id_rna sequence raw_count mapping_loci
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTT 551860 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTT 45856 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTG 7514 4
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTT 6024 2
mmu-let-7a-5p GGTAGTAGGTTGTATAGTT 3118 2
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTTA 316 2
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTTT 198 1
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGT 179 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTTGTTTT 8 3
mmu-let-7a-5p GTAGTAGGTTGTANAGTT 7 2
mmu-let-7a-5p TGAGGTAGNAGGTTGTATAGT 6 3
mmu-let-7a-5p TGAGGTAGNAGGTTGTATAGT 6 3
mmu-let-7a-5p TGAGGTAGNAGGTTGTATAGC 2 3
mmu-let-7a-5p TGAGGTAGNAGGTTGTATAGC 2 3
mmu-let-7a-5p TGAGGTAGGAGGTTGNATAGTTTA 2 2
mmu-let-7a-5p TGAGGTAGGAGGTTGNATAGTTTT 3 1
mmu-let-7a-5p GTAGTAGGTTGTANAGTT 7 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTTGTTTA 5 3
mmu-let-7a-5p TTGAGGTAGTAGTTTGTATAGTT 2 1
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGT 179 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGA 4 4
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGA 4 4
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAGTTAA 2 1
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTGA 6 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTAT 7 5
mmu-let-7a-5p TGAGGTAGTAGGTCGTAT 7 5
mmu-let-7a-5p TGAGGTAGTAGATTGTATATTTTA 3 3
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTTC 20 4
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTTC 20 4
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTTG 68 4
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTTG 68 4
mmu-let-7a-5p TGAGGTAGTAGTTTGNATAGTT 2 5
mmu-let-7a-5p TGAGGTAGTAGTTTGNATAGTT 2 5
mmu-let-7a-5p TGCGGTAGTAGGTTGT 6 12
mmu-let-7a-5p TGCGGTAGTAGGTTGT 6 12
mmu-let-7a-5p TTAGGTAGTAGGTTGTAT 6 6
mmu-let-7a-5p TTAGGTAGTAGGTTGTAT 6 6
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAGTA 3 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAGTT 46 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAGTT 46 2
mmu-let-7a-5p TAGTAGGTTGTATAGTTT 44 2
mmu-let-7a-5p TAGTAGGTTGTATAGTTT 44 2
mmu-let-7a-5p TAGTAGGTTGTATAGTTA 95 7
mmu-let-7a-5p TAGTAGGTTGTATAGTTA 95 7
mmu-let-7a-5p TAGTAGGTTGTATAGTTG 7 6
mmu-let-7a-5p TAGTAGGTTGTATAGTTG 7 6
mmu-let-7a-5p ANGTAGTAGGTTGTATAGT 5 2
mmu-let-7a-5p ANGTAGTAGGTTGTATAGT 5 2
mmu-let-7a-5p GAGGTAGTANGTTGTATAGTTG 3 5
mmu-let-7a-5p GAGGTAGTANGTTGTATAGTTG 3 5
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGTTT 12 2
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGTTT 12 2
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGTTG 4 5
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGTTG 4 5
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGTTA 29 3
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGTTA 29 3
mmu-let-7a-5p CGAGGTAGGAGGTTGTATAGTTT 4 3
mmu-let-7a-5p CGAGGTAGGAGGTTGTATAGTTT 4 3
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAG 55 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAG 55 2
mmu-let-7a-5p TGAGGTACTAGGNTGTATAGTT 3 2
mmu-let-7a-5p TGAGGTACTAGGNTGTATAGTT 3 2
mmu-let-7a-5p GGTAGTAGGTTGTATAGTT 3118 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATACTT 2 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATACTT 2 2
mmu-let-7a-5p TGAGGTAGTAGATTGTATAGTTTAG 8 1
mmu-let-7a-5p TGAGGTAGTAGGTNGT 10 11
mmu-let-7a-5p TGAGGTAGTAGGTNGT 10 11
mmu-let-7a-5p GAGGTAGTAGCTTNTATAGTT 2 4
mmu-let-7a-5p GAGGTAGTAGCTTNTATAGTT 2 4
mmu-let-7a-5p TGCCGTAGTAGGTTGTATAGTT 13 3
mmu-let-7a-5p TGCCGTAGTAGGTTGTATAGTT 13 3
mmu-let-7a-5p TAGGTAGTAGGTNGTATAGTT 4 2
mmu-let-7a-5p TAGGTAGTAGGTNGTATAGTT 4 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTTTT 2 1
mmu-let-7a-5p TGNGGTAGTAGCTTGTATAGTT 2 4
mmu-let-7a-5p TGNGGTAGTAGCTTGTATAGTT 2 4
mmu-let-7a-5p NGGGGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p NGGGGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTT 13 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTT 13 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTC 3 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTC 3 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTA 23 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTA 23 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTG 4 4
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTG 4 4
mmu-let-7a-5p TGANGTAGTAGGTTGTA 7 4
mmu-let-7a-5p TGANGTAGTAGGTTGTA 7 4
mmu-let-7a-5p TGAGGCAGTAGGTNGTATAGTT 3 2
mmu-let-7a-5p TGAGGCAGTAGGTNGTATAGTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCTT 14 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCTT 14 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCTA 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCTA 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCTG 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCTG 2 4
mmu-let-7a-5p GTTGAGGTAGTAGGTTGTATAGTT 2 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGGTA 4 3
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGGTA 4 3
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGGTT 3 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGGTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTAT 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTAT 6 2
mmu-let-7a-5p TGGNGTAGTAGGTTGTATAGTT 1217 2
mmu-let-7a-5p TGGNGTAGTAGGTTGTATAGTT 1217 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATA 2 4
mmu-let-7a-5p TGAGGAAGTAGGTTGTATA 2 4
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTAT 3 1
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTAA 12 1
mmu-let-7a-5p GTAGTAGGTTGTATAGTTTG 2 2
mmu-let-7a-5p GTAGTAGGTTGTATAGTTTG 2 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTAT 27 1
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGA 13 6
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGA 13 6
mmu-let-7a-5p TGGGGTAGTAGGTTGTATTGTT 2 5
mmu-let-7a-5p TGGGGTAGTAGGTTGTATTGTT 2 5
mmu-let-7a-5p GTAGGTTGTATAGNT 48 14
mmu-let-7a-5p GTAGGTTGTATAGNT 48 14
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTT 135 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTT 135 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTG 36 5
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTG 36 5
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTC 6 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTC 6 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTA 242 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTA 242 2
mmu-let-7a-5p TGACGTAGTAGGTTGTACAGTT 2 3
mmu-let-7a-5p TGACGTAGTAGGTTGTACAGTT 2 3
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTAAA 6 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTAAA 6 2
mmu-let-7a-5p TGNGGTAGTAGATTGTATAGTTTA 5 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-5p GCGGTAGTAGGTTGTATAGTTT 3 2
mmu-let-7a-5p GCGGTAGTAGGTTGTATAGTTT 3 2
mmu-let-7a-5p TGGGGTAGTAGGTTGCATAGTTT 2 4
mmu-let-7a-5p TGGGGTAGTAGGTTGCATAGTTT 2 4
