id_rna sequence raw_count mapping_loci
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTT 551860 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTT 45856 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTG 7514 4
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTT 6024 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTT 3118 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTA 316 2
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGT 179 2
mmu-let-7a-2_precursor GTAGTAGGTTGTANAGTT 7 2
mmu-let-7a-2_precursor TGAGGTAGNAGGTTGTATAGT 6 3
mmu-let-7a-2_precursor TGAGGTAGNAGGTTGTATAGC 2 3
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGNATAGTTTA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTTGTTTA 5 3
mmu-let-7a-2_precursor TTGAGGTAGTAGTTTGTATAGTT 2 1
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGA 4 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTCTATAGTTAA 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGTTGA 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTAT 7 5
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATATTTTA 3 3
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTC 20 4
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTG 68 4
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGNATAGTT 2 5
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGT 6 12
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTAT 6 6
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAAAGTT 46 2
mmu-let-7a-2_precursor TAGTAGGTTGTATAGTTT 44 2
mmu-let-7a-2_precursor TAGTAGGTTGTATAGTTA 95 7
mmu-let-7a-2_precursor TAGTAGGTTGTATAGTTG 7 6
mmu-let-7a-2_precursor ANGTAGTAGGTTGTATAGT 5 2
mmu-let-7a-2_precursor GAGGTAGTANGTTGTATAGTTG 3 5
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAGTTT 12 2
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAGTTG 4 5
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAGTTA 29 3
mmu-let-7a-2_precursor CGAGGTAGGAGGTTGTATAGTTT 4 3
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAG 55 2
mmu-let-7a-2_precursor TGAGGTACTAGGNTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATACTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATAGTTTAG 8 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGT 10 11
mmu-let-7a-2_precursor GAGGTAGTAGCTTNTATAGTT 2 4
mmu-let-7a-2_precursor TGCCGTAGTAGGTTGTATAGTT 13 3
mmu-let-7a-2_precursor TAGGTAGTAGGTNGTATAGTT 4 2
mmu-let-7a-2_precursor TGNGGTAGTAGCTTGTATAGTT 2 4
mmu-let-7a-2_precursor NGGGGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAAGTAGTAGGTTGTATAGTTT 13 2
mmu-let-7a-2_precursor TGAAGTAGTAGGTTGTATAGTTC 3 2
mmu-let-7a-2_precursor TGAAGTAGTAGGTTGTATAGTTA 23 2
mmu-let-7a-2_precursor TGAAGTAGTAGGTTGTATAGTTG 4 4
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTA 7 4
mmu-let-7a-2_precursor TGAGGCAGTAGGTNGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGCTT 14 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGCTA 8 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGCTG 2 4
mmu-let-7a-2_precursor GTTGAGGTAGTAGGTTGTATAGTT 2 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGGTA 4 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTAT 6 2
mmu-let-7a-2_precursor TGGNGTAGTAGGTTGTATAGTT 1217 2
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATA 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGTTAA 12 1
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTTTG 2 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGA 13 6
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATTGTT 2 5
mmu-let-7a-2_precursor GTAGGTTGTATAGNT 48 14
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTTT 135 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTTG 36 5
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTTC 6 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTTA 242 2
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTACAGTT 2 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTAAA 6 2
mmu-let-7a-2_precursor TGNGGTAGTAGATTGTATAGTTTA 5 2
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-2_precursor GCGGTAGTAGGTTGTATAGTTT 3 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGCATAGTTT 2 4
mmu-let-7a-2_precursor TNGAGGTAGTAGGTTGTATAGTTA 2 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTGCATAGTTGA 6 3
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTACAGTT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTTC 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTTT 77 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTTG 11 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTTA 150 2
mmu-let-7a-2_precursor GTAGNTTGTATAGTT 55 23
mmu-let-7a-2_precursor TGAGGGAGGAGGTTGTATAGTTTA 2 2
mmu-let-7a-2_precursor TGAGNTAGGAGGTTGTATAGTTTA 6 2
mmu-let-7a-2_precursor GGTAGTAGGNTGTATAGT 8 2
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATAGTTCAG 3 2
mmu-let-7a-2_precursor TGCGGGAGTAGGTTGTATAGT 2 3
mmu-let-7a-2_precursor TTGAGGTAGTNAGTTGTATAGTT 3 1
mmu-let-7a-2_precursor CGCGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTATG 4 4
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTAT 24 5
mmu-let-7a-2_precursor TGAGGTATTAGGTTGTATAGT 36 2
mmu-let-7a-2_precursor GGTAGTAGGTGGTNTAGTT 2 2
mmu-let-7a-2_precursor CGAGGTAGTAGGTTGTATAG 9 2
mmu-let-7a-2_precursor NAGGTAGTAGGTTGTATAGTT 18 2
mmu-let-7a-2_precursor TTGAGGTAGNAGGTTGTATAGT 5 1
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTAT 3 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAG 29 1
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTT 2678 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTA 10 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTTTAGT 10 2
mmu-let-7a-2_precursor GGGNGTAGGTTGTATAGT 3 10
mmu-let-7a-2_precursor TGAGGTAGGNGGTTGTATAGTTT 47 4
mmu-let-7a-2_precursor GAAGTAGGTTGTATAGTT 5 5
mmu-let-7a-2_precursor TGATGTAGTAGCTTGTATAGTT 2 6
mmu-let-7a-2_precursor NGAGGAAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATATTT 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTAG 747 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTAT 685 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTAA 1798 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTAC 51 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTTTA 3 1
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGCATAGTT 2 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATATTT 2 2
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTGTAGTT 3 3
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGGA 4 40
mmu-let-7a-2_precursor TNAGGTAGTAGTTTGTATAGT 2 5
mmu-let-7a-2_precursor CTGTACAGCCTCCTAGCTTTC 5 1
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGT 250 4
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGA 2 6
mmu-let-7a-2_precursor TGAGGGAGGAGGTTGTATAGTTT 46 3
mmu-let-7a-2_precursor GAGGTAGTANGTTGTATAGTTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGTTTA 2 1
mmu-let-7a-2_precursor GAGNTAGTAGGTTGGATAGTT 4 3
mmu-let-7a-2_precursor TGAGATAGTAGGTTGTATAGTTA 6 3
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGTT 490 2
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGTA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTGA 1205 2
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATAGTTTA 379 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTTTAGTT 2 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTGT 5 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTTAA 24 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTTA 11 1
mmu-let-7a-2_precursor TNAGGTAGTAGGTT 51 48
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGGATAGT 9 2
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATATTT 2 6
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTATAGTTAA 4 1
mmu-let-7a-2_precursor GAGTAGTAGGTTGTATAGT 5 20
mmu-let-7a-2_precursor TGCGGTAGTAGCTTGTATAGTT 6 4
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGTTTAT 3 1
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGTTT 103 2
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGTTA 145 3
mmu-let-7a-2_precursor TGAGGTAGTGGGTNGTATAGTT 4 2
mmu-let-7a-2_precursor TAGGTAGTAGGTTNTATAGTT 3 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTA 8 3
mmu-let-7a-2_precursor GGTAGTAGGTTGTATATTT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGTA 11 4
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGTT 1736 4
mmu-let-7a-2_precursor GGTAGTAGGTTGNATAGTT 24 3
mmu-let-7a-2_precursor GTAGGTTGTATAGTTC 19 42
mmu-let-7a-2_precursor TGAGGTAGTACGTTGTATAGT 4 2
mmu-let-7a-2_precursor NGCGGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-2_precursor TGAGGTAGGAGTTTGTATAGTTT 12 5
mmu-let-7a-2_precursor TGCGGTATTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTA 8 16
mmu-let-7a-2_precursor NGAGGTAGTAGTTTGTATAGT 2 5
mmu-let-7a-2_precursor TGAGGGAGTAGTTTGTATAGTT 2 6
mmu-let-7a-2_precursor TGAGGTAGTANTTTGTATAG 12 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTTTATAGT 13 2
mmu-let-7a-2_precursor TGCGGTAGTAGATTGTATAGTTTA 6 2
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATA 3 2
mmu-let-7a-2_precursor GAGNTAGTAGGTTGTATAGTA 2 2
mmu-let-7a-2_precursor GAGNTAGTAGGTTGTATAGTT 63 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTCTAGTT 204 2
mmu-let-7a-2_precursor CGGGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor GTAGGTTGTNTAGTT 70 17
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATAGTTTAT 2 2
mmu-let-7a-2_precursor TGAAGTAGGTTGTATAGTTT 2 20
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATAGTT 616 2
mmu-let-7a-2_precursor TGAGGTAGCAGGTTGTATAGTTAA 2 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAT 3 5
mmu-let-7a-2_precursor GTGNTAGGTTGTATAGT 2 37
mmu-let-7a-2_precursor TGNTGTAGTAGGTTGTATAGTT 6 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTATATAGTTT 3 3
mmu-let-7a-2_precursor TTAGGTAGTAGGTNGTATAGTT 6 2
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAG 24 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTGGTATAGTT 5 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGT 45 9
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAGTTAA 3 1
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAG 21 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTATA 4 2
mmu-let-7a-2_precursor TGAGATAGTAGGTTGTATAGTT 66 2
mmu-let-7a-2_precursor TTAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor TTNAGGTAGTAGGTTGTATAGTT 7 1
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGT 133 2
mmu-let-7a-2_precursor GANGTAGTAGGTTGTATAGT 17 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGA 4 7
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGT 180 5
mmu-let-7a-2_precursor GNAGGTTGTATAGTT 290 16
mmu-let-7a-2_precursor TGAGGTAGTGGGTTGTATAGTTT 26 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATA 11 3
mmu-let-7a-2_precursor TGGGGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-2_precursor TGCGGTTGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TGAGCTAGTAGGTTGTATAGTT 134 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCNGTATAGTT 3 2
mmu-let-7a-2_precursor GAGGTCGTAGGTTGTATAGTT 54 2
mmu-let-7a-2_precursor TAAGGTAGGAGGTTGTATAGTTT 8 3
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAGT 136 5
mmu-let-7a-2_precursor TGGGGTAGTAGGGTGTATAGTT 2 2
mmu-let-7a-2_precursor GGAGGTAGTAGGTTGTATAG 3 2
mmu-let-7a-2_precursor GAGGTGGTAGGTTGTATAGTTG 3 4
mmu-let-7a-2_precursor GAGGTGGTAGGTTGTATAGTTA 7 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTTGA 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAAGT 2 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATCGT 4 4
mmu-let-7a-2_precursor TAGGTTGTATAGTT 569 21
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATA 16 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTAT 11 7
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTGTAGTT 5 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTTTAGTTT 14 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTTTAGTTA 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTA 1614 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGGTT 7 4
mmu-let-7a-2_precursor TGAGGTAGTACGTTGTATAGTT 24 2
mmu-let-7a-2_precursor GAGGTAGTAGNTTGTATAGTT 8 4
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTAT 4 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTT 384 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTG 50 4
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTC 18 3
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTA 550 3
mmu-let-7a-2_precursor TGNGCTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTGA 5 2
mmu-let-7a-2_precursor GAGGTGGTAGGTTGTATAG 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTA 3 24
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAATAGTTT 13 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAATAGTTG 5 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAATAGTTA 22 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTA 22 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTG 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTTTTT 9 4
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGCATAGTT 2 3
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGNATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTGT 2 2
mmu-let-7a-2_precursor AAGGTAGTAGGTTGTATAGTT 5 3
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTTAA 13 1
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTTAG 5 4
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATAGTTAAG 60 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTTAA 15 2
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTT 745 2
