 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGTTG 17 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGTTA 8 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGTTT 5 4
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTTG 7 1
mmu-let-7e_precursor TGAGGTAGGAAGTTGTATAGTTG 3 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATGGTT 24 3
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAT 32 2
mmu-let-7e_precursor TGAGGTAGGATTTTGTATAGT 2 8
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGT 12 3
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGT 9 1
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTAT 2 6
mmu-let-7e_precursor GGAGGTTGTATAGTTG 8 1
mmu-let-7e_precursor GGAGGTTGTATAGTTA 5 38
mmu-let-7e_precursor TAGGAGGTTGTATAGTTT 9 8
mmu-let-7e_precursor TAGGAGGTTGTATAGTTA 7 4
mmu-let-7e_precursor TAGGAGGTTGTATAGTTG 11 1
mmu-let-7e_precursor AGAGGTAGGAGGTTGTATAGTTG 3 1
mmu-let-7e_precursor AGAGGTAGGAGGTTGTATAGTTA 2 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTT 243 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGT 12 1
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTG 12 1
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTA 2 1
mmu-let-7e_precursor GGTAGTAGGTTGTATAGTTG 8 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGCTGT 2 1
mmu-let-7e_precursor NAGGTAGGAGGTTGTATAGTTT 3 3
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTG 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAAT 8 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAAA 28 8
mmu-let-7e_precursor TGAGGTAGGAGGATGTATAGTT 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTGAA 6 2
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGT 7 1
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTATGGTTG 2 3
mmu-let-7e_precursor GGAGGTTGTATAGT 11 12
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGT 97 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTGT 3 1
mmu-let-7e_precursor TCTGAGGTAGTAGGTTGTATAGT 2 4
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTGT 7 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTGC 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAA 48 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAT 371 1
mmu-let-7e_precursor GAGGTAGTAGGTTGTATAGTTGAA 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGAGTT 2 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTACAGTTG 2 5
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATGGTTGA 2 2
mmu-let-7e_precursor TGATGTAGTAGGTTGTATAGTTG 4 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAC 20 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAG 13 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAA 58 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAT 21 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGNT 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTA 5 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTTG 14 4
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTAA 6 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGAA 8 1
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGTTG 14 1
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGTTT 9 4
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGTTA 5 3
mmu-let-7e_precursor TGAGGTTGGAGGTTGTATAGT 2 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTA 4 2
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTT 177 1
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTTG 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTT 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAGA 17 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAGT 12 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAG 4 2
mmu-let-7e_precursor TAGGAGGTTGTATAGTTGAGGA 3 1
mmu-let-7e_precursor GAGGTTGTATAGTT 19 15
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATATTTG 16 4
mmu-let-7e_precursor GGTAGCAGGTTGTATAGTT 3 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTT 636 3
mmu-let-7e_precursor TGAGGTAGTGGGTTGTATAGTTG 2 4
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGTA 2 2
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTT 45 1