mmu-let-7a-5p ATGAGGTAGTAGGTTGTATAGTTG 2 1
mmu-let-7a-5p ATGAGGTAGTAGGTTGTATAGTTA 2 1
mmu-let-7a-5p ATGAGGTAGTAGGTTGTATAGTTT 8 1
mmu-let-7a-5p TNGAGGTAGTAGGTTGTATAGTTA 2 1
mmu-let-7a-5p GAGGTAGTAGGTTGCATAGTTGA 6 3
mmu-let-7a-5p NGAGGTAGTAGGTTGTACAGTT 3 3
mmu-let-7a-5p NGAGGTAGTAGGTTGTACAGTT 3 3
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTC 2 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTC 2 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTT 77 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTT 77 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTG 11 4
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTG 11 4
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTA 150 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTA 150 2
mmu-let-7a-5p GTAGNTTGTATAGTT 55 23
mmu-let-7a-5p GTAGNTTGTATAGTT 55 23
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTGTA 55 2
mmu-let-7a-5p TGAGGGAGGAGGTTGTATAGTTTA 2 2
mmu-let-7a-5p TGAGNTAGGAGGTTGTATAGTTTA 6 2
mmu-let-7a-5p GGTAGTAGGNTGTATAGT 8 2
mmu-let-7a-5p GGTAGTAGGNTGTATAGT 8 2
mmu-let-7a-5p TGAGGTAGTAGATTGTATAGTTCAG 3 2
mmu-let-7a-5p TGCGGGAGTAGGTTGTATAGT 2 3
mmu-let-7a-5p TGCGGGAGTAGGTTGTATAGT 2 3
mmu-let-7a-5p TTGAGGTAGTNAGTTGTATAGTT 3 1
mmu-let-7a-5p CGCGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p CGCGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTATA 4 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTATG 4 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTATG 4 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTATC 37 1
mmu-let-7a-5p TGAGNTAGTAGGTTGTAT 24 5
mmu-let-7a-5p TGAGNTAGTAGGTTGTAT 24 5
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGT 36 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGT 36 2
mmu-let-7a-5p GGTAGTAGGTGGTNTAGTT 2 2
mmu-let-7a-5p GGTAGTAGGTGGTNTAGTT 2 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAG 9 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAG 9 2
mmu-let-7a-5p NAGGTAGTAGGTTGTATAGTT 18 2
mmu-let-7a-5p NAGGTAGTAGGTTGTATAGTT 18 2
mmu-let-7a-5p TTGAGGTAGNAGGTTGTATAGT 5 1
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTAT 3 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTAT 3 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAG 29 1
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTT 2678 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTT 2678 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTA 10 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTA 10 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAGT 10 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAGT 10 2
mmu-let-7a-5p GGGNGTAGGTTGTATAGT 3 10
mmu-let-7a-5p GGGNGTAGGTTGTATAGT 3 10
mmu-let-7a-5p TGAGGTAGGNGGTTGTATAGTTT 47 4
mmu-let-7a-5p TGAGGTAGGNGGTTGTATAGTTT 47 4
mmu-let-7a-5p GAAGTAGGTTGTATAGTT 5 5
mmu-let-7a-5p GAAGTAGGTTGTATAGTT 5 5
mmu-let-7a-5p TGATGTAGTAGCTTGTATAGTT 2 6
mmu-let-7a-5p TGATGTAGTAGCTTGTATAGTT 2 6
mmu-let-7a-5p NGAGGAAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p NGAGGAAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATATTT 11 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATATTT 11 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTTT 6 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAG 747 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAG 747 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAT 685 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAT 685 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAA 1798 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAA 1798 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAC 51 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAC 51 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTTA 3 1
mmu-let-7a-5p TGAGGTGGTAGGTTGCATAGTT 2 5
mmu-let-7a-5p TGAGGTGGTAGGTTGCATAGTT 2 5
mmu-let-7a-5p TGAGGTAGTAGGTTGNATATTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATATTT 2 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTGTAGTT 3 3
mmu-let-7a-5p TAAGGTAGTAGGTTGTGTAGTT 3 3
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTGA 2 1
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTGT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTGGA 4 40
mmu-let-7a-5p TGAGGTAGTAGGTTGTGGA 4 40
mmu-let-7a-5p TNAGGTAGTAGTTTGTATAGT 2 5
mmu-let-7a-5p TNAGGTAGTAGTTTGTATAGT 2 5
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGT 250 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGT 250 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGA 2 6
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGA 2 6
mmu-let-7a-5p TGAGGGAGGAGGTTGTATAGTTT 46 3
mmu-let-7a-5p TGAGGGAGGAGGTTGTATAGTTT 46 3
mmu-let-7a-5p GAGGTAGTANGTTGTATAGTTT 3 2
mmu-let-7a-5p GAGGTAGTANGTTGTATAGTTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTTA 2 1
mmu-let-7a-5p GAGNTAGTAGGTTGGATAGTT 4 3
mmu-let-7a-5p GAGNTAGTAGGTTGGATAGTT 4 3
mmu-let-7a-5p TGAGATAGTAGGTTGTATAGTTA 6 3
mmu-let-7a-5p TGAGATAGTAGGTTGTATAGTTA 6 3
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTT 490 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTT 490 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTA 2 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTA 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGA 1205 2
mmu-let-7a-5p TGAGGTAGTAGATTGTATAGTTTA 379 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTTTAGTT 2 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTTTAGTT 2 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTGT 5 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTGT 5 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTTAT 8 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTTAA 24 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTTT 14 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTTA 11 1
mmu-let-7a-5p TNAGGTAGTAGGTT 51 48
mmu-let-7a-5p TNAGGTAGTAGGTT 51 48
mmu-let-7a-5p TGCGGTAGTAGGTTGGATAGT 9 2
mmu-let-7a-5p TGCGGTAGTAGGTTGGATAGT 9 2
mmu-let-7a-5p TGAGGTAGTAGTTTGTATATTT 2 6
mmu-let-7a-5p TGAGGTAGTAGTTTGTATATTT 2 6
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTAA 4 1
mmu-let-7a-5p GAGTAGTAGGTTGTATAGT 5 20
mmu-let-7a-5p GAGTAGTAGGTTGTATAGT 5 20
mmu-let-7a-5p TGCGGTAGTAGCTTGTATAGTT 6 4
mmu-let-7a-5p TGCGGTAGTAGCTTGTATAGTT 6 4
mmu-let-7a-5p TGATGTAGTAGGTTGTATAGTTTAT 3 1
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTT 103 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTT 103 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTA 145 3
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTA 145 3
mmu-let-7a-5p TGAGGTAGTGGGTNGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTGGGTNGTATAGTT 4 2
mmu-let-7a-5p TAGGTAGTAGGTTNTATAGTT 3 2
mmu-let-7a-5p TAGGTAGTAGGTTNTATAGTT 3 2
mmu-let-7a-5p GGTAGTAGGTTGTATAGTA 8 3
mmu-let-7a-5p GGTAGTAGGTTGTATAGTA 8 3
mmu-let-7a-5p GGTAGTAGGTTGTATATTT 4 3
mmu-let-7a-5p GGTAGTAGGTTGTATATTT 4 3
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTA 11 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTA 11 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTT 1736 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTT 1736 4
mmu-let-7a-5p GGTAGTAGGTTGNATAGTT 24 3
mmu-let-7a-5p GGTAGTAGGTTGNATAGTT 24 3
mmu-let-7a-5p GTAGGTTGTATAGTTC 19 42
mmu-let-7a-5p GTAGGTTGTATAGTTC 19 42
mmu-let-7a-5p TGAGGTAGTACGTTGTATAGT 4 2
mmu-let-7a-5p TGAGGTAGTACGTTGTATAGT 4 2
mmu-let-7a-5p NGCGGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-5p NGCGGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-5p TGAGGTAGGAGTTTGTATAGTTT 12 5
mmu-let-7a-5p TGAGGTAGGAGTTTGTATAGTTT 12 5
mmu-let-7a-5p TGCGGTATTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TGCGGTATTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTA 8 16
mmu-let-7a-5p TGGGGTAGTAGGTTGTA 8 16
mmu-let-7a-5p NGAGGTAGTAGTTTGTATAGT 2 5
mmu-let-7a-5p NGAGGTAGTAGTTTGTATAGT 2 5
mmu-let-7a-5p TGAGGGAGTAGTTTGTATAGTT 2 6
mmu-let-7a-5p TGAGGGAGTAGTTTGTATAGTT 2 6
mmu-let-7a-5p TGAGGTAGTANTTTGTATAG 12 5
mmu-let-7a-5p TGAGGTAGTANTTTGTATAG 12 5
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAGT 13 2
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAGT 13 2
mmu-let-7a-5p TGCGGTAGTAGATTGTATAGTTTA 6 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATA 3 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATA 3 2
mmu-let-7a-5p GAGNTAGTAGGTTGTATAGTA 2 2
mmu-let-7a-5p GAGNTAGTAGGTTGTATAGTA 2 2
mmu-let-7a-5p GAGNTAGTAGGTTGTATAGTT 63 2
mmu-let-7a-5p GAGNTAGTAGGTTGTATAGTT 63 2
mmu-let-7a-5p TGANGTAGTAGGTTGTCTAGTT 204 2
mmu-let-7a-5p TGANGTAGTAGGTTGTCTAGTT 204 2
mmu-let-7a-5p CGGGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p CGGGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p GTAGGTTGTNTAGTT 70 17
mmu-let-7a-5p GTAGGTTGTNTAGTT 70 17
mmu-let-7a-5p TGAGGTAGTAGATTGTATAGTTTAT 2 2
mmu-let-7a-5p TGAAGTAGGTTGTATAGTTT 2 20
mmu-let-7a-5p TGAAGTAGGTTGTATAGTTT 2 20
mmu-let-7a-5p TGACGTAGTAGGTTGTATAGTT 616 2
mmu-let-7a-5p TGACGTAGTAGGTTGTATAGTT 616 2
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAGTTAA 2 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAT 3 5
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAT 3 5
mmu-let-7a-5p GTGNTAGGTTGTATAGT 2 37
mmu-let-7a-5p GTGNTAGGTTGTATAGT 2 37
mmu-let-7a-5p TGNTGTAGTAGGTTGTATAGTT 6 2
mmu-let-7a-5p TGNTGTAGTAGGTTGTATAGTT 6 2
mmu-let-7a-5p TGAGGTAGGAGGTTATATAGTTT 3 3
mmu-let-7a-5p TGAGGTAGGAGGTTATATAGTTT 3 3
mmu-let-7a-5p TTAGGTAGTAGGTNGTATAGTT 6 2
mmu-let-7a-5p TTAGGTAGTAGGTNGTATAGTT 6 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAG 24 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAG 24 2
mmu-let-7a-5p TGAGGGAGTAGGTGGTATAGTT 5 2
mmu-let-7a-5p TGAGGGAGTAGGTGGTATAGTT 5 2
mmu-let-7a-5p TNAGGTAGTAGGTTGT 45 9
mmu-let-7a-5p TNAGGTAGTAGGTTGT 45 9
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGTTAA 3 1
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAG 21 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAG 21 2
mmu-let-7a-5p GGTAGTAGGTTGTATA 4 2
mmu-let-7a-5p GGTAGTAGGTTGTATA 4 2
mmu-let-7a-5p TGAGATAGTAGGTTGTATAGTT 66 2
mmu-let-7a-5p TGAGATAGTAGGTTGTATAGTT 66 2
mmu-let-7a-5p TTAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TTAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TTNAGGTAGTAGGTTGTATAGTT 7 1
mmu-let-7a-5p GTAGTAGGTTGTATAGT 133 2
mmu-let-7a-5p GTAGTAGGTTGTATAGT 133 2
mmu-let-7a-5p GANGTAGTAGGTTGTATAGT 17 2
mmu-let-7a-5p GANGTAGTAGGTTGTATAGT 17 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGA 4 7
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGA 4 7
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGT 180 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGT 180 5
mmu-let-7a-5p GNAGGTTGTATAGTT 290 16
mmu-let-7a-5p GNAGGTTGTATAGTT 290 16
mmu-let-7a-5p TGAGGTAGTGGGTTGTATAGTTT 26 2
mmu-let-7a-5p TGAGGTAGTGGGTTGTATAGTTT 26 2
mmu-let-7a-5p TGAGNTAGTAGGTTGTATA 11 3
mmu-let-7a-5p TGAGNTAGTAGGTTGTATA 11 3
mmu-let-7a-5p TGGGGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-5p TGGGGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-5p TGCGGTTGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p TGCGGTTGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTT 134 2
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTT 134 2
mmu-let-7a-5p TGAGGTAGTAGGCNGTATAGTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGCNGTATAGTT 3 2
mmu-let-7a-5p GAGGTCGTAGGTTGTATAGTT 54 2
mmu-let-7a-5p GAGGTCGTAGGTTGTATAGTT 54 2
mmu-let-7a-5p TAAGGTAGGAGGTTGTATAGTTT 8 3
mmu-let-7a-5p TAAGGTAGGAGGTTGTATAGTTT 8 3
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGT 136 5
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGT 136 5
mmu-let-7a-5p TGGGGTAGTAGGGTGTATAGTT 2 2
mmu-let-7a-5p TGGGGTAGTAGGGTGTATAGTT 2 2
mmu-let-7a-5p GGAGGTAGTAGGTTGTATAG 3 2
mmu-let-7a-5p GGAGGTAGTAGGTTGTATAG 3 2
mmu-let-7a-5p GAGGTGGTAGGTTGTATAGTTG 3 4
mmu-let-7a-5p GAGGTGGTAGGTTGTATAGTTG 3 4
mmu-let-7a-5p GAGGTGGTAGGTTGTATAGTTA 7 2
mmu-let-7a-5p GAGGTGGTAGGTTGTATAGTTA 7 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTTGA 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAAGT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAAGT 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATCGT 4 4
mmu-let-7a-5p GAGGTAGTAGGTTGTATCGT 4 4
mmu-let-7a-5p TAGTAGGTTGTATAGTTTTAGG 5 1
mmu-let-7a-5p TAGGTTGTATAGTT 569 21
mmu-let-7a-5p TAGGTTGTATAGTT 569 21
mmu-let-7a-5p TGNGGTAGTAGGTTGTATA 16 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATA 16 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTAT 11 7
mmu-let-7a-5p TGGGGTAGTAGGTTGTAT 11 7
mmu-let-7a-5p TGAGGGAGTAGGTTGTGTAGTT 5 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTGTAGTT 5 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAGTTT 14 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAGTTT 14 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAGTTA 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAGTTA 6 2
mmu-let-7a-5p GATGAGGTAGTAGGTTGTATGGT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTA 1614 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTA 1614 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGGTT 7 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGGTT 7 4
mmu-let-7a-5p TGAGGTAGTACGTTGTATAGTT 24 2
mmu-let-7a-5p TGAGGTAGTACGTTGTATAGTT 24 2
mmu-let-7a-5p GAGGTAGTAGNTTGTATAGTT 8 4
mmu-let-7a-5p GAGGTAGTAGNTTGTATAGTT 8 4
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTAT 4 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTAT 4 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTT 384 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTT 384 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTG 50 4
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTG 50 4
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTC 18 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTC 18 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTA 550 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTA 550 3
