id_rna sequence raw_count mapping_loci
mmu-let-7a-2-3p CTGTACAGCCTCCTAGCTTTCC 7 1
mmu-let-7a-2-3p CTGTACAGCCTCCTAGCTTTC 5 1
mmu-let-7a-2-3p CTGTACAGCCTCCTAGCTTTCCA 2 1