id_rna sequence raw_count mapping_loci
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCT 101 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCCA 4 2
mmu-let-7a-1-3p CNATACAATCTACTGTCTTTCT 3 2
mmu-let-7a-1-3p CGATACAATCTACTGTCTTTCC 2 3
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCCT 3 2
mmu-let-7a-1-3p CTATATAATCTACTGTCTTTCT 2 11
mmu-let-7a-1-3p TATACAATCTACTGTCTTTC 4 2
mmu-let-7a-1-3p CTANACAATCTACTGTCTTTC 2 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCC 70 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCA 2 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCG 4 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTC 94 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTTCTG 2 3
mmu-let-7a-1-3p CNATACAATCTACTGTCTTTCC 4 2
mmu-let-7a-1-3p CTCTACAATCTACTGTCTTTCC 2 3
mmu-let-7a-1-3p TATACAATCTACTGTCTTTCC 3 2
mmu-let-7a-1-3p TATACAATCTACTGTCTTTCT 4 3
mmu-let-7a-1-3p CTATACAATCTACTGT 2 4
mmu-let-7a-1-3p CTAGACAATCTACTGTCTTTC 2 3
mmu-let-7a-1-3p CNATACAATCTACTGTCTTT 4 2
mmu-let-7a-1-3p CTGNACAATCTACTGTCTTTC 3 2
mmu-let-7a-1-3p CTATACAATCTACTGTCTTT 40 2