mmu-let-7a-5p TGNGCTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGNGCTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTGA 5 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTGT 3 2
mmu-let-7a-5p GAGGTGGTAGGTTGTATAG 3 2
mmu-let-7a-5p GAGGTGGTAGGTTGTATAG 3 2
mmu-let-7a-5p TGAGGTAGTAGCTTGTA 3 24
mmu-let-7a-5p TGAGGTAGTAGCTTGTA 3 24
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTTT 13 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTTT 13 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTTG 5 4
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTTG 5 4
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTTA 22 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTTA 22 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTA 22 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTA 22 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTG 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTG 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTTTTT 9 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTTTTT 9 4
mmu-let-7a-5p TGNGGTAGTAGGTTGCATAGTT 2 3
mmu-let-7a-5p TGNGGTAGTAGGTTGCATAGTT 2 3
mmu-let-7a-5p TTAGGTAGTAGGTTGNATAGTT 4 2
mmu-let-7a-5p TTAGGTAGTAGGTTGNATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTGT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTGT 2 2
mmu-let-7a-5p AAGGTAGTAGGTTGTATAGTT 5 3
mmu-let-7a-5p AAGGTAGTAGGTTGTATAGTT 5 3
mmu-let-7a-5p GGTAGTAGGTTGTATAGTTAA 13 1
mmu-let-7a-5p GGTAGTAGGTTGTATAGTTAT 6 2
mmu-let-7a-5p GGTAGTAGGTTGTATAGTTAG 5 4
mmu-let-7a-5p GGTAGTAGGTTGTATAGTTAG 5 4
mmu-let-7a-5p TGAGGTAGTAGATTGTATAGTTAAG 60 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTAA 15 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTAA 15 2
mmu-let-7a-5p GTAGTAGGTTGTATAGTT 745 2
mmu-let-7a-5p GTAGTAGGTTGTATAGTT 745 2
mmu-let-7a-5p GTAGTAGGTTGTATAGTA 3 5
mmu-let-7a-5p GTAGTAGGTTGTATAGTA 3 5
mmu-let-7a-5p TAGGAGGTTGTATAGTTAT 3 24
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTAT 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTAGA 2 1
mmu-let-7a-5p GAGGTAGTAGNGTGTATAGTT 24 5
mmu-let-7a-5p GAGGTAGTAGNGTGTATAGTT 24 5
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTAA 71 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTT 6024 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTA 53 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTA 53 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTAAA 2 7
mmu-let-7a-5p TGAGGTAGTAGGTNGTAAA 2 7
mmu-let-7a-5p GTAGGAGGTTGTATAGTTT 9 6
mmu-let-7a-5p GTAGGAGGTTGTATAGTTT 9 6
mmu-let-7a-5p TAGTAGGTTGTATAG 15 4
mmu-let-7a-5p TAGTAGGTTGTATAG 15 4
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTT 1017 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTT 1017 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7a-5p TGCGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7a-5p GACGTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p GACGTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTT 114 3
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTT 114 3
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTC 5 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTC 5 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTA 191 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTA 191 4
mmu-let-7a-5p TGAGGTGGTAGCTTGTATAGTT 2 4
mmu-let-7a-5p TGAGGTGGTAGCTTGTATAGTT 2 4
mmu-let-7a-5p NGTAGGTTGTATAGTT 2 7
mmu-let-7a-5p NGTAGGTTGTATAGTT 2 7
mmu-let-7a-5p GANGTAGTAGGTTGTATAGTTA 7 2
mmu-let-7a-5p GANGTAGTAGGTTGTATAGTTA 7 2
mmu-let-7a-5p GTAGTTGGTTGTATAGTT 8 6
mmu-let-7a-5p GTAGTTGGTTGTATAGTT 8 6
mmu-let-7a-5p TGATGTAGTANGTTGTATAGTT 2 2
mmu-let-7a-5p TGATGTAGTANGTTGTATAGTT 2 2
mmu-let-7a-5p ATAGTAGGTTGTATAGTT 2 7
mmu-let-7a-5p ATAGTAGGTTGTATAGTT 2 7
mmu-let-7a-5p TGAGGTAGGAGGGTGTATAGTTT 6 4
mmu-let-7a-5p TGAGGTAGGAGGGTGTATAGTTT 6 4
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATTGT 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAA 4 17
mmu-let-7a-5p TGAGGTAGTAGGTTGAA 4 17
mmu-let-7a-5p GGTAGTAGGATGTATAGTT 2 3
mmu-let-7a-5p GGTAGTAGGATGTATAGTT 2 3
mmu-let-7a-5p GGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7a-5p GGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7a-5p TGATGTAGTAGGTTGTATAGTT 729 2
mmu-let-7a-5p TGATGTAGTAGGTTGTATAGTT 729 2
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTTT 7 2
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTTT 7 2
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTTA 13 2
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTTA 13 2
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTTG 2 4
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTTG 2 4
mmu-let-7a-5p TGAGGTAGTTGGTTGTATAGTT 46 2
mmu-let-7a-5p TGAGGTAGTTGGTTGTATAGTT 46 2
mmu-let-7a-5p GNGTTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p GNGTTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTAGAGTT 21 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAGAGTT 21 2
mmu-let-7a-5p AGTAGGTTGTATAG 5 16
mmu-let-7a-5p AGTAGGTTGTATAG 5 16
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTC 19 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTC 19 2
mmu-let-7a-5p NGAGGTGGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p NGAGGTGGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGGAGTCGGTTGTATAGT 2 4
mmu-let-7a-5p TGAGGGAGTCGGTTGTATAGT 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAC 13 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAC 13 2
mmu-let-7a-5p TGAGGTAGGAGGNTGTATAGTTT 38 3
mmu-let-7a-5p TGAGGTAGGAGGNTGTATAGTTT 38 3
mmu-let-7a-5p TNAGGTAGGAGGTTGTATAGTTTT 5 1
mmu-let-7a-5p TGCGGTAGTAGGTTGGATAGTTT 6 2
mmu-let-7a-5p TGCGGTAGTAGGTTGGATAGTTT 6 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTGTAGTT 12 3
mmu-let-7a-5p TNAGGTAGTAGGTTGTGTAGTT 12 3
mmu-let-7a-5p GGTAGTAGTTTGTATAGTT 2 5
mmu-let-7a-5p GGTAGTAGTTTGTATAGTT 2 5
mmu-let-7a-5p TGAGGTAGTAGGTGGTATGGTTTTA 4 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATTGTT 11 5
mmu-let-7a-5p TGAGGTAGTAGGNTGTATTGTT 11 5
mmu-let-7a-5p GATGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-5p GATGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTTA 5 2
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTTT 6 1
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTTG 3 4
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTTG 3 4
mmu-let-7a-5p ACTGAGGTAGTAGGTTGTATAGTT 2 4
mmu-let-7a-5p ACTGAGGTAGTAGGTTGTATAGTT 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTACATTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTACATTT 2 3
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTTAA 4 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTTAA 4 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAG 6 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAG 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTCT 11 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTCT 11 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTCA 13 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTCA 13 2
mmu-let-7a-5p TNAGCTAGTAGGTTGTATAGTT 8 2
mmu-let-7a-5p TNAGCTAGTAGGTTGTATAGTT 8 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATTGTT 6 5
mmu-let-7a-5p TGNGGTAGTAGGTTGTATTGTT 6 5
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAGT 10 2
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAGT 10 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTAA 22 2
mmu-let-7a-5p TGAGNTAGTAGGTTGT 3 15
mmu-let-7a-5p TGAGNTAGTAGGTTGT 3 15
mmu-let-7a-5p TGACGTAGTAGGTTGTATAGTTTA 3 1
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTT 81 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTT 81 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTA 141 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTA 141 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTG 13 4
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTG 13 4
mmu-let-7a-5p GGTAGTAGGTTGTATAGTAA 5 11
mmu-let-7a-5p GGTAGTAGGTTGTATAGTAA 5 11
mmu-let-7a-5p ATGAGGTAGTAGGTTGTATGGT 3 3
mmu-let-7a-5p TGCGGTAGTAGGTTGTATATTT 5 3
mmu-let-7a-5p TGCGGTAGTAGGTTGTATATTT 5 3
mmu-let-7a-5p AGGTAGTAGGTTNTATAGTT 4 2
mmu-let-7a-5p AGGTAGTAGGTTNTATAGTT 4 2
mmu-let-7a-5p TGAGTTAGTAGGNTGTATAGT 2 3
mmu-let-7a-5p TGAGTTAGTAGGNTGTATAGT 2 3
mmu-let-7a-5p TNAGGTAGTTGGTTGTATAGTT 2 2
mmu-let-7a-5p TNAGGTAGTTGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTACGAGGTTGTATAGTTT 2 3
mmu-let-7a-5p TGAGGTACGAGGTTGTATAGTTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGAG 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGAA 40 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGAA 40 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGAT 6 2
mmu-let-7a-5p GAGGTAGTAGGTTTTATAGTTT 3 2
mmu-let-7a-5p GAGGTAGTAGGTTTTATAGTTT 3 2
mmu-let-7a-5p AGGTAGTAGGTTGTA 2 5
mmu-let-7a-5p AGGTAGTAGGTTGTA 2 5
mmu-let-7a-5p NAGGTAGTAGGTTGTATAGT 6 2
mmu-let-7a-5p NAGGTAGTAGGTTGTATAGT 6 2
mmu-let-7a-5p TTGGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TTGGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATATT 2 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATATT 2 2
mmu-let-7a-5p TGAGGTAGNAGGTTGTGTAGTT 2 4
mmu-let-7a-5p TGAGGTAGNAGGTTGTGTAGTT 2 4
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTT 1247 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTT 1247 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTA 7 4
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTA 7 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGTAA 2 1
mmu-let-7a-5p TGAGGTAGGAGGTTGTTTAGTTT 2 3
mmu-let-7a-5p TGAGGTAGGAGGTTGTTTAGTTT 2 3
mmu-let-7a-5p TGAGGTAGTAGTTTGCATAGTT 6 8
mmu-let-7a-5p TGAGGTAGTAGTTTGCATAGTT 6 8
mmu-let-7a-5p GTGGTAGTAGGTTGTATAGT 4 2
mmu-let-7a-5p GTGGTAGTAGGTTGTATAGT 4 2
mmu-let-7a-5p TNGAGGTAGTAGGTTGTATAGTT 34 1
mmu-let-7a-5p TGAGGTAGGNGGTTGTATAGTTTA 4 2
mmu-let-7a-5p TNAGGTACTAGGTTGTATAGTT 7 2
mmu-let-7a-5p TNAGGTACTAGGTTGTATAGTT 7 2
mmu-let-7a-5p GNAGTAGGTTGTATAGTT 30 3
mmu-let-7a-5p GNAGTAGGTTGTATAGTT 30 3
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTAT 5 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTAT 5 2
mmu-let-7a-5p TTAGGTAGTAGGTTGTGTAGTT 2 5
mmu-let-7a-5p TTAGGTAGTAGGTTGTGTAGTT 2 5
mmu-let-7a-5p GGTANTAGGTTGTATAGTT 5 2
mmu-let-7a-5p GGTANTAGGTTGTATAGTT 5 2
mmu-let-7a-5p TGCGGTAGTAGGTTGAATAGTT 181 2
mmu-let-7a-5p TGCGGTAGTAGGTTGAATAGTT 181 2
mmu-let-7a-5p TGCGGTAGTAGGCTGTATAGTT 3 2
mmu-let-7a-5p TGCGGTAGTAGGCTGTATAGTT 3 2
mmu-let-7a-5p GAGGTAGTAGGTTGTCTAGT 7 2
mmu-let-7a-5p GAGGTAGTAGGTTGTCTAGT 7 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTC 6 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTC 6 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTA 218 4
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTA 218 4
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTG 20 4
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTG 20 4
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGTT 31 2
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGTT 31 2
mmu-let-7a-5p TAGGTAGTANGTTGTATAGTT 2 2
mmu-let-7a-5p TAGGTAGTANGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTGTAGTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTGGTGTAGTT 2 3
mmu-let-7a-5p TGAGNTAGTAGATTGTATAGTTTA 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTGCAGTT 3 6
mmu-let-7a-5p TGAGGTAGTAGGTTGTGCAGTT 3 6
mmu-let-7a-5p GAGGTATTAGGTTGTATAGTT 3 2
mmu-let-7a-5p GAGGTATTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TNGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TNGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTCT 7 1
mmu-let-7a-5p TGAGGTAGGATGTTGTATAGTTT 23 3
mmu-let-7a-5p TGAGGTAGGATGTTGTATAGTTT 23 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGT 583 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGT 583 3
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTTA 7 1
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTTT 7 1
mmu-let-7a-5p TGAGGCAGTAGGTTGTAT 7 6
mmu-let-7a-5p TGAGGCAGTAGGTTGTAT 7 6
mmu-let-7a-5p TGAGGTAGTAGGTNGTATTGT 3 5
mmu-let-7a-5p TGAGGTAGTAGGTNGTATTGT 3 5
mmu-let-7a-5p TGAGGTCGNAGGTTGTATAGT 2 3
mmu-let-7a-5p TGAGGTCGNAGGTTGTATAGT 2 3
mmu-let-7a-5p TGAGGCCGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGGCCGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p GTAGTAGGTTGTATAGTTT 38 2
mmu-let-7a-5p GTAGTAGGTTGTATAGTTT 38 2
mmu-let-7a-5p GTAGTAGGTTGTATAGTTC 2 3
mmu-let-7a-5p GTAGTAGGTTGTATAGTTC 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTCTAG 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTCTAG 2 2
mmu-let-7a-5p GTAGTAGGTTGTATAGTTA 63 4
mmu-let-7a-5p GTAGTAGGTTGTATAGTTA 63 4
mmu-let-7a-5p GTAGTAGGTTGTATAGTTG 5 4
mmu-let-7a-5p GTAGTAGGTTGTATAGTTG 5 4
mmu-let-7a-5p GAGGTAGTAGGTTNTATAGTTT 5 2
mmu-let-7a-5p GAGGTAGTAGGTTNTATAGTTT 5 2
mmu-let-7a-5p GAGGTAGTAGGTTNTATAGTTA 10 2
mmu-let-7a-5p GAGGTAGTAGGTTNTATAGTTA 10 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTGA 4 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTGA 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTTTA 462 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTT 195 2
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTT 195 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGT 701 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGG 17 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGG 17 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGC 61 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGC 61 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTGTAG 4 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTAA 81 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTAG 19 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTAG 19 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTAT 48 1
mmu-let-7a-5p TGAGGGAGTAGGTTGTAT 30 9
mmu-let-7a-5p TGAGGGAGTAGGTTGTAT 30 9
mmu-let-7a-5p TGAGGTAGTAGGTTGAAGA 2 42
mmu-let-7a-5p TGAGGTAGTAGGTTGAAGA 2 42
mmu-let-7a-5p GTNGTAGGTTGTATAGTT 8 2
mmu-let-7a-5p GTNGTAGGTTGTATAGTT 8 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTT 625 1
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTA 5 1
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTG 4 4
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTG 4 4
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTC 3 2
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTC 3 2
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTA 25 2
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTA 25 2
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTT 19 2
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGTTT 19 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-5p TGAGTTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-5p TGAGGTAGTANCTTGTATAGTT 949 4
mmu-let-7a-5p TGAGGTAGTANCTTGTATAGTT 949 4
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTT 167 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTT 167 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTG 37 4
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTG 37 4
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTA 207 3
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTA 207 3
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTC 5 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGTTC 5 2
mmu-let-7a-5p TGGGTAGTAGGTTGTATAGTT 24 3
mmu-let-7a-5p TGGGTAGTAGGTTGTATAGTT 24 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTT 519 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTT 519 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTC 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTC 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGGATAGT 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGGATAGT 6 2
mmu-let-7a-5p TGNGTTAGTAGGTTGTATAGT 5 3
mmu-let-7a-5p TGNGTTAGTAGGTTGTATAGT 5 3
mmu-let-7a-5p TGAGNTAGTAGGTTGTATAGTTTT 9 1
mmu-let-7a-5p AGTAGTAGGTTGTATAGT 2 5
mmu-let-7a-5p AGTAGTAGGTTGTATAGT 2 5
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTTAT 11 1
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTTAA 31 1
mmu-let-7a-5p GGTNGTAGGTTGTATAGT 4 2
mmu-let-7a-5p GGTNGTAGGTTGTATAGT 4 2
mmu-let-7a-5p NGTAGTAGGTTGTATAGTT 15 2
mmu-let-7a-5p NGTAGTAGGTTGTATAGTT 15 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGCT 3 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGCT 3 2
mmu-let-7a-5p TGNGGGAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGNGGGAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGGGGCAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TGGGGCAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TAGNAGGTTGTATAGTTA 3 16
mmu-let-7a-5p TAGNAGGTTGTATAGTTA 3 16
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGT 164 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGT 164 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGA 3 7
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGA 3 7
mmu-let-7a-5p TGAGNTAGTCGGTTGTATAGT 4 2
mmu-let-7a-5p TGAGNTAGTCGGTTGTATAGT 4 2
mmu-let-7a-5p TGAGGTAGTAGTTTGTATA 2 5
mmu-let-7a-5p TGAGGTAGTAGTTTGTATA 2 5
mmu-let-7a-5p GGTAGTAGATTGTATAGTTAA 2 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAGTTA 7 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAGTTA 7 4
mmu-let-7a-5p GAGGTAGTAGGTNGTATAGA 3 3
mmu-let-7a-5p GAGGTAGTAGGTNGTATAGA 3 3
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTT 5327 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTT 5327 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTG 3 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTG 3 2
mmu-let-7a-5p TGAGATAGTAGGTTGTATAGT 10 2
mmu-let-7a-5p TGAGATAGTAGGTTGTATAGT 10 2
mmu-let-7a-5p GAGGTAGTAGGGTGTATAGTT 9 2
mmu-let-7a-5p GAGGTAGTAGGGTGTATAGTT 9 2
mmu-let-7a-5p CTGAGGTAGTAGGTTGTATAGTT 35 3
mmu-let-7a-5p CTGAGGTAGTAGGTTGTATAGTT 35 3
mmu-let-7a-5p AGTAGGTTGTATAGT 61 9
mmu-let-7a-5p AGTAGGTTGTATAGT 61 9
mmu-let-7a-5p GGTAGTAGGTTGGATAGTT 3 3
mmu-let-7a-5p GGTAGTAGGTTGGATAGTT 3 3
mmu-let-7a-5p TGAGGAGGTAGGTTGTATAGTT 9 4
mmu-let-7a-5p TGAGGAGGTAGGTTGTATAGTT 9 4
mmu-let-7a-5p TGAGGGAGTAGGTTGTACAGTT 3 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTACAGTT 3 3
mmu-let-7a-5p TTNAGGTAGTAGGTTGTATAGT 3 1
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTTA 2 1
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTTAA 2 1
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTGA 8 2
mmu-let-7a-5p TGTGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGTGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TTGNGGTAGTAGGTTGTATAGTT 9 1
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTGT 5 2
mmu-let-7a-5p TGAGGAGGTAGGTTGTATAGT 4 5
mmu-let-7a-5p TGAGGAGGTAGGTTGTATAGT 4 5
mmu-let-7a-5p TGTGGTAGTAGGTTGTATAGTT 131 2
mmu-let-7a-5p TGTGGTAGTAGGTTGTATAGTT 131 2
mmu-let-7a-5p TTANGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TTANGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTTG 5 4
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTTG 5 4
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTTA 20 2
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTTA 20 2
mmu-let-7a-5p TGAGGTAATAGGTTGTATAG 2 2
mmu-let-7a-5p TGAGGTAATAGGTTGTATAG 2 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTTA 10 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATA 30 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATA 30 2
mmu-let-7a-5p GGAAGTAGGTTGTATAGTT 8 4
mmu-let-7a-5p GGAAGTAGGTTGTATAGTT 8 4
mmu-let-7a-5p TGGGTAGTAGGTTGTATAGT 9 7
mmu-let-7a-5p TGGGTAGTAGGTTGTATAGT 9 7
mmu-let-7a-5p AGGAGGTAGTAGGTTGTATAGTT 2 1
mmu-let-7a-5p TGAGNTATTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGNTATTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTATGTTGTATAGTT 56 2
mmu-let-7a-5p TGAGGTAGTATGTTGTATAGTT 56 2
mmu-let-7a-5p TGAGNTAGTAGGTTGTATAGTTTTA 2 1
mmu-let-7a-5p TNAGGTAGTAGGTTGTATTGT 7 6
mmu-let-7a-5p TNAGGTAGTAGGTTGTATTGT 7 6
mmu-let-7a-5p TGAGGTTGTAGGTTGTATAGTT 35 2
mmu-let-7a-5p TGAGGTTGTAGGTTGTATAGTT 35 2
mmu-let-7a-5p CAGGTAGTAGGTTGTATAGTT 31 2
mmu-let-7a-5p CAGGTAGTAGGTTGTATAGTT 31 2
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTT 12 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTT 12 3
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGA 11 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGA 11 2
mmu-let-7a-5p TGTAGTAGGTTGTATAG 6 20
mmu-let-7a-5p TGTAGTAGGTTGTATAG 6 20
mmu-let-7a-5p NAGGTAGTAGGTTGTATAGTTA 4 3
mmu-let-7a-5p NAGGTAGTAGGTTGTATAGTTA 4 3
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTT 56 1
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTA 51 1
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTG 8 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTG 8 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTC 4 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTC 4 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTTAG 2 1
mmu-let-7a-5p TGAGGTAGTAGGTNGTATGGTTTTA 3 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTTT 5 1
mmu-let-7a-5p TGAGGTACTAGGTTGTATAGT 32 2
mmu-let-7a-5p TGAGGTACTAGGTTGTATAGT 32 2
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p GAANTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p GAANTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGGAGGTNGTATAGTTT 50 3
mmu-let-7a-5p TGAGGTAGGAGGTNGTATAGTTT 50 3
mmu-let-7a-5p TNAGGTAGTAGGTTG 28 14
mmu-let-7a-5p TNAGGTAGTAGGTTG 28 14
mmu-let-7a-5p GAGGTAGTAGGTGGTATAGTT 4 2
mmu-let-7a-5p GAGGTAGTAGGTGGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTT 4591 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTT 4591 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATCGT 3 4
mmu-let-7a-5p TNAGGTAGTAGGTTGTATCGT 3 4
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGAT 2 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGAT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTGAC 4 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATCGTT 2 4
mmu-let-7a-5p TGAGGTAGTAGGNTGTATCGTT 2 4
mmu-let-7a-5p GNTAGTAGGTTGTATAGT 55 2
mmu-let-7a-5p GNTAGTAGGTTGTATAGT 55 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTT 2026 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTT 2026 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTA 12 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTA 12 2
mmu-let-7a-5p TGCGGTAGTAGGTTGAATAGT 26 3
mmu-let-7a-5p TGCGGTAGTAGGTTGAATAGT 26 3
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGTT 212 2
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGTT 212 2
mmu-let-7a-5p GGTAGTAGGTTGTATCGTT 11 5
mmu-let-7a-5p GGTAGTAGGTTGTATCGTT 11 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAG 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAG 2 2
mmu-let-7a-5p TGAGNTAGTCGGTTGTATAGTT 31 2
mmu-let-7a-5p TGAGNTAGTCGGTTGTATAGTT 31 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTAT 3 7
mmu-let-7a-5p TGAGGTAGTAGGGTGTAT 3 7
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTT 80 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTT 80 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTG 15 4
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTG 15 4
mmu-let-7a-5p TGAGGTATTAGGTTGNATAGTT 4 2
mmu-let-7a-5p TGAGGTATTAGGTTGNATAGTT 4 2
mmu-let-7a-5p TAGGTAGTAGNTTGTATAGTT 2 4
mmu-let-7a-5p TAGGTAGTAGNTTGTATAGTT 2 4
mmu-let-7a-5p TNGAGGTAGTAGGTTGTATAGT 14 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTCTCGTT 2 6
mmu-let-7a-5p TGAGGTAGTAGGTTGTCTCGTT 2 6
mmu-let-7a-5p GTAGTAGGTTGTNTAGTT 5 2
mmu-let-7a-5p GTAGTAGGTTGTNTAGTT 5 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTAAG 2 1
mmu-let-7a-5p TGAGGCAGNAGGTTGTATAGTT 9 4
mmu-let-7a-5p TGAGGCAGNAGGTTGTATAGTT 9 4
mmu-let-7a-5p GGTAGTAGGTTGTNTAGTT 21 2
mmu-let-7a-5p GGTAGTAGGTTGTNTAGTT 21 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTAT 6 1
mmu-let-7a-5p GGGGTAGTAGGTTGTATAGT 12 2
mmu-let-7a-5p GGGGTAGTAGGTTGTATAGT 12 2
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGGTT 2 3
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGGTT 2 3
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTAA 7 1
mmu-let-7a-5p TNAGGTAGTAGGTTGCATAGTT 2 3
mmu-let-7a-5p TNAGGTAGTAGGTTGCATAGTT 2 3
mmu-let-7a-5p TGTAGTAGGTTGTATAGTT 96 3
mmu-let-7a-5p TGTAGTAGGTTGTATAGTT 96 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTATT 2 1
mmu-let-7a-5p TGAGGTGGTAGGTTGTATTGTT 2 8
mmu-let-7a-5p TGAGGTGGTAGGTTGTATTGTT 2 8
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAG 130 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAG 130 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAA 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAA 2 3
mmu-let-7a-5p GAGGTAGTAGGTTGTATGGTTTAAG 2 4
mmu-let-7a-5p ATGAGGTAGTAGGTTGTATAGTA 2 1
mmu-let-7a-5p ATGAGGTAGTAGGTTGTATAGTT 89 1
mmu-let-7a-5p TGAGGTAGTAGCTTGTGTAGTT 2 5
mmu-let-7a-5p TGAGGTAGTAGCTTGTGTAGTT 2 5
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGTTAA 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTT 26 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTT 26 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTA 43 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTA 43 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTG 6 5
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTG 6 5
mmu-let-7a-5p GTAGTAGGTNGTATAGTTA 2 6
mmu-let-7a-5p GTAGTAGGTNGTATAGTTA 2 6
mmu-let-7a-5p GTAGTAGGTTGTATTGTT 2 15
mmu-let-7a-5p GTAGTAGGTTGTATTGTT 2 15
mmu-let-7a-5p GAGGTAGTAGGCTGTCTAGTT 2 3
mmu-let-7a-5p GAGGTAGTAGGCTGTCTAGTT 2 3
mmu-let-7a-5p TGAGGAAGTAGGTTGCATAGTT 2 6
mmu-let-7a-5p TGAGGAAGTAGGTTGCATAGTT 2 6
mmu-let-7a-5p TAGTAGGTTGTATAGTA 4 17
mmu-let-7a-5p TAGTAGGTTGTATAGTA 4 17
mmu-let-7a-5p TGAGGCAGTANGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGCAGTANGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGCT 2 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGCT 2 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTAGAGT 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAGAGT 6 2
mmu-let-7a-5p GAGGCAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p GAGGCAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGT 288 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGT 288 2
mmu-let-7a-5p GNAGTAGGTTGTATAGTTAA 2 2
mmu-let-7a-5p GAGGTAGTAGNCTGTATAGTT 12 4
mmu-let-7a-5p GAGGTAGTAGNCTGTATAGTT 12 4
mmu-let-7a-5p GGGNGTAGGTTGTATAGTT 12 6
mmu-let-7a-5p GGGNGTAGGTTGTATAGTT 12 6
mmu-let-7a-5p GAGGNAGTCGGTTGTATAGT 3 2
mmu-let-7a-5p GAGGNAGTCGGTTGTATAGT 3 2
mmu-let-7a-5p TGTNGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGTNGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p GATAGTAGGTTGTATAGTT 8 3
mmu-let-7a-5p GATAGTAGGTTGTATAGTT 8 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTA 3541 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTA 3541 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTC 165 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTC 165 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTG 183 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTG 183 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTN 18 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTN 18 2
mmu-let-7a-5p TGAGGTAGTAGCTTGTATTGTT 5 8
mmu-let-7a-5p TGAGGTAGTAGCTTGTATTGTT 5 8
mmu-let-7a-5p TGAGGTAGNAGGTTGTATAGTTC 27 3
mmu-let-7a-5p TGAGGTAGNAGGTTGTATAGTTC 27 3
mmu-let-7a-5p GTAGNAGGTTGTATAGTT 7 3
mmu-let-7a-5p GTAGNAGGTTGTATAGTT 7 3
mmu-let-7a-5p TGTGGTAGTAGGTTGTATAG 6 2
mmu-let-7a-5p TGTGGTAGTAGGTTGTATAG 6 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTGA 13 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTGT 11 2
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTTT 16 2
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTTT 16 2
mmu-let-7a-5p GGTCGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p GGTCGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TTAGGTAGTAGGGTGTATAGTT 2 2
mmu-let-7a-5p TTAGGTAGTAGGGTGTATAGTT 2 2
mmu-let-7a-5p TTGGGGTAGTAGGTTGTATAGT 2 1
mmu-let-7a-5p GANGTAGTAGGTTGTATAGTTAA 2 1
mmu-let-7a-5p TGAGGTAGTNGGTTGTAT 34 4
mmu-let-7a-5p TGAGGTAGTNGGTTGTAT 34 4
mmu-let-7a-5p TGAGGTAGTNGGTTGTAA 2 26
mmu-let-7a-5p TGAGGTAGTNGGTTGTAA 2 26
mmu-let-7a-5p GAGGTAGTAGGTTGTGTAGT 3 3
mmu-let-7a-5p GAGGTAGTAGGTTGTGTAGT 3 3
mmu-let-7a-5p TGAGGTAGTAAGTTGTATAGT 3 3
mmu-let-7a-5p TGAGGTAGTAAGTTGTATAGT 3 3
mmu-let-7a-5p GGTAGTAGGTTGTATAG 31 2
mmu-let-7a-5p GGTAGTAGGTTGTATAG 31 2
mmu-let-7a-5p TGAGGTAGTAGATTGTATAGTTAAGA 2 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATAA 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAA 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAG 261 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAG 261 2
mmu-let-7a-5p GAGGTAGTAGGTTGTNTAGTTT 9 2
mmu-let-7a-5p GAGGTAGTAGGTTGTNTAGTTT 9 2
mmu-let-7a-5p GAGGTAGTAGGTTGTNTAGTTA 8 2
mmu-let-7a-5p GAGGTAGTAGGTTGTNTAGTTA 8 2
mmu-let-7a-5p TNGGGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-5p TNGGGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-5p TGANGTAGGAGGTTGTATAGTTTA 3 2
mmu-let-7a-5p GAGGTAGTAGGTTTTATAGTTA 3 3
mmu-let-7a-5p GAGGTAGTAGGTTTTATAGTTA 3 3
mmu-let-7a-5p TGCGGTAGTAGGTTG 6 34
mmu-let-7a-5p TGCGGTAGTAGGTTG 6 34
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTAT 6 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTAT 6 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTAA 25 3
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTAA 25 3
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTAG 4 5
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTAG 4 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGT 56 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGT 56 3
mmu-let-7a-5p TAGTAGGTTNTATAGTT 7 4
mmu-let-7a-5p TAGTAGGTTNTATAGTT 7 4
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAGTTTA 2 1
mmu-let-7a-5p GGTAGTAGGTTGAATAGTT 3 3
mmu-let-7a-5p GGTAGTAGGTTGAATAGTT 3 3
mmu-let-7a-5p TTAGGTAGTAGGTTGTATTGTT 5 6
mmu-let-7a-5p TTAGGTAGTAGGTTGTATTGTT 5 6
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTTT 7 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTTGTT 4 9
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTTGTT 4 9
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTTA 5 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTGT 6 2
mmu-let-7a-5p TCCGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TCCGGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATTGTT 11 5
mmu-let-7a-5p TGAGGGAGTAGGTTGTATTGTT 11 5
mmu-let-7a-5p TGAGGTAGTAGGTAGTAT 7 8
mmu-let-7a-5p TGAGGTAGTAGGTAGTAT 7 8
mmu-let-7a-5p ATGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p ATGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTA 46 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTA 46 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTC 3 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTC 3 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTG 5 4
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTG 5 4
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTT 22 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGTTT 22 2
mmu-let-7a-5p TGAGGTAGTANGTTGTACAGTT 73 3
mmu-let-7a-5p TGAGGTAGTANGTTGTACAGTT 73 3
mmu-let-7a-5p GAGGTAGGAGGTTGTCTAGTTT 2 4
mmu-let-7a-5p GAGGTAGGAGGTTGTCTAGTTT 2 4
mmu-let-7a-5p TGCGGTAGTAGGTTGCATAG 8 4
mmu-let-7a-5p TGCGGTAGTAGGTTGCATAG 8 4
mmu-let-7a-5p TGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TNAGGTATTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TNAGGTATTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTTT 8 1
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTTG 2 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTTG 2 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATA 7 4
mmu-let-7a-5p TGAGGGAGTAGGTTGTATA 7 4
mmu-let-7a-5p TAGTAGGTTGTATAGNT 5 2
mmu-let-7a-5p TAGTAGGTTGTATAGNT 5 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTA 602 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTA 602 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTG 72 4
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTG 72 4
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTC 15 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTC 15 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTT 383 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTT 383 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTTTAG 11 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTTTAT 54 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTTTAC 2 2
mmu-let-7a-5p GTAGTAGGTTGTAT 4 20
mmu-let-7a-5p GTAGTAGGTTGTAT 4 20
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTT 363 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTT 363 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTA 572 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTA 572 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTC 10 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTC 10 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTG 57 4
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTG 57 4
mmu-let-7a-5p TGGGGTAGTAGGTTGTATTGTTT 2 4
mmu-let-7a-5p TGGGGTAGTAGGTTGTATTGTTT 2 4
mmu-let-7a-5p TGAGGCAGTAGGCTGTATAGTT 2 2
mmu-let-7a-5p TGAGGCAGTAGGCTGTATAGTT 2 2
mmu-let-7a-5p GATAGTAGGTTGTATAGT 2 4
mmu-let-7a-5p GATAGTAGGTTGTATAGT 2 4
mmu-let-7a-5p TNAGGTATTAGGTTGTATAGT 3 3
mmu-let-7a-5p TNAGGTATTAGGTTGTATAGT 3 3
mmu-let-7a-5p TGAGGAAGNAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGAGGAAGNAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGAGGTAGTACGTTGTATAGTTT 3 2
mmu-let-7a-5p TGAGGTAGTACGTTGTATAGTTT 3 2
mmu-let-7a-5p TGAGGTAGTACGTTGTATAGTTA 2 2
mmu-let-7a-5p TGAGGTAGTACGTTGTATAGTTA 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGGTT 5 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGGTT 5 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGGTA 5 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGGTA 5 3
mmu-let-7a-5p TGAGGTAATAGGTTGTATAGT 12 2
mmu-let-7a-5p TGAGGTAATAGGTTGTATAGT 12 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTAA 14 1
mmu-let-7a-5p GGGAGTAGGTTGTATAGT 8 7
mmu-let-7a-5p GGGAGTAGGTTGTATAGT 8 7
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTTA 37 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTTA 37 4
mmu-let-7a-5p TGAGGGTGTAGGTTGTATAGT 2 4
mmu-let-7a-5p TGAGGGTGTAGGTTGTATAGT 2 4
mmu-let-7a-5p TGGNGTAGTAGGTTGTATAGTTTT 2 1
mmu-let-7a-5p TNAGGTAGCAGGTTGTATAGT 3 4
mmu-let-7a-5p TNAGGTAGCAGGTTGTATAGT 3 4
mmu-let-7a-5p TGAGNTAGTAGGTTGTATAGTTAT 29 1
mmu-let-7a-5p TGAGNTAGTAGGTTGTATAGTTAA 52 1
mmu-let-7a-5p NAGGTAGTAGGTTGTATAG 2 2
mmu-let-7a-5p NAGGTAGTAGGTTGTATAG 2 2
mmu-let-7a-5p TGAGNTAGTAGGTTGTATCGTT 4 4
mmu-let-7a-5p TGAGNTAGTAGGTTGTATCGTT 4 4
mmu-let-7a-5p TGGGGTAGGAGGTTGTATAGTTTA 2 3
mmu-let-7a-5p NGAGGTAGTAGGTTGTATTGTT 5 5
mmu-let-7a-5p NGAGGTAGTAGGTTGTATTGTT 5 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGTTAA 6 1
mmu-let-7a-5p TGAGNTAGGAGGTTGTATAGTTT 36 3
mmu-let-7a-5p TGAGNTAGGAGGTTGTATAGTTT 36 3
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGT 5 3
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGT 5 3
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGG 2 9
mmu-let-7a-5p GAGGGAGTAGGTTGTATAGG 2 9
mmu-let-7a-5p TGAGGTAