id_rna sequence raw_count mapping_loci
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCCT 17 1
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCCTT 3 1
mmu-let-7f-1-3p CTATACAATCTATTGCCTTC 2 1
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCC 3 1
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCCG 2 1
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCCA 3 1
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCCTAGA 3 1