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTA 3 5
mmu-let-7a-2_precursor GAGGTAGTAGNGTGTATAGTT 24 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTTAA 71 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTA 53 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTAAA 2 7
mmu-let-7a-2_precursor GTAGGAGGTTGTATAGTTT 9 6
mmu-let-7a-2_precursor TAGTAGGTTGTATAG 15 4
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGTT 1017 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7a-2_precursor GACGTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGTTT 114 3
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGTTC 5 4
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGTTA 191 4
mmu-let-7a-2_precursor TGAGGTGGTAGCTTGTATAGTT 2 4
mmu-let-7a-2_precursor NGTAGGTTGTATAGTT 2 7
mmu-let-7a-2_precursor GANGTAGTAGGTTGTATAGTTA 7 2
mmu-let-7a-2_precursor GTAGTTGGTTGTATAGTT 8 6
mmu-let-7a-2_precursor TGATGTAGTANGTTGTATAGTT 2 2
mmu-let-7a-2_precursor ATAGTAGGTTGTATAGTT 2 7
mmu-let-7a-2_precursor TGAGGTAGGAGGGTGTATAGTTT 6 4
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATTGT 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAA 4 17
mmu-let-7a-2_precursor GGTAGTAGGATGTATAGTT 2 3
mmu-let-7a-2_precursor GGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGTT 729 2
mmu-let-7a-2_precursor TGAGCTAGTAGGTTGTATAGTTT 7 2
mmu-let-7a-2_precursor TGAGCTAGTAGGTTGTATAGTTA 13 2
mmu-let-7a-2_precursor TGAGCTAGTAGGTTGTATAGTTG 2 4
mmu-let-7a-2_precursor TGAGGTAGTTGGTTGTATAGTT 46 2
mmu-let-7a-2_precursor GNGTTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAGAGTT 21 2
mmu-let-7a-2_precursor AGTAGGTTGTATAG 5 16
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTC 19 2
mmu-let-7a-2_precursor NGAGGTGGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGGAGTCGGTTGTATAGT 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAC 13 2
mmu-let-7a-2_precursor TGAGGTAGGAGGNTGTATAGTTT 38 3
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGGATAGTTT 6 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTGTAGTT 12 3
mmu-let-7a-2_precursor GGTAGTAGTTTGTATAGTT 2 5
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATTGTT 11 5
mmu-let-7a-2_precursor GATGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-2_precursor GAGGTAGGAGGTTGTATAGTTTA 5 2
mmu-let-7a-2_precursor GAGGTAGGAGGTTGTATAGTTTG 3 4
mmu-let-7a-2_precursor ACTGAGGTAGTAGGTTGTATAGTT 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACATTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTTAA 4 2
mmu-let-7a-2_precursor TGAAGTAGTAGGTTGTATAG 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTCT 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTCA 13 2
mmu-let-7a-2_precursor TNAGCTAGTAGGTTGTATAGTT 8 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATTGTT 6 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTCTATAGT 10 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTTAA 22 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGT 3 15
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATAGTTTA 3 1
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGTTT 81 2
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGTTA 141 2
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGTTG 13 4
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTAA 5 11
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATATTT 5 3
mmu-let-7a-2_precursor AGGTAGTAGGTTNTATAGTT 4 2
mmu-let-7a-2_precursor TGAGTTAGTAGGNTGTATAGT 2 3
mmu-let-7a-2_precursor TNAGGTAGTTGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTACGAGGTTGTATAGTTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTGAG 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTGAA 40 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTGAT 6 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTTTATAGTTT 3 2
mmu-let-7a-2_precursor AGGTAGTAGGTTGTA 2 5
mmu-let-7a-2_precursor NAGGTAGTAGGTTGTATAGT 6 2
mmu-let-7a-2_precursor TTGGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATATT 2 2
mmu-let-7a-2_precursor TGAGGTAGNAGGTTGTGTAGTT 2 4
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGTT 1247 2
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGTA 7 4
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTTTAGTTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGCATAGTT 6 8
mmu-let-7a-2_precursor GTGGTAGTAGGTTGTATAGT 4 2
mmu-let-7a-2_precursor TNGAGGTAGTAGGTTGTATAGTT 34 1
mmu-let-7a-2_precursor TGAGGTAGGNGGTTGTATAGTTTA 4 2
mmu-let-7a-2_precursor TNAGGTACTAGGTTGTATAGTT 7 2
mmu-let-7a-2_precursor GNAGTAGGTTGTATAGTT 30 3
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTAT 5 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTGTAGTT 2 5
mmu-let-7a-2_precursor GGTANTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGAATAGTT 181 2
mmu-let-7a-2_precursor TGCGGTAGTAGGCTGTATAGTT 3 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTCTAGT 7 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTTC 6 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTTA 218 4
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTTG 20 4
mmu-let-7a-2_precursor GAGGGAGTAGGTTGTATAGTT 31 2
mmu-let-7a-2_precursor TAGGTAGTANGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTGTAGTT 2 3
mmu-let-7a-2_precursor TGAGNTAGTAGATTGTATAGTTTA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGCAGTT 3 6
mmu-let-7a-2_precursor GAGGTATTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TNGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor TGAGGTAGGATGTTGTATAGTTT 23 3
mmu-let-7a-2_precursor TGTGACTGCATGTTCCCAGGT 3 1
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGT 583 3
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTTTA 7 1
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTAT 7 6
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATTGT 3 5
mmu-let-7a-2_precursor TGAGGTCGNAGGTTGTATAGT 2 3
mmu-let-7a-2_precursor TGAGGCCGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTTT 38 2
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTTC 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTCTAG 2 2
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTTA 63 4
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTTG 5 4
mmu-let-7a-2_precursor GAGGTAGTAGGTTNTATAGTTT 5 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTNTATAGTTA 10 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTGA 4 2
mmu-let-7a-2_precursor TGAAGTAGTAGGTTGTATAGTT 195 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTGG 17 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTGC 61 4
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTAA 81 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTAG 19 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTAT 30 9
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAAGA 2 42
mmu-let-7a-2_precursor GTNGTAGGTTGTATAGTT 8 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTT 625 1
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTA 5 1
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTATAGTTG 4 4
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTATAGTTC 3 2
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTATAGTTA 25 2
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTATAGTTT 19 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-2_precursor TGAGGTAGTANCTTGTATAGTT 949 4
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTTT 167 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTTG 37 4
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTTA 207 3
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTTC 5 2
mmu-let-7a-2_precursor TGGGTAGTAGGTTGTATAGTT 24 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGTT 519 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGTC 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGGATAGT 6 2
mmu-let-7a-2_precursor TGNGTTAGTAGGTTGTATAGT 5 3
mmu-let-7a-2_precursor AGTAGTAGGTTGTATAGT 2 5
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTTAA 31 1
mmu-let-7a-2_precursor GGTNGTAGGTTGTATAGT 4 2
mmu-let-7a-2_precursor NGTAGTAGGTTGTATAGTT 15 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGCT 3 2
mmu-let-7a-2_precursor TGNGGGAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGGGGCAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TAGNAGGTTGTATAGTTA 3 16
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGT 164 2
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGA 3 7
mmu-let-7a-2_precursor TGAGNTAGTCGGTTGTATAGT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATA 2 5
mmu-let-7a-2_precursor GGTAGTAGATTGTATAGTTAA 2 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAAAGTTA 7 4
mmu-let-7a-2_precursor GAGGTAGTAGGTNGTATAGA 3 3
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTT 5327 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTG 3 2
mmu-let-7a-2_precursor TGAGATAGTAGGTTGTATAGT 10 2
mmu-let-7a-2_precursor GAGGTAGTAGGGTGTATAGTT 9 2
mmu-let-7a-2_precursor CTGAGGTAGTAGGTTGTATAGTT 35 3
mmu-let-7a-2_precursor AGTAGGTTGTATAGT 61 9
mmu-let-7a-2_precursor GGTAGTAGGTTGGATAGTT 3 3
mmu-let-7a-2_precursor TGAGGAGGTAGGTTGTATAGTT 9 4
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTACAGTT 3 3
mmu-let-7a-2_precursor TTNAGGTAGTAGGTTGTATAGT 3 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTTTA 2 1
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGTATAGTTAA 2 1
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTGA 8 2
mmu-let-7a-2_precursor TGTGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-2_precursor TTGNGGTAGTAGGTTGTATAGTT 9 1
mmu-let-7a-2_precursor TGAGGAGGTAGGTTGTATAGT 4 5
mmu-let-7a-2_precursor TGTGGTAGTAGGTTGTATAGTT 131 2
mmu-let-7a-2_precursor TTANGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGTATAGTTG 5 4
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGTATAGTTA 20 2
mmu-let-7a-2_precursor TGAGGTAATAGGTTGTATAG 2 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTTA 10 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATA 30 2
mmu-let-7a-2_precursor GGAAGTAGGTTGTATAGTT 8 4
mmu-let-7a-2_precursor TGGGTAGTAGGTTGTATAGT 9 7
mmu-let-7a-2_precursor TGAGNTATTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTATGTTGTATAGTT 56 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATTGT 7 6
mmu-let-7a-2_precursor TGAGGTTGTAGGTTGTATAGTT 35 2
mmu-let-7a-2_precursor CAGGTAGTAGGTTGTATAGTT 31 2
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGTTT 12 3
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGA 11 2
mmu-let-7a-2_precursor TGTAGTAGGTTGTATAG 6 20
mmu-let-7a-2_precursor NAGGTAGTAGGTTGTATAGTTA 4 3
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTTA 51 1
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTTG 8 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTTC 4 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTTAG 2 1
mmu-let-7a-2_precursor TGAGGTACTAGGTTGTATAGT 32 2
mmu-let-7a-2_precursor GAGGGAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor GAANTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTNGTATAGTTT 50 3
mmu-let-7a-2_precursor TNAGGTAGTAGGTTG 28 14
mmu-let-7a-2_precursor GAGGTAGTAGGTGGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTT 4591 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATCGT 3 4
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGAT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTGAC 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATCGTT 2 4
mmu-let-7a-2_precursor GNTAGTAGGTTGTATAGT 55 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTT 2026 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTA 12 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGAATAGT 26 3
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGTT 212 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTATCGTT 11 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTTTAG 2 2
mmu-let-7a-2_precursor TGAGNTAGTCGGTTGTATAGTT 31 2
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTAT 3 7
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGTTT 80 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGTTG 15 4
mmu-let-7a-2_precursor TGAGGTATTAGGTTGNATAGTT 4 2
mmu-let-7a-2_precursor TAGGTAGTAGNTTGTATAGTT 2 4
mmu-let-7a-2_precursor TNGAGGTAGTAGGTTGTATAGT 14 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTCTCGTT 2 6
mmu-let-7a-2_precursor GTAGTAGGTTGTNTAGTT 5 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTAAG 2 1
mmu-let-7a-2_precursor TGAGGCAGNAGGTTGTATAGTT 9 4
mmu-let-7a-2_precursor GGTAGTAGGTTGTNTAGTT 21 2
mmu-let-7a-2_precursor GGGGTAGTAGGTTGTATAGT 12 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGTTAA 7 1
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGCATAGTT 2 3
mmu-let-7a-2_precursor TGTAGTAGGTTGTATAGTT 96 3
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGTATTGTT 2 8
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAG 130 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAA 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTGTAGTT 2 5
mmu-let-7a-2_precursor GAGGGAGTAGGTTGTATAGTTAA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAGTTT 26 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAGTTA 43 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAGTTG 6 5
mmu-let-7a-2_precursor GTAGTAGGTNGTATAGTTA 2 6
mmu-let-7a-2_precursor GTAGTAGGTTGTATTGTT 2 15
mmu-let-7a-2_precursor GAGGTAGTAGGCTGTCTAGTT 2 3
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGCATAGTT 2 6
mmu-let-7a-2_precursor TAGTAGGTTGTATAGTA 4 17
mmu-let-7a-2_precursor TGAGGCAGTANGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGCT 2 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAGAGT 6 2
mmu-let-7a-2_precursor GAGGCAGTAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGT 288 2
mmu-let-7a-2_precursor GNAGTAGGTTGTATAGTTAA 2 2
mmu-let-7a-2_precursor GAGGTAGTAGNCTGTATAGTT 12 4
mmu-let-7a-2_precursor GGGNGTAGGTTGTATAGTT 12 6
mmu-let-7a-2_precursor GAGGNAGTCGGTTGTATAGT 3 2
mmu-let-7a-2_precursor TGTNGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor GATAGTAGGTTGTATAGTT 8 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTA 3541 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTC 165 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTG 183 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTN 18 2
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATTGTT 5 8
mmu-let-7a-2_precursor TGAGGTAGNAGGTTGTATAGTTC 27 3
mmu-let-7a-2_precursor GTAGNAGGTTGTATAGTT 7 3
mmu-let-7a-2_precursor TGTGGTAGTAGGTTGTATAG 6 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTGA 13 2
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGTATAGTTT 16 2
mmu-let-7a-2_precursor GGTCGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TTAGGTAGTAGGGTGTATAGTT 2 2
mmu-let-7a-2_precursor TTGGGGTAGTAGGTTGTATAGT 2 1
mmu-let-7a-2_precursor GANGTAGTAGGTTGTATAGTTAA 2 1
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTAT 34 4
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTAA 2 26
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTGTAGT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAAGTTGTATAGT 3 3
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAG 31 2
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATAGTTAAGA 2 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAA 2 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAG 261 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTNTAGTTT 9 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTNTAGTTA 8 2
mmu-let-7a-2_precursor TNGGGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-2_precursor TGANGTAGGAGGTTGTATAGTTTA 3 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTTTATAGTTA 3 3
mmu-let-7a-2_precursor TGCGGTAGTAGGTTG 6 34
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTAT 6 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTAA 25 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTAG 4 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGT 56 3
mmu-let-7a-2_precursor TAGTAGGTTNTATAGTT 7 4
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGTTTA 2 1
mmu-let-7a-2_precursor GGTAGTAGGTTGAATAGTT 3 3
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATTGTT 5 6
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTTTTGTT 4 9
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTTA 5 1
mmu-let-7a-2_precursor TCCGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATTGTT 11 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTAT 7 8
mmu-let-7a-2_precursor ATGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGTTA 46 2
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGTTC 3 2
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGTTG 5 4
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGTTT 22 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTACAGTT 73 3
mmu-let-7a-2_precursor GAGGTAGGAGGTTGTCTAGTTT 2 4
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGCATAG 8 4
mmu-let-7a-2_precursor TGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor TNAGGTATTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTTG 2 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATA 7 4
mmu-let-7a-2_precursor TAGTAGGTTGTATAGNT 5 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTA 602 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTG 72 4
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTC 15 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTT 383 2
mmu-let-7a-2_precursor GTAGTAGGTTGTAT 4 20
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTT 363 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTA 572 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTC 10 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTG 57 4
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATTGTTT 2 4
mmu-let-7a-2_precursor TGAGGCAGTAGGCTGTATAGTT 2 2
mmu-let-7a-2_precursor GATAGTAGGTTGTATAGT 2 4
mmu-let-7a-2_precursor TNAGGTATTAGGTTGTATAGT 3 3
mmu-let-7a-2_precursor TGAGGAAGNAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTACGTTGTATAGTTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTACGTTGTATAGTTA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGGTT 5 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGGTA 5 3
mmu-let-7a-2_precursor TGAGGTAATAGGTTGTATAGT 12 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGTTAA 14 1
mmu-let-7a-2_precursor GGGAGTAGGTTGTATAGT 8 7
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTTA 37 4
mmu-let-7a-2_precursor TGAGGGTGTAGGTTGTATAGT 2 4
mmu-let-7a-2_precursor TNAGGTAGCAGGTTGTATAGT 3 4
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTTAA 52 1
mmu-let-7a-2_precursor NAGGTAGTAGGTTGTATAG 2 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATCGTT 4 4
mmu-let-7a-2_precursor TGGGGTAGGAGGTTGTATAGTTTA 2 3
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATTGTT 5 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGTTAA 6 1
mmu-let-7a-2_precursor TGAGNTAGGAGGTTGTATAGTTT 36 3
mmu-let-7a-2_precursor GAGGGAGTAGGTTGTATAGT 5 3
mmu-let-7a-2_precursor GAGGGAGTAGGTTGTATAGG 2 9
mmu-let-7a-2_precursor TGAGGTAGTANCTTGTATAG 17 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTAT 30 4
mmu-let-7a-2_precursor GTAGTAGGTTGTATAG 12 2
mmu-let-7a-2_precursor TGCGGTGGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTTTAGTT 3 2
mmu-let-7a-2_precursor GTAGTAGGTTGTAAAGTT 2 7
mmu-let-7a-2_precursor TGAGGTATGAGGTTGTATAGTTT 4 3
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTGTAGTTT 3 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTGTAGTT 2 3
mmu-let-7a-2_precursor NGATGTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TGANGTAGTAGATTGTATAGTTTA 4 2
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGTTG 6 5
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGTTC 2 3
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGTTA 27 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATTGTT 7 5
mmu-let-7a-2_precursor TAGTAGGTTGTATAGTT 552 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTTGA 3 4
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTNTAG 2 2
mmu-let-7a-2_precursor TGNGGTAGTGGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATATT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTTGA 7 2
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGNATAGTT 2 2
mmu-let-7a-2_precursor GTAGGTTGTATAGTT 6011 7
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGTTGA 4 2
mmu-let-7a-2_precursor ANGTAGTAGGTTGTATAGTTA 2 4
mmu-let-7a-2_precursor GAGGGAGTAGGTTNTATAGTT 2 2
mmu-let-7a-2_precursor NAGGTAGTAGGTTGTATAGTTT 4 2
mmu-let-7a-2_precursor GGTAGTCGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGA 12 2
mmu-let-7a-2_precursor TAGGTAGTAGGGTGTATAGTT 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGT 55 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTAA 75 1
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGAATAGTT 5 8
mmu-let-7a-2_precursor TGCGGAAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor GAGGTAGTAGCTTGTATAGTT 3 4
mmu-let-7a-2_precursor TGAGGTGGTAGGCTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTCGTCGGTTGTATAGTT 6 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATTGTT 15 5
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTTTA 5 1
mmu-let-7a-2_precursor TGANGTAGTAGGTTG 10 15
mmu-let-7a-2_precursor GAGGTAGTAGGTTGCATAGTTAA 19 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGT 220 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGA 3 5
mmu-let-7a-2_precursor GAGGTAGTAGGTCGTATAGTT 22 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATATTT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAGT 64 3
mmu-let-7a-2_precursor TGAGGTAGGANGTTGTATAGTTT 3 3
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTAA 53 1
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGT 234 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGA 3 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATA 2 4
mmu-let-7a-2_precursor TGAGGTAGTACGTTGTATAG 5 2
mmu-let-7a-2_precursor CTGAGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor TTAGGTAGTAGGCTGTATAGTT 3 2
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAGT 111 3
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAGG 2 10
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTTT 58 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTTC 11 4
mmu-let-7a-2_precursor GAGNTAGTAGGTTGTATAG 3 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGAATAGTT 2 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTT 1858 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTA 2899 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTC 83 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTG 318 4
mmu-let-7a-2_precursor AGGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-2_precursor GCGGTAGTAGGTTGTATAGT 5 2
mmu-let-7a-2_precursor TAGGTTGTAGGTTGTATAGTT 5 3
mmu-let-7a-2_precursor TGAGGTCGGAGGTTGTATAGTTT 3 4
mmu-let-7a-2_precursor TGGTAGTAGGTTGTATAGTT 70 2
mmu-let-7a-2_precursor TGCGGTAGGAGGTTGTATAGTTT 38 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTGTAGT 2 3
mmu-let-7a-2_precursor TGAGGTATTAGGTTGTATAGTTT 12 2
mmu-let-7a-2_precursor TGAGGTATTAGGTTGTATAGTTG 8 4
mmu-let-7a-2_precursor TGAGGTATTAGGTTGTATAGTTA 17 2
mmu-let-7a-2_precursor GGGCGTAGGTTGTATAGTT 4 11
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTA 8 44
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATTGT 2 5
mmu-let-7a-2_precursor CGAGGTAGTAGGTTGTATAGTTT 23 2
mmu-let-7a-2_precursor CGAGGTAGTAGGTTGTATAGTTA 31 2
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGTTAA 13 1
mmu-let-7a-2_precursor GAGGTAGTANGTTGTATAGT 9 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNAT 38 4
mmu-let-7a-2_precursor AGGGAGTAGGTTGTATAGTT 11 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTTGA 5 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTGT 41 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTGC 7 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTGA 137 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAA 60 16
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTGA 10 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTAAA 12 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTAAT 2 2
mmu-let-7a-2_precursor GAGGTTGTAGGTTGTATAGTT 36 2
mmu-let-7a-2_precursor TGAGGCAGTAGATTGTATAGTTTA 2 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGCATAGTT 11 4
mmu-let-7a-2_precursor GANGTAGTAGGTTGTATAG 4 2
mmu-let-7a-2_precursor TGTAGGAGGTTGTATAGTTT 8 21
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATA 2 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTTAA 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATTGT 2 9
mmu-let-7a-2_precursor TGAGATAGTAGGTTGTATAGTTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAG 43 3
mmu-let-7a-2_precursor GGTAGTAGGTTGNATAGT 7 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATNGTTA 2 4
mmu-let-7a-2_precursor TNAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor AGGAGGTTGTATAGTTT 2 21
mmu-let-7a-2_precursor GGTAGTAGGTTGTTTAGT 5 3
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGTTAA 19 1
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGGATAGTT 2 5
mmu-let-7a-2_precursor TTGCGGTAGTAGGTTGTATAGTT 11 1
mmu-let-7a-2_precursor TGAGGTAGTAGGNTG 9 22
mmu-let-7a-2_precursor AGGGAGTAGGTTGTATAGT 3 6
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTA 4 7
mmu-let-7a-2_precursor GNTAGTAGGTTGTATAGTTT 3 2
mmu-let-7a-2_precursor GNTAGTAGGTTGTATAGTTA 6 5
mmu-let-7a-2_precursor GNTAGTAGGTTGTATAGTTG 2 4
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAG 7 4
mmu-let-7a-2_precursor TGAGGAAGGAGGTTGTATAGTTT 9 3
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTGTAGTT 3 3
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGTATAG 4 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTAAA 5 1
mmu-let-7a-2_precursor GAGGTAGTAGGGTGTCTAGTT 5 5
mmu-let-7a-2_precursor GAGGNAGTAGGTTGTATAGTT 8 2
mmu-let-7a-2_precursor GGGGTAGTAGGTTGTATAG 3 2
mmu-let-7a-2_precursor TGAGNTAGTCGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTTTAGTT 17 3
mmu-let-7a-2_precursor TGAGGTAGTACGTNGTATAGTT 2 2
mmu-let-7a-2_precursor NGAGGTAGTAGTTTGTATAGTT 5 5
mmu-let-7a-2_precursor TTAGGTAGTAGGNTGTATAGTT 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTT 780 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTA 6 2
mmu-let-7a-2_precursor NTAGGTTGTATAGTT 21 21
mmu-let-7a-2_precursor TGCGGTAGTAGGCTGTATAGT 2 3
mmu-let-7a-2_precursor GTAGTAGGTNGTATAGTT 8 2
mmu-let-7a-2_precursor GNTAGTAGGTTGTATAGTT 142 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAGTTAA 5 1
mmu-let-7a-2_precursor TAGTAGGTTGTATTGTT 6 44
mmu-let-7a-2_precursor GAGGTAGGAGGTTGTATAGTTT 78 3
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-2_precursor TGGGAGTAGGTTGTATAGTT 3 13
mmu-let-7a-2_precursor TAGTAGGTTGTATAGT 84 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTCA 6 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTCG 7 2
mmu-let-7a-2_precursor GAGGTAGTAGGTCGTATAGTTA 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATACTA 2 3
mmu-let-7a-2_precursor TGCTGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAAAGT 8 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAAAGA 3 4
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATA 14 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAG 12 3
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATA 7 3
mmu-let-7a-2_precursor GCTAGTAGGTTGTATAGTT 6 2
mmu-let-7a-2_precursor TGATGTAGTAGGNTGTATAGTT 2 2
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGTTG 13 4
mmu-let-7a-2_precursor GGTAGTAGGTTGTATCGT 2 5
mmu-let-7a-2_precursor TNAGGTAGTAGGTTATATAGTTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTGTA 2 7
mmu-let-7a-2_precursor GAGGTAGTAGGTCGTATAGT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTTTA 2 1
mmu-let-7a-2_precursor GGTAGTTGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTA 37 2
mmu-let-7a-2_precursor GAGGTAGTANGTTGTATAG 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTCTAGTT 32 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTTGA 9 2
mmu-let-7a-2_precursor TGAGGTATTAGGTTGTAT 3 6
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTA 10 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGTT 913 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGTA 4 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTA 6 4
mmu-let-7a-2_precursor TGANGTAGTAGGTTGT 4 8
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTA 2 14
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATATTT 4 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGAATAGTTT 2 5
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGTTA 38 2
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGTTC 4 2
mmu-let-7a-2_precursor TGATGTAGGAGGTTGTATAGTTT 33 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTAT 4 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTTTA 3 1
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGTT 1082 2
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGTA 8 2
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAGTTTA 3 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-2_precursor GAGGTAGGAGGTTGTATAGTAT 2 5
mmu-let-7a-2_precursor TAAGTAGTAGGTTGTATAGTT 3 4
mmu-let-7a-2_precursor TTAGGTAGTAGGTGGTATAGTT 2 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGAATAGTTT 12 2
mmu-let-7a-2_precursor GAGGTAGTAGATTGTATAGTTTA 5 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATATTT 4 2
mmu-let-7a-2_precursor TTAGGTAGTAGTTTGTATAGTT 2 7
mmu-let-7a-2_precursor TNAGGTAGTAGGTCGTATAGTT 3 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTATTGTT 9 9
mmu-let-7a-2_precursor TGAGGTAGTAAGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGNTGTATAGTT 2 1
mmu-let-7a-2_precursor TNGTAGGTTGTATAGTT 25 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTCTATAG 8 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7a-2_precursor NAGTAGGTTGTATAGTT 5 3
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATCGTT 3 4
mmu-let-7a-2_precursor TGAGTTAGTAGGTNGTATAGT 4 2
mmu-let-7a-2_precursor TTGAGGTAGTAGNTTGTATAGT 2 1
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTGA 12 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTTAA 14 1
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTA 14 5
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGT 34 2
mmu-let-7a-2_precursor GAGGTAGTAGGATGTCTAGTT 3 4
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGA 5 2
mmu-let-7a-2_precursor TGAGGCAGTAGGNTGTATAGTT 2 2
mmu-let-7a-2_precursor GTAGTAGTTTGTATAGTTT 2 11
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTTAG 3 1
mmu-let-7a-2_precursor GGAGGTAGTAGGTTGTATAGTT 38 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGCATAGTT 191 3
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGCATAGTT 5 4
mmu-let-7a-2_precursor TGCTGTAGTAGGTTGTATAGT 3 5
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTATAG 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGATTGNATAGTTTA 3 2
mmu-let-7a-2_precursor GTTGAGGTAGTAGG 3 11
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGTTTA 3 1
mmu-let-7a-2_precursor TGGGGTGGTAGGTTGTATAGTT 4 5
mmu-let-7a-2_precursor TTCGGTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAG 8 3
mmu-let-7a-2_precursor AGNTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATANTT 8 2
mmu-let-7a-2_precursor GAGGTAGTAGATTGTATAGTTAAG 2 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGT 295 1
mmu-let-7a-2_precursor TAGTAGGTTGTATAGTTAA 10 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATTGTTT 4 4
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATA 2 3
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATA 6 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGAATAGTT 18 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTTA 611 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTTG 51 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTTC 17 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTTT 380 2
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGT 53 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTTTA 5 1
mmu-let-7a-2_precursor CGAGGTAGTAGGTTGTATAGTTAA 3 1
mmu-let-7a-2_precursor TTAGTAGGTTGTATAGTT 2 5
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGTTC 5 2
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGTTA 119 2
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGTTG 20 4
mmu-let-7a-2_precursor TGAGGTAGTTGGTTGTATAGTTAA 2 1
mmu-let-7a-2_precursor TGAGGTAGCAGGTTGTATAGTTA 18 4
mmu-let-7a-2_precursor TGAGGTAGCAGGTTGTATAGTTT 13 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTCTATAGTT 70 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTCTATAGTA 2 2
mmu-let-7a-2_precursor TNAGGTAGAAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TGAGGTATTNGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTAA 73 1
mmu-let-7a-2_precursor TGAGGTAGTGGGTTGTAT 2 10
mmu-let-7a-2_precursor TGCGTTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TGGGGTCGTAGGTTGTATAGTT 13 2
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGCATAGTT 3 3
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTATAGT 30 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAGTTC 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTT 4433 2
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGTTAA 14 1
mmu-let-7a-2_precursor TGGCGTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-2_precursor GAGGTAGTAGNTTGTATAGT 2 4
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTTG 23 4
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTTA 87 3
mmu-let-7a-2_precursor TGAGGTAGTANGTTG 4 19
mmu-let-7a-2_precursor AGTAGGTTGTATNGTT 11 11
mmu-let-7a-2_precursor GTAGGTTGTATAGTTN 55 7
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAG 59 2
mmu-let-7a-2_precursor TGTGGTAGTAGGTTGTATAGTTAA 4 1
mmu-let-7a-2_precursor CGAGGGAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGN 16 10
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGT 817 8
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTGTAGTTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAAAT 4 15
mmu-let-7a-2_precursor TNAGGTATTAGGTTGTATAGTT 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGTTT 32 2
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGTTG 2 5
mmu-let-7a-2_precursor TCAGGTAGGAGGTTGTATAGTTT 8 3
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTAT 6 15
mmu-let-7a-2_precursor TGAGGGAGTAGGCTGTATAGTT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAAT 2 4
mmu-let-7a-2_precursor TGAAGTAGTAGGTTGTATAGTTAA 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTATATAGTTG 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTATATAGTTA 10 2
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTAT 9 6
mmu-let-7a-2_precursor TGNGGTGGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor GAGGTACTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGCAGGTTGTATAG 3 3
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-2_precursor TGAGGTGGTGGGTTGTATAGTT 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGT 98 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGA 3 4
mmu-let-7a-2_precursor AGTAGGTTGTATAGTTG 4 19
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAG 24 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGAA 87 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTATATAGT 2 2
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGAATAGTT 2 3
mmu-let-7a-2_precursor TGATGTAGTAGGTTGNATAGT 3 2
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGTATAGTT 186 2
mmu-let-7a-2_precursor GTAGGTTGTATAGTTTAGA 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTT 4864 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTG 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTA 35 2
mmu-let-7a-2_precursor GTTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAG 29 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTN 21 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTC 2097 2
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAG 49 4
mmu-let-7a-2_precursor AGNAGGTTGTATAGTT 4 4
mmu-let-7a-2_precursor TGAGGTAGCNGGTTGTATAGT 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTTA 13 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTC 26 2
mmu-let-7a-2_precursor NGAAGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TAGGTAGTAGGTTTTATAGTT 3 12
mmu-let-7a-2_precursor GAGGTAGTCGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAA 7592 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAC 55 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAG 2174 2
mmu-let-7a-2_precursor TTGGTAGTAGGTTGTATAGTT 2 4
mmu-let-7a-2_precursor GTAGTAGGTTNTATAGTT 2 2
mmu-let-7a-2_precursor TGCGGTAGTAGGGTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTAAG 2 1
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGA 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGA 10 5
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAA 3 9
mmu-let-7a-2_precursor GAGGTAGGAGGTTGTATAGTTTAA 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAATTA 20 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAATTT 10 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTA 3 15
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGGT 42 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGGA 3 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGC 2 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGG 13 2
mmu-let-7a-2_precursor AGGTAGTAGATTGTATAGTTAA 2 4
mmu-let-7a-2_precursor TGACGTAGGAGGTTGTATAGTTT 15 3
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTGA 12 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTGGTATAGTTT 12 3
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGTTTA 2 1
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTCTAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACTGTT 4 7
mmu-let-7a-2_precursor TGAGNTAGTAGGTTTTATAGTT 2 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTTTT 2 2
mmu-let-7a-2_precursor GTAGNTTGTATAGTTT 4 8
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-2_precursor TANGTAGTAGGTTGTATAGT 4 3
mmu-let-7a-2_precursor TGATGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor CTGTACAGCCTCCTAGCTTTCCA 2 1
mmu-let-7a-2_precursor GAGGTCGTAGGTTGTATAGTTA 3 3
mmu-let-7a-2_precursor GAGGTCGTAGGTTGTATAGTTG 2 4
mmu-let-7a-2_precursor TAGGTAGTANGTTGTATAGT 2 3
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTTTTT 3 2
mmu-let-7a-2_precursor GGNAGTAGGTTGTATAGT 13 4
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGT 1017 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGT 130 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGA 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTGTAGTT 2 3
mmu-let-7a-2_precursor NGAGTTAGTAGGTTGTATAGT 3 2
mmu-let-7a-2_precursor TGAGGTAGAAGGTTGTATAGTTA 6 3
mmu-let-7a-2_precursor GTAGTCGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor CAGGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-2_precursor TGATGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAGTT 444 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCATAGTA 5 4
mmu-let-7a-2_precursor TNAGGTAGTAGGTTTTATAGTT 5 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTCTG 9 4
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGTTT 23 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGAATAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGT 44 3
mmu-let-7a-2_precursor AGTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor TGNGGTAGTAGGTTATATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAAC 62 1
mmu-let-7a-2_precursor TGAGGGAGTAGGGTGTATAGTT 6 3
mmu-let-7a-2_precursor TGAGGGCGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTACAGT 12 3
mmu-let-7a-2_precursor GAGGTAGTAGGATGTATAGT 6 3
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGCATAGTT 4 5
mmu-let-7a-2_precursor TGAGGTAGTCGCTTGTATAGTT 2 5
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGTTT 81 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTTAA 45 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTG 14 26
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTAT 4 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTNGTATAGTT 7 2
mmu-let-7a-2_precursor TGAGNTAGCAGGTTGTATAGTT 10 3
mmu-let-7a-2_precursor TGACGTAGTAGATTGTATAGTTTA 3 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-2_precursor TGAGGTCGNAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor CTGAGGTAGTAGGTTGTATAGTTAA 3 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGT 379 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGA 8 2
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGAATAGTT 9 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATATTTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTA 9 6
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGT 37 3
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGA 3 4
mmu-let-7a-2_precursor TAGTATGTTGTATAGTT 4 38
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTAT 11 5
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATATTT 2 7
mmu-let-7a-2_precursor TTGGGGTAGTAGGTTGTATAGTT 4 1
mmu-let-7a-2_precursor NGAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGCAT 3 8
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAG 50 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGT 564 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGA 12 3
mmu-let-7a-2_precursor TGAGCTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGGATAGTT 34 2
mmu-let-7a-2_precursor GCTAGTAGGTTGTATAGTTA 2 8
mmu-let-7a-2_precursor TGAGGGGGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor CGAGGTAGTAGGTTGTATAGTT 288 2
mmu-let-7a-2_precursor CGAGGTAGTAGGTTGTATAGTA 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTTTATAG 8 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATA 5 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATA 2 1
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATT 2 2
mmu-let-7a-2_precursor TGGGGGAGTAGGTTGTATAGTT 8 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATA 4 5
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTAG 2 17
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATTGTT 6 5
mmu-let-7a-2_precursor TGAGCTAGTAGGTTGTATAGTTAA 2 1
mmu-let-7a-2_precursor GAGGTAGCAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAGTTT 64 4
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAGTTA 131 5
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAGTTC 8 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATACTTAA 4 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTCTATAGT 2 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAA 4 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAG 667 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAATAGTTTA 2 1
mmu-let-7a-2_precursor GGAGTAGGTTGTATAGTTT 2 3
mmu-let-7a-2_precursor TGCGGTAGGAGGTTGTATAGTTTA 3 2
mmu-let-7a-2_precursor GGGAGTAGGTTGTATCGTT 2 14
mmu-let-7a-2_precursor TGAGGTATTAGGTTGTATAG 8 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAG 53 3
mmu-let-7a-2_precursor GTCGGTTGTATAGTT 31 37
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTC 2 4
mmu-let-7a-2_precursor TGGNGTAGTAGGTTGTATA 4 6
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTT 400 2
mmu-let-7a-2_precursor GCGGTAGTAGGTTGTATAGTT 40 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAAT 79 1
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTAA 2 1
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGAATAG 7 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTAA 175 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTAG 52 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTAT 61 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTG 14 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTC 2 16
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTA 13 15
mmu-let-7a-2_precursor TGAGGTAGTGGGNTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTT 711 23
mmu-let-7a-2_precursor TGACTTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TTGAGGTAGTAGNTTGTATAGTT 8 1
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGCATAGTTT 16 3
mmu-let-7a-2_precursor GAGATAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTTTATAGTTT 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTTTATAGTTA 12 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTTTATAGTTG 4 4
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTTTAT 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATA 8 2
mmu-let-7a-2_precursor TATGTAGTAGGTTGTATAGTT 5 6
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGNATAGTTTA 3 2
mmu-let-7a-2_precursor TGAGGTACTAGGTTGTAT 2 10
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAATAG 6 2
mmu-let-7a-2_precursor TGATGCAGTAGGTTGTATAGTT 4 3
mmu-let-7a-2_precursor TGAGTTAGGAGGTTGTATAGTTT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTT 1035 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTA 4 2
mmu-let-7a-2_precursor TTGAGGTAGTAGATTGTATAGTT 4 3
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGT 290 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGA 2 2
mmu-let-7a-2_precursor GGNAGTAGGTTGTATAGTT 20 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTT 4543 17
mmu-let-7a-2_precursor TGAGGTAGNACGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TCTGAGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTATC 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTATA 2 1
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTAAA 2 10
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTATG 2 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTTAA 26 1
mmu-let-7a-2_precursor TGGAGGTAGTAGGTTGTATAGT 3 1
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTC 3 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGTA 36 2
mmu-let-7a-2_precursor TNAGGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTT 442 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTC 4 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTA 5 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTANAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTC 2 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGA 10 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTTT 14 15
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAATAGTT 154 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTTG 2 1
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTTT 55 1
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTTA 44 1
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTT 1701 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTA 8 2
mmu-let-7a-2_precursor AGGTNGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCG 5 4
mmu-let-7a-2_precursor TGAGGTAGGAGCTTGTATAGTTT 10 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATATTT 2 2
mmu-let-7a-2_precursor CGAGGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-2_precursor TGNGGTACTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATTGTT 7 5
mmu-let-7a-2_precursor TNAGGTAGCAGGTTGTATAGTT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGTTAAGA 2 1
mmu-let-7a-2_precursor TAGTAGGTTGTATAGNTA 2 17
mmu-let-7a-2_precursor TCAGCTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGCAGGTTGTATAGT 27 3
mmu-let-7a-2_precursor GAGGTAGAAGGTTGTATAGTT 4 3
mmu-let-7a-2_precursor TNAGATAGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TTAGGGAGTAGGTTGTATAGTT 7 2
mmu-let-7a-2_precursor GAGCTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-2_precursor TGNTGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-2_precursor NGACGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTA 52 4
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTAT 5 2
mmu-let-7a-2_precursor TGTGGTAGTAGGTTGTATAGT 20 2
mmu-let-7a-2_precursor GTGGTAGTAGGTTGTATAGTT 7 2
mmu-let-7a-2_precursor TGAGGTATTAGGTTGTATAGTTAA 3 1
mmu-let-7a-2_precursor GAGGTAGTAGGTTNTATAGT 7 2
mmu-let-7a-2_precursor TGATTTAGTAGGTTGTATAGTTT 2 3
mmu-let-7a-2_precursor AGTAGGTTGTATAGTTC 2 17
mmu-let-7a-2_precursor TGAGGTAGTANCTTGTATAGT 170 4
mmu-let-7a-2_precursor TGAGCTAGTAGGTTGTATAGT 44 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTGTAGTTT 3 6
mmu-let-7a-2_precursor TAGGTAGGAGGTTGTATAGTTT 4 4
mmu-let-7a-2_precursor GTAGGTTGTATAGTTTA 2 1
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTAAG 2 1
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATTGTT 16 6
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTA 708 2
mmu-let-7a-2_precursor TGCNGTAGTAGGTTGTATAGT 31 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTCTAGTT 20 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTTGA 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAAGA 18 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAAGC 3 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAAGT 6 1
mmu-let-7a-2_precursor TGATTTAGTAGGTTGTATAGTT 8 4
mmu-let-7a-2_precursor NGAGGTAGGAGGTTGTATAGTTT 27 3
mmu-let-7a-2_precursor GAGGTTGTAGGTTGTATAG 4 4
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAG 23 5
mmu-let-7a-2_precursor TGCNGTAGTAGGTTGTATAGTT 223 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTGTA 2 6
mmu-let-7a-2_precursor GAGGTTGTAGGTTGTATAGTTT 8 2
mmu-let-7a-2_precursor GAGGTTGTAGGTTGTATAGTTA 6 2
mmu-let-7a-2_precursor TGAGGTTGTAGGTNGTATAGTT 2 2
mmu-let-7a-2_precursor TGCGGTGGTAGGTTGTATAGT 3 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATAGTTC 2 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATAGTTA 28 3
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATAGTTT 18 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATAGTTG 5 4
mmu-let-7a-2_precursor TGCGGTAGTCGGTTGTATAGTT 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTACAGTTTAG 8 2
mmu-let-7a-2_precursor GAGGTAGTAGNGTGTATAGT 2 6
mmu-let-7a-2_precursor TGAGGTAGAAGGTTGTATAGTTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTT 4713 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTA 22 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTG 2 2
mmu-let-7a-2_precursor CGAGGTAGTAGGTTGTAT 2 4
mmu-let-7a-2_precursor GGACGTAGGTTGTATAGTT 2 10
mmu-let-7a-2_precursor GAGNTAGTAGGTTGTATAGTTT 5 2
mmu-let-7a-2_precursor GAGNTAGTAGGTTGTATAGTTA 14 2
mmu-let-7a-2_precursor NGCGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor AGGTTGTATAGTTT 25 36
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTA 598 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTG 76 4
mmu-let-7a-2_precursor GGTTGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTAT 4 12
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGTTAA 22 1
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTTAT 6 2
mmu-let-7a-2_precursor TAGGTTGTATAGTTT 36 11
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTT 22179 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTA 132 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTC 6 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTG 4 2
mmu-let-7a-2_precursor GTAGTAGTTTGTATAGTT 3 18
mmu-let-7a-2_precursor TGAGGTAGGCGGTTGTATAGTTT 3 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTAAA 83 1
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATTGTT 7 5
mmu-let-7a-2_precursor TGAGGGATTAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTAT 2 5
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATTGTTT 6 5
mmu-let-7a-2_precursor GAGGTAGTAGGTAGTATAGTTT 2 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTC 9 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTG 86 4
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTT 477 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-2_precursor GAGGNAGTCGGTTGTATAGTT 8 2
mmu-let-7a-2_precursor TGAGGTAGTGGGTTGTATAGTT 186 2
mmu-let-7a-2_precursor TGCGGTCGTAGGTTGTATAGT 7 2
mmu-let-7a-2_precursor TGAGGTATTAGGTTGTATAGTT 263 2
mmu-let-7a-2_precursor GAGGTAGTAGNTTGTATAGTTA 2 4
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGA 20 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGT 767 2
mmu-let-7a-2_precursor TGAGGTACTAGGTTGTATAG 4 2
mmu-let-7a-2_precursor TGAGGTAGTAAGTTGTATTGTTTA 49 3
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATAGTTC 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGTTC 5 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATAGTTA 135 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTATATAGTTT 10 2
mmu-let-7a-2_precursor GAGGTAGTAGNATGTATAGTT 22 5
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTAT 27 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTT 860 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTC 2 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTA 6 7
mmu-let-7a-2_precursor TGNCGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTAT 2 2
mmu-let-7a-2_precursor TGGTAGTAGATTGTATAGTTTA 2 3
mmu-let-7a-2_precursor TNAGGTAGTAGGTTCTATAGTT 3 2
mmu-let-7a-2_precursor TGANGTAGGAGGTTGTATAGTTT 29 3
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTAA 8 21
mmu-let-7a-2_precursor TNTAGTAGGTTGTATAGT 4 26
mmu-let-7a-2_precursor TGAGGTAGTTGGTTGTATAGT 15 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATATTT 2 2
mmu-let-7a-2_precursor GGAGTAGGTTGTATAGTT 7 8
mmu-let-7a-2_precursor GAGGTAGTAGGTAGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTTAA 26 1
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTTTA 8 1
mmu-let-7a-2_precursor TAGTAGGTTGTATNGTT 4 6
mmu-let-7a-2_precursor GGTCNTAGGTTGTATAGTT 6 11
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTTT 200 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTTA 364 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTTC 7 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTCTAGTTA 6 2
mmu-let-7a-2_precursor TGAGGTAGGACGTTGTATAGTTT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGTTC 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGTTA 52 2
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGTTG 7 4
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGTTAA 5 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTTTAGTT 41 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTAT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGTTTAA 2 3
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTTG 34 4
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTTA 351 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTTT 206 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTCTATAGTT 16 2
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTCTAGTT 2 2
mmu-let-7a-2_precursor NGGTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTTTT 84 6
mmu-let-7a-2_precursor TGAGGGAGTCGGTTGTATAGTTT 2 2
mmu-let-7a-2_precursor TNAGTTAGTAGGTTGTATAGT 9 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTGTAG 2 3
mmu-let-7a-2_precursor CGAGGTAGTAGGTNGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTTGA 5 2
mmu-let-7a-2_precursor TNACGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGNTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor AGTAGGTTGTATAGTTT 32 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGT 3 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGCT 6 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAG 163 2
mmu-let-7a-2_precursor TGTNGTAGTAGGTTGTATAGTT 38 2
mmu-let-7a-2_precursor TGNGGTAGCAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGTT 182 3
mmu-let-7a-2_precursor TGGAGGTAGTAGGTTGTATAGTT 8 1
mmu-let-7a-2_precursor TGATGGAGTAGGTTGTATAGT 2 5
mmu-let-7a-2_precursor NGACGTAGTAGGTTGTATAGTT 8 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTT 1592 2
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTA 9 3
mmu-let-7a-2_precursor GAGGTAGTAGGCTGTATAGT 2 2
mmu-let-7a-2_precursor TGATGTAGTNGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor GGTAGTGGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTA 19 4
mmu-let-7a-2_precursor TGAGCTAGTNGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNA 9 5
mmu-let-7a-2_precursor TNAGCTAGTAGGTTGTATAGT 5 2
mmu-let-7a-2_precursor TGAGGCAGGAGGTTGTATAGTTT 10 6
mmu-let-7a-2_precursor GTAGTTGGTTGTATAGTTT 3 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAA 137 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAG 15206 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAT 123 3
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATACTTT 2 3
mmu-let-7a-2_precursor TGACGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAT 3400 4
mmu-let-7a-2_precursor TGAGGTAGGAGGTAGTATAGTTTA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTATATAGT 18 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGTA 5 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTT 1668 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAGG 5 1
mmu-let-7a-2_precursor TANTAGGTTGTATAGTT 4 3
mmu-let-7a-2_precursor TGAGNTAGTAGGTTG 3 23
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTGA 21 2
mmu-let-7a-2_precursor TGTAGTAGGTTGTATAGT 42 12
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATAGTTTA 2 1
mmu-let-7a-2_precursor GGTCGTAGGTTGTATAGT 3 4
mmu-let-7a-2_precursor TGAGTTAGTNGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGT 124 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATAG 6 2
mmu-let-7a-2_precursor GTGNTAGGTTGTATAGTT 2 11
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGCT 94 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGCC 4 2
mmu-let-7a-2_precursor GAGGTAGTAAGTTGTATAGT 2 3
mmu-let-7a-2_precursor TGAGGTAGTANGTTGT 2 12
mmu-let-7a-2_precursor TTAGGTAGTNGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTAT 5 11
mmu-let-7a-2_precursor TGAGGTAGGTGGTTGTATAGTTT 2 5
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGCATAGTTT 3 4
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTAT 19 5
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTAA 3 28
mmu-let-7a-2_precursor TGAGGGCGTAGGTTGTATAGT 4 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGGATAGTTA 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAATGT 4 14
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTCTAGTTT 16 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGCTGTATAGTT 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTG 681 10
mmu-let-7a-2_precursor TGGTAGTAGGTTGTATAGTTA 8 4
mmu-let-7a-2_precursor TNAGGTAGTAGATTGTATAGTTTA 14 2
mmu-let-7a-2_precursor GTCGTAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor AGTAGGTTGTATAGTT 516 3
mmu-let-7a-2_precursor AGTAGGTTGTATAGTN 4 9
mmu-let-7a-2_precursor NAAGGTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGTA 3 4
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGTT 378 2
mmu-let-7a-2_precursor TGGNGTAGTAGGTTGTATAG 36 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAG 6 4
mmu-let-7a-2_precursor TGNGGTAGGAGGTTGTATAGTTTA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAGAGTTA 2 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTCTAGT 25 2
mmu-let-7a-2_precursor CGAGGTAGTAGGTTGTATAGT 36 2
mmu-let-7a-2_precursor TGAGGGAGTCGGTTGTATAGTT 7 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAAAA 25 1
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGCATAGTT 17 3
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTAT 2 4
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATA 6 2
mmu-let-7a-2_precursor GGTGGTAGGTTGTATAGT 5 3
mmu-let-7a-2_precursor CGAGGTAGTAGGNTGTATAGTT 2 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTATATAGTT 14 2
mmu-let-7a-2_precursor GTGGTAGGTTGTATAGTT 2 5
mmu-let-7a-2_precursor CTAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGA 9 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGT 599 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAATAGT 18 2
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTNTAGT 3 3
mmu-let-7a-2_precursor GAGGTCGTAGGTTGTATAG 3 2
mmu-let-7a-2_precursor TNGAGGTAGTAGGTTGTATAGTTT 2 1
mmu-let-7a-2_precursor TGCNGTAGTAGGTTGTATAGTTT 20 2
mmu-let-7a-2_precursor TAGGAGGTTGTATAGTTTA 2 3
mmu-let-7a-2_precursor TTGAGGTAGNAGGTTGTATAGTT 9 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTA 70549 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAGTTG 37 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTTGA 3 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTAT 2 8
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTTC 3 2
mmu-let-7a-2_precursor TTAGGTAGTNGGTTGTATAGT 3 2
mmu-let-7a-2_precursor GNAGGTTGTATAGTTT 6 6
mmu-let-7a-2_precursor TGCGGTCGTAGGTTGTATAGTT 95 2
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAGGT 2 4
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTTGA 2 1
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATTGT 2 5
mmu-let-7a-2_precursor TGNGTTAGTAGGTTGTATAGTT 4 3
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTAT 113 5
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATCGT 2 4
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTTTAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAGTTGA 4 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTGTAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGTTT 59 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGTTA 64 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGTTG 6 5
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTA 4 12
mmu-let-7a-2_precursor GTAGTAGGTTGTANAGT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGATNGTATAGTTTA 4 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATTGT 7 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGTTT 44 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGTTA 39 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGTTG 8 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTTT 118 10
mmu-let-7a-2_precursor GGTAGTAGGTTGTATNGTT 34 4
mmu-let-7a-2_precursor TGAGGTAGNAGCTTGTATAGTT 4 5
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATATTT 7 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTCTATAGTTT 2 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTCTATAGTTA 2 2
mmu-let-7a-2_precursor TNATGTAGTAGGTTGTATAG 2 3
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGT 9 10
mmu-let-7a-2_precursor GAGGTAGTAGGTTGGATAGTT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGAAT 9 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATC 2 4
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTACAGTT 3 3
mmu-let-7a-2_precursor TNAGGTAGTGGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor NTAGGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor ATAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor GGTAGTAGGTTGTNTAGT 9 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAATT 99 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGCTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTGGGTTGTATAGTTG 2 4
mmu-let-7a-2_precursor TNAGTTAGTAGGTTGTATAGTT 18 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGA 2 6
mmu-let-7a-2_precursor TGTGGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7a-2_precursor GAGGTAGTAGGTNGTATAGT 8 2
mmu-let-7a-2_precursor TGCGGTCGTAGGTTGTATAGTTT 7 2
mmu-let-7a-2_precursor AGGTAGTAGGTTGTATAGT 100 2
mmu-let-7a-2_precursor NGAGGTAGTAGCTTGTATAGTT 8 4
mmu-let-7a-2_precursor GNAGTAGGTTGTATAGTTT 3 2
mmu-let-7a-2_precursor GGTAGTAGGNTGTATAGTTA 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTAT 7 9
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTTG 2 2
mmu-let-7a-2_precursor GTANGTTGTATAGTT 57 29
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGTATA 3 2
mmu-let-7a-2_precursor TGAGGTAGTANCTTGTATAGTTT 68 3
mmu-let-7a-2_precursor TGNGGTATTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TAGTAGGTTGTANAGTT 9 4
mmu-let-7a-2_precursor GAGGTAGTAGGTTTTATAGT 7 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTTA 13 1
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTTTG 2 2
mmu-let-7a-2_precursor TGAGGTACTAGGTTGTATAGTT 133 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGA 8 4
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTAT 4 2
mmu-let-7a-2_precursor TGGCGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTCTAGT 6 2
mmu-let-7a-2_precursor TGAGGTAGNAGGTTGTCTAGTT 10 3
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGT 3020 2
mmu-let-7a-2_precursor TGNGGTAGGAGGTTGTATAGTTTAG 2 2
mmu-let-7a-2_precursor CNAGGTAGTAGGTTGTATAGT 2 3
mmu-let-7a-2_precursor GAAGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGT 642 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGC 2 2
mmu-let-7a-2_precursor TGAGGGAGTGGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTA 10 18
mmu-let-7a-2_precursor TGTGGTAGTAGGTTGTATAGTTT 8 2
mmu-let-7a-2_precursor TGTGGTAGTAGGTTGTATAGTTA 17 2
mmu-let-7a-2_precursor GTNGGTTGTATAGT 2 45
mmu-let-7a-2_precursor TGATCTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor NGAGGTAGTAGGCTGTATAGTT 8 2
mmu-let-7a-2_precursor AGGTAGTAGNTTGTATAGTT 5 4
mmu-let-7a-2_precursor GGGGTAGTAGGTTGTATAGTTA 8 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGAT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTAT 2 5
mmu-let-7a-2_precursor TNATGTAGTAGGTTGTATAGT 8 3
mmu-let-7a-2_precursor TGAGTTAGTAGGNTGTATAGTT 5 2
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGTA 3 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAG 93 2
mmu-let-7a-2_precursor GTAGTAGGTTGTA 2 45
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATACT 55 2
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGGATAGTT 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTTT 181 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTTA 263 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTTG 36 4
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGTTC 5 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTAA 297 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAAA 73 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAAC 2 30
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTATTT 3 5
mmu-let-7a-2_precursor GAGGTTGTAGGTTGTATAGT 6 2
mmu-let-7a-2_precursor TGAGGTAGTAAGTTGTATAGTT 37 3
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGTA 4 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTA 17 5
mmu-let-7a-2_precursor CNAGGTAGTAGGTTGTATAGTT 8 2
mmu-let-7a-2_precursor TGAGGTAGTATGTTGTATAG 8 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGTT 1359 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGTA 11 3
mmu-let-7a-2_precursor GGAGGTAGTAGGTTGTATAGT 6 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGTTC 6 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGTTA 140 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGTTT 75 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGTTG 21 4
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTGTAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTA 36 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTG 3 2
mmu-let-7a-2_precursor GTAGGTTGTATAGTTT 200 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAAAG 7 2
mmu-let-7a-2_precursor TGTCGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGCATAGT 2 5
mmu-let-7a-2_precursor TGAGGTAGTANTTTGTATAGTTT 48 4
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTG 2 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTT 3490 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTA 21 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTAT 6 2
mmu-let-7a-2_precursor GAGGTAGTAGNATGTATAGT 2 6
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGAT 73 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGAG 3 3
mmu-let-7a-2_precursor GAGGTCGTAGGTTGTATAGT 7 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATATTTT 19 4
mmu-let-7a-2_precursor GCTAGTAGGTTGTATAGT 3 2
mmu-let-7a-2_precursor TGAGGTAGTANCTTGTAT 6 26
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTACAGTT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTATATAGTT 85 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTAA 56 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATA 6 6
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGTTTA 3 1
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGT 384 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATTG 2 6
mmu-let-7a-2_precursor TNGTAGTAGGTTGTATAGTT 6 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATAGTTTA 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTTC 5 5
mmu-let-7a-2_precursor TGACGTAGTAGTTTGTATAGTT 2 6
mmu-let-7a-2_precursor TGAGGTAGTAGATTTTATAGTTTA 2 2
mmu-let-7a-2_precursor TGATGTAGTAGGTNGTATAGTT 3 2
mmu-let-7a-2_precursor TGCGGTCGTAGGTTGTATAG 3 3
mmu-let-7a-2_precursor TGAGNTAGCAGGTTGTATAGT 2 3
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATTGTTT 2 4
mmu-let-7a-2_precursor TGGNGTAGTAGGTTGTAT 9 14
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTT 4244 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTA 19 4
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATATTT 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGTTA 51 2
mmu-let-7a-2_precursor TTGAGGTAGTAGNTTGTATAGTTA 2 1
mmu-let-7a-2_precursor GANGTAGTAGGTTGTATAGTTT 6 2
mmu-let-7a-2_precursor GCGGTAGTAGGTTGTATAG 2 2
mmu-let-7a-2_precursor TGCTAGTAGGTTGTATAGTT 10 9
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATA 1405 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATT 10 5
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTAAA 6 8
mmu-let-7a-2_precursor GTNGGTTGTATAGTTT 3 4
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATAGT 277 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATATTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGT 77330 2
mmu-let-7a-2_precursor TTAGNTAGTAGGTTGTATAGT 3 2
mmu-let-7a-2_precursor TGAGGTAATAGGTTGTATAGTTT 7 2
mmu-let-7a-2_precursor TGAGGTAATAGGTTGTATAGTTA 7 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTTTA 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTTTG 2 5
mmu-let-7a-2_precursor TAGCAGGTTGTATAGTT 3 13
mmu-let-7a-2_precursor AGTANGTTGTATAGTT 2 9
mmu-let-7a-2_precursor TGAGGTAGGAGGTCGTATAGTTT 7 3
mmu-let-7a-2_precursor TGAGGTAGTATGTTGTATAGT 3 2
mmu-let-7a-2_precursor GGTATTAGGTTGTATAGTT 6 3
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTATA 3 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTTAA 5 1
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTGA 51 2
mmu-let-7a-2_precursor GGTAGTAGGTNGTATAGTT 5 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGT 13 10
mmu-let-7a-2_precursor GAGGTAGTAGGTTNTATAGTT 55 2
mmu-let-7a-2_precursor TGAGGTAGCAGGTTGTATTGTT 4 7
mmu-let-7a-2_precursor GAGCTAGTAGGTTGTATAGT 5 2
mmu-let-7a-2_precursor GAGGTAGTAGGGTGTATAGTTT 2 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTA 12 6
mmu-let-7a-2_precursor TGAGGTGGTAGGTTGTATAGT 20 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTGTAGT 3 3
mmu-let-7a-2_precursor TGAGGTAGGAGGTAGTATAGTTT 17 3
mmu-let-7a-2_precursor AGGTAGTAGGTTGTATAGTTT 15 2
mmu-let-7a-2_precursor AGGTAGTAGGTTGTATAGTTA 18 3
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGTT 371 2
mmu-let-7a-2_precursor TGAGGTAGTCGGTTGTATAGTA 8 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTG 8 16
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGT 1029 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGA 19 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTA 841 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTG 110 4
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGTTT 525 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTTTA 4 1
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATAGTTAA 14 1
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTTTAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTTGA 2 2
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAA 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATCGTTT 2 4
mmu-let-7a-2_precursor TCGAGGTAGTAGGTTGTATAGT 2 1
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTTAAG 8 1
mmu-let-7a-2_precursor GATGTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGNTGTATAGT 2 1
mmu-let-7a-2_precursor TGAGGTAGCAGGNTGTATAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGATT 2 3
mmu-let-7a-2_precursor TANGTAGTAGGTTGTATAGTT 7 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGNT 26 2
mmu-let-7a-2_precursor GGAGGTAGTAGGTTGTATAGTTT 6 2
mmu-let-7a-2_precursor GGAGGTAGTAGGTTGTATAGTTA 2 3
mmu-let-7a-2_precursor TGAGGTATTAGCTTGTATAGTT 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGT 635 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGA 13 3
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTTC 10 2
mmu-let-7a-2_precursor GAGGTAGTAGGTNGTATAGTT 55 2
mmu-let-7a-2_precursor TGAGGTATTAGGNTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGANTGTATAGTTTA 7 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTTAA 17 2
mmu-let-7a-2_precursor TGCGGGAGTAGGTTGTATAGTT 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATT 266 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTATNGTTT 3 4
mmu-let-7a-2_precursor TTAGGTGGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor CGTAGGTTGTATAGTT 2 16
mmu-let-7a-2_precursor TNAGGTAATAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor CGATGTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTGT 20 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTGC 3 2
mmu-let-7a-2_precursor TGGGGTAGTAGGCTGTATAGTT 4 4
mmu-let-7a-2_precursor TTGAGGTAGTAGGGTGTATAGT 4 1
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATAGTTA 82 2
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATAGTTG 10 4
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATAGTTT 56 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGA 13 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGT 435 2
mmu-let-7a-2_precursor AGGTAGTAGGTTGTATAG 2 2
mmu-let-7a-2_precursor TGAGTTAGTAGCTTGTATAGTT 3 4
mmu-let-7a-2_precursor GTAGGTTGTATAGTTAA 7 19
mmu-let-7a-2_precursor TGANGTAGTAGCTTGTATAGTT 2 4
mmu-let-7a-2_precursor CTGAGGTAGTAGGTTGTATAGT 4 3
mmu-let-7a-2_precursor TGGGGTAGTAGGNTGTATAGTT 6 2
mmu-let-7a-2_precursor GTAGGTTGTATAGT 416 15
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGT 51 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTCTATAGTTA 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTCTATAGTTT 8 2
mmu-let-7a-2_precursor NTGAGGTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTT 4731 3
mmu-let-7a-2_precursor ANGTAGTAGGTTGTATAGTT 18 2
mmu-let-7a-2_precursor TGAGGTAGGAGGCTGTATAGTTT 15 4
mmu-let-7a-2_precursor TAAGNTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTTT 67 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTATAG 89 2
mmu-let-7a-2_precursor TGAGGTCGTAGGTTGTATAGTT 166 2
mmu-let-7a-2_precursor TNAGGTAGGAGGTTGTATAGTTTA 10 2
mmu-let-7a-2_precursor GTAGTAGATTGTATAGTTAA 4 14
mmu-let-7a-2_precursor TGAGGTACTAGGTTGTATAGTTT 9 2
mmu-let-7a-2_precursor TGAGGTACTAGGTTGTATAGTTA 17 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAGA 56 3
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTTGA 6 2
mmu-let-7a-2_precursor GTAGTAGGTTGTATA 3 5
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTA 13 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTAAA 3 5
mmu-let-7a-2_precursor GTAGGTTGTATAGN 5 39
mmu-let-7a-2_precursor TCAGGTAGTAGGTTGTATAGTTC 8 2
mmu-let-7a-2_precursor TGAGGTAGAAGGTTGTATAGT 13 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTATAGGT 40 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAGAT 4 9
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATAGT 192 2
mmu-let-7a-2_precursor TTGAGGTAGTAGNTTGTATAG 2 1
mmu-let-7a-2_precursor TGGNGTAGTAGGTTGTATAGTTT 116 2
mmu-let-7a-2_precursor AGGTAGTAGNTTGTATAGTTAA 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTGAAA 3 1
mmu-let-7a-2_precursor GGGGTAGTAGGTTGTATAGTTG 2 4
mmu-let-7a-2_precursor TGAGCTAGTAGGTTGTATAG 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTG 56 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTA 579 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTAAAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAAC 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAAA 34 6
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAAG 5 4
mmu-let-7a-2_precursor GTAGTAGGTTGTGTAGTT 2 4
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATTGT 3 5
mmu-let-7a-2_precursor TGAGGGAGAAGGTTGTATAGTT 2 3
mmu-let-7a-2_precursor GTGACTGCATGTTCCCAGGT 13 1
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATCGTT 2 4
mmu-let-7a-2_precursor TGAGGGTGTAGGTTGTATAGTT 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAGA 3 5
mmu-let-7a-2_precursor TGAGGTAGTATGTTGTATAGTTG 3 5
mmu-let-7a-2_precursor TGAGGTAGTATGTTGTATAGTTA 5 2
mmu-let-7a-2_precursor TGAGGTAATAGGTTGTATAGTT 56 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTAT 3 11
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGTAT 32 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTGGTATAGT 173 2
mmu-let-7a-2_precursor GAGTAGTAGGTTGTATAGTT 4 9
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTAT 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTAA 79 1
mmu-let-7a-2_precursor GTAGGTTGTATANTTT 2 8
mmu-let-7a-2_precursor GTAGTAGGTTGTCTAGTT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGNTA 4 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGNTT 2 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTA 2 15
mmu-let-7a-2_precursor TGACGTAGTAGCTTGTATAGTT 7 4
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGT 703 2
mmu-let-7a-2_precursor TGAGGGAGNAGGTTGTATAGTT 11 3
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTTGA 4 2
mmu-let-7a-2_precursor TGANGTGGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTAG 2 19
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTAT 134 4
mmu-let-7a-2_precursor TNAGGTAGTAGGCTGTATAGTT 4 2
mmu-let-7a-2_precursor GAGGTAGTAGGTNGTATAGTTA 8 2
mmu-let-7a-2_precursor GAGGTAGTAGGTNGTATAGTTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTAT 39 4
mmu-let-7a-2_precursor TGAGGTAGTCGTTTGTATAGTT 2 5
mmu-let-7a-2_precursor TGATNTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGT 5 13
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTA 49 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTAGA 48 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGAAT 3 5
mmu-let-7a-2_precursor TGAGGTAGTGGGTTGTATAGT 52 3
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATAGTTAA 9 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTATATAG 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTTG 12 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTTA 99 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAGTTC 4 2
mmu-let-7a-2_precursor TGAGGTAGTGGGTTGTATAG 4 3
mmu-let-7a-2_precursor GGGGTAGTAGGTTGTATAGTT 73 2
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATAG 15 2
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATATTT 3 5
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAGTT 941 5
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAGTA 10 6
mmu-let-7a-2_precursor TGAGGTAGTANTTTGTATAGT 93 5
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTAT 13 6
mmu-let-7a-2_precursor GGTAGTAGGTTGTGTAGTT 9 4
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTAG 21 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTAT 27 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTAA 87 3
mmu-let-7a-2_precursor TGAGGTAGTGGGTTGTATAGTTA 23 2
mmu-let-7a-2_precursor TGAGGTAGTGGGTTGTATAGTTC 4 2
mmu-let-7a-2_precursor GAGGTGGTAGGTTGTATAGTT 30 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTNTAGTT 50 2
mmu-let-7a-2_precursor TGAGGTAGNAGGTTGTATAGTT 57 3
mmu-let-7a-2_precursor GTAGTAGGTTGTTTAGTT 2 12
mmu-let-7a-2_precursor AGTAGGTTGNATAGTT 13 6
mmu-let-7a-2_precursor GGTAGTAGGTTGTATNGT 18 4
mmu-let-7a-2_precursor TGAGGTTGTAGGTTGTATAGT 9 2
mmu-let-7a-2_precursor TGAGGTAGAAGGTTGTATAGTT 55 3
mmu-let-7a-2_precursor TTAGGTAGGAGGTTGTATAGTTT 11 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTAGTTAA 15 1
mmu-let-7a-2_precursor TTAGTTAGTAGGTTGTATAGT 2 5
mmu-let-7a-2_precursor GAGGTAGTAGGTTATATAGTTT 2 2
mmu-let-7a-2_precursor GAGGTAGTAGTTTGTATAGTT 3 5
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATAGTTAA 4073 3
mmu-let-7a-2_precursor TGAGNTAGTCGGTTGTATAG 2 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGNATAGT 2 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTACAGTTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATACTTT 34 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATACTTC 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATACTTG 2 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATACTTA 44 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTTT 2 30
mmu-let-7a-2_precursor GANGTAGTAGGTTGTATAGTT 67 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATA 15 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGTTTA 6 1
mmu-let-7a-2_precursor TGAGGTAGTANTTTGTATAGTT 648 5
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGA 4 5
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTA 25 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAGTT 4153 2
mmu-let-7a-2_precursor GTCGGTTGTATAGTTT 3 9
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAG 117 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAA 3 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAT 4 3
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATTGTT 7 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTTAA 4 2
mmu-let-7a-2_precursor TAAGGTAGTAGGTTGTAT 7 7
mmu-let-7a-2_precursor GAGGTAGTAGGTTNTATAG 2 2
mmu-let-7a-2_precursor TAGNAGGTTGTATAGTT 8 3
mmu-let-7a-2_precursor TGAGGTAGTTGGTTGTATAGTTA 9 3
mmu-let-7a-2_precursor TGGTAGTAGGTTGTATAGT 24 2
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAGGT 2 2
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTATAG 40 2
mmu-let-7a-2_precursor TNGGTTGTATAGTTT 2 35
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGTTAA 7 1
mmu-let-7a-2_precursor TNAGGTAGTAGTTTGTATAGTT 2 5
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATAGT 143 2
mmu-let-7a-2_precursor GGTAGTAGGNTGTATAGTT 28 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTCTAG 2 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTAT 55 4
mmu-let-7a-2_precursor TGATGTAGTNGGTTGTATAGT 2 3
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTAA 5 14
mmu-let-7a-2_precursor GAGGTAGTAGNCTGTATAG 2 6
mmu-let-7a-2_precursor TGAGGAAGTAGGTTGTATAGA 3 6
mmu-let-7a-2_precursor TGAGGTAGTANGTGGTATAGTT 2 2
mmu-let-7a-2_precursor TAGGTGGTAGGTTGTATAGTT 4 3
mmu-let-7a-2_precursor TNGGTAGTAGGTTGTATAGT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTCTAGTTT 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTCTAGTTA 8 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTCTAGTTC 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGCATAGT 3 5
mmu-let-7a-2_precursor TNGGGTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TAGTAGGTTGTATAGCT 2 9
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATCGTT 2 4
mmu-let-7a-2_precursor GTTGAGGTAGTAGGTTGTA 3 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATAGTT 469 2
mmu-let-7a-2_precursor TGAGTTAGTAGGTTGTATAGTA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCGTTG 3 7
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTT 1680 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGTATAGTA 11 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGAAG 9 13
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGCT 2 2
mmu-let-7a-2_precursor TNAGGTAGGAGGTTGTATAGTTT 208 3
mmu-let-7a-2_precursor CTGAGGTAGTAGGTTGTATAGTTA 9 3
mmu-let-7a-2_precursor TAGGTAGTAGGTTGTATAGTT 429 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATCT 3 3
mmu-let-7a-2_precursor TGAGGTAGTAGTTTGTATAGTTAA 19 1
mmu-let-7a-2_precursor TGAGGTAGTNGATTGTATAGTTTA 3 2
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGTTT 24 2
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGTTG 5 4
mmu-let-7a-2_precursor TAGGAGGTTGTATAGTTT 10 8
mmu-let-7a-2_precursor TGGNGTAGTAGGTTGTATAGT 186 2
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTTAA 9 1
mmu-let-7a-2_precursor GTAGTAGGTTGTATAGTTAG 3 9
mmu-let-7a-2_precursor TGAGATAGTAGGTTGTATAG 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGTATAGTTTA 9 1
mmu-let-7a-2_precursor TGAGGTAGCAGGTTGTATAGTA 3 5
mmu-let-7a-2_precursor TGAGGTAGCAGGTTGTATAGTT 141 3
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGT 58 3
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTA 6 17
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGA 4 4
mmu-let-7a-2_precursor TGAGTTAGTAGGCTGTATAGTT 3 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTTAA 46 1
mmu-let-7a-2_precursor TTAGGTAGTAGGTTGTATTGT 2 8
mmu-let-7a-2_precursor GAGTTAGTAGGTTGTATAGT 2 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTTT 104 2
mmu-let-7a-2_precursor GGTAGTAGGTTGTATAGTTC 5 2
mmu-let-7a-2_precursor GGGGTAGTAGGTTGTATAGTTT 4 2
mmu-let-7a-2_precursor GAGGTAGTANGTTGTATAGTT 63 2
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTA 4 7
mmu-let-7a-2_precursor TGAGGTAGTNGTTTGTATAGTT 3 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTT 371 2
mmu-let-7a-2_precursor TGAAGTAGTAGGTTGTATAGT 31 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGATAA 2 1
mmu-let-7a-2_precursor TGAGNTAGAAGGTTGTATAGTT 4 3
mmu-let-7a-2_precursor GNGGTAGGAGGTTGTATAGTTT 3 4
mmu-let-7a-2_precursor TGAGGTAGTCGGCTGTATAGTT 6 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTNT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTNA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAAT 28 2
mmu-let-7a-2_precursor TGAGGGGGTAGGTTGTATAGTT 8 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGCATAGTTTA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGG 24 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGA 1526 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGC 31 2
mmu-let-7a-2_precursor TGAGCTAGTAGCTTGTATAGTT 2 4
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTAT 5 2
mmu-let-7a-2_precursor TGAGGGCGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATA 5 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTAGA 3 6
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTTG 8 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTAGTATAG 17 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAAG 147 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTAAA 539 2
mmu-let-7a-2_precursor TCNGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor NGCGGTAGTAGGTTGTATAGTT 11 2
mmu-let-7a-2_precursor GGTGGTAGGTTGTATAGTT 9 3
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTTT 289 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTTC 12 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTTA 431 2
mmu-let-7a-2_precursor TGAGNTAGTAGGTTGTATAGTTG 48 4
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAGTTTAA 3 2
mmu-let-7a-2_precursor NGAGGGAGTAGGTTGTATAGT 4 3
mmu-let-7a-2_precursor GTAGGTTGTANAGTT 12 28
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTGTATT 2 7
mmu-let-7a-2_precursor TTNGGTAGTAGGTTGTATAGTT 7 2
mmu-let-7a-2_precursor AGTAGGTTGTATAGTTGA 2 6
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATCGTT 7 4
mmu-let-7a-2_precursor GGTAGTAGGTTGTAT 8 7
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAG 70 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGTT 305 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGTA 5 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTNGCATAGTT 2 3
mmu-let-7a-2_precursor GGTAGTAGGTTGTCTAGTT 2 2
mmu-let-7a-2_precursor TTGAGGTAGTAGCTTGTATAGTT 2 1
mmu-let-7a-2_precursor AGGTAGTAGGTTGTANAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATNGTT 13 4
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATAGA 53 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATAG 168 2
mmu-let-7a-2_precursor TGAGGTTGTAGGTTGTATAGTTT 4 2
mmu-let-7a-2_precursor TGAGGTTGTAGGTTGTATAGTTG 2 4
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATCGTTT 3 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTATC 4 1
mmu-let-7a-2_precursor TGAGGTAGTATGTTGTATAGTTT 7 2
mmu-let-7a-2_precursor NGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-2_precursor TGAGGTATTANGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TAGNTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAG 135 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTGGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTNG 5 20
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATACTT 310 2
mmu-let-7a-2_precursor GGANGTAGGTTGTATAGTT 10 6
mmu-let-7a-2_precursor GAGGTAGTAGGATGTATAGTT 7 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTAT 4 2
mmu-let-7a-2_precursor TGAGGTAGTANTTTGTAT 2 42
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGTTTA 2 1
mmu-let-7a-2_precursor ANTAGGTTGTATAGTT 21 6
mmu-let-7a-2_precursor GAGGTAGTAGGTTTTATAGTT 18 2
mmu-let-7a-2_precursor GAGGTAGTAGGTTGT 10 11
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAA 241 9
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAG 107 12
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTCG 3 3
mmu-let-7a-2_precursor GAGGTAGTAGGTNGTATAG 3 2
mmu-let-7a-2_precursor TNAAGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor TGAGGTAGNATGTTGTATAGTT 9 3
mmu-let-7a-2_precursor TGAGGTAGTANCTTGTATAGTTTA 4 1
mmu-let-7a-2_precursor GGTAGAAGGTTGTATAGTT 5 4
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTATATTT 3 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGGATAGTT 42 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATATTT 3 4
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGT 239 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGA 2 6
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTTT 167 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATTGTT 4 5
mmu-let-7a-2_precursor TGGNGTAGTAGGTTGTATAGTTTA 3 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTACAGTTC 2 3
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTTA 7 1
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTTC 2 2
mmu-let-7a-2_precursor TGTAGTAGGTTGTATAGTTT 3 2
mmu-let-7a-2_precursor TGTAGTAGGTTGTATAGTTA 8 10
mmu-let-7a-2_precursor NTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAG 12 2
mmu-let-7a-2_precursor TGANGTAGTAGGTTGTAT 15 4
mmu-let-7a-2_precursor TGAGGTAGTAGATTGTATAGTTCA 3 3
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGTTT 50 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGTTA 75 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGTTC 4 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGTTG 12 5
mmu-let-7a-2_precursor TTAGNTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-2_precursor TGAGGTAGTNGGTTGTATAGCT 2 2
mmu-let-7a-2_precursor GGTNGTAGGTTGTATAGTT 17 2
mmu-let-7a-2_precursor TGAGGTAGTAGGGTGTATAG 16 2
mmu-let-7a-2_precursor GAGGTGGTAGGTTGTATAGT 8 2
mmu-let-7a-2_precursor TTGAGGTAGTAGGTTGTATTGTT 3 2
mmu-let-7a-2_precursor TGATGTAGTAGGTTGTATAGTTAA 5 1
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTAT 5 6
mmu-let-7a-2_precursor AGAGGTAGTAGGTTGTATAGTTGA 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTTT 148 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATTGTTA 98 5
mmu-let-7a-2_precursor TNGGTAGTAGGTTGTATAGTT 20 2
mmu-let-7a-2_precursor TGCGGTAGTAGGTTTTATAGTT 2 2
mmu-let-7a-2_precursor TTAGGTAGTAGGTTTTATAGTT 2 5
mmu-let-7a-2_precursor GNAGTAGGTTGTATAGT 9 5
mmu-let-7a-2_precursor TGCGGCAGTAGGTTGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGNTGTAG 2 21
mmu-let-7a-2_precursor TGAGTGAGTAGGTTGTATAGTT 4 3
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGTATAG 117 2
mmu-let-7a-2_precursor TNAGGTGGTAGGTTGTATAGTT 7 2
mmu-let-7a-2_precursor GGTAGTAGGGTGTATAGTT 2 3
mmu-let-7a-2_precursor TGAGGTAGTNGGTTG 3 19
mmu-let-7a-2_precursor GTAGTAGGTTGGATAGTT 4 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTG 163 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTC 122 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTTA 1098 1
mmu-let-7a-2_precursor TGGTAGTAGGTTGTATAG 2 4
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTAT 11 4
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTAA 3 14
mmu-let-7a-2_precursor TGNGGTAGGAGGTTGTATAGTTT 43 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTTTA 5 1
mmu-let-7a-2_precursor TGAGGTAGTAGCTTGTATA 6 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGNATAGTTC 20 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTCTGA 5 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTAGAAT 2 8
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTTTG 3 4
mmu-let-7a-2_precursor CTGTACAGCCTCCTAGCTTTCC 7 1
mmu-let-7a-2_precursor TGAGGCAGTAGGTTGTATAGTTT 133 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATATTTT 5 2
mmu-let-7a-2_precursor TGAGGTAGTAGGCTGTATA 8 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTCTATAGTTT 4 5
mmu-let-7a-2_precursor TGAGGTAGTAGGTTTTATAGTT 79 2
mmu-let-7a-2_precursor GATGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTATAGTTAA 69 1
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAGTTAA 12 1
mmu-let-7a-2_precursor TTGAGGTAGTAGGGTGTATAGTT 3 1
mmu-let-7a-2_precursor GTAGTAGGTTGTATANTT 4 2
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGNATAGTTT 37 3
mmu-let-7a-2_precursor TGAGGTAGTTGGTTGTATAGTTT 3 2
mmu-let-7a-2_precursor TNAGGTAGTAGGTTGTATA 46 2
mmu-let-7a-2_precursor TGAGGTAGTCGGCTGTATAGTTT 3 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTTAAG 2 1
mmu-let-7a-2_precursor TGATTTAGTAGGTTGTATAGT 2 4
mmu-let-7a-2_precursor TGCGGTAGTAGGTTGCATAGT 24 4
mmu-let-7a-2_precursor TNATGTAGTAGGTTGTATAGTT 15 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTCGT 2 20
mmu-let-7a-2_precursor AGGTAGTAGGTTGTATAGTG 3 2
mmu-let-7a-2_precursor AGGTAGTAGGTTGTATAGTT 359 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATCTT 16 6
mmu-let-7a-2_precursor TGAGGTAGGAGGTTGTATAGTTAAGA 4 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTG 2 2
mmu-let-7a-2_precursor NGAGGTAGTAGGTTGTATAGTT 2532 2
mmu-let-7a-2_precursor TGGGGTAGTAGGTTGGATAGTT 2 3
mmu-let-7a-2_precursor GTNGGTTGTATAGTT 59 12
mmu-let-7a-2_precursor TGNGGTAGTAGGTTGTA 20 4
mmu-let-7a-2_precursor GTAGGTTGTATANTT 59 28
mmu-let-7a-2_precursor GTAGGTTGTATAG 9 39
mmu-let-7a-2_precursor GAGGTAGTAGGCTGTATAGTT 2 2
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTATATTT 2 2
mmu-let-7a-2_precursor GGGAGTAGGTTGTATAGTT 20 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTCAA 3 1
mmu-let-7a-2_precursor TGAGGTTGTAGGTTGTATAG 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTTG 30 4
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTTC 10 2
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATATTTA 231 3
mmu-let-7a-2_precursor NGAGGGAGTAGGTTGTATAGTT 10 2
mmu-let-7a-2_precursor GAGGTAGTAGATTGTATAGTTAA 105 3
mmu-let-7a-2_precursor TGAGGGAGTAGGTTGTATAG 135 3
mmu-let-7a-2_precursor TGAGGTAGTANGTTGTACAGTTT 21 3
mmu-let-7a-2_precursor GTAGTGGGTTGTATAGTT 3 6
mmu-let-7a-2_precursor GAGGTAGTAGGTTGTNTAGT 3 2
mmu-let-7a-2_precursor GAGNTAGTAGGTTGTATAGT 9 2
mmu-let-7a-2_precursor GGTAGCAGGTTGTATAGTT 5 3
mmu-let-7a-2_precursor GNGGTAGTAGGTTGTATAGTTTA 2 1
mmu-let-7a-2_precursor NGAGGTAGTAGGTGGTATAGTT 2 2
mmu-let-7a-2_precursor TGAGGTAGTAGGATGTATAG 9 3
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTCAG 2 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTCAT 3 1
mmu-let-7a-2_precursor TGAGGTAGTAGGTTGTATAGTTCAA 2 2
mmu-let-7a-2_precursor GAGTTAGTAGGTTGTATAGTT 10 2
mmu-let-7a-2_precursor GAGGTAGTAGGATGTAT 2 16
mmu-let-7a-2_precursor TGACGTAGTAGGTTGTAT 3 5
mmu-let-7a-2_precursor NCAGGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-2_precursor GAGGTAGTANGTTGTATAGTTAA 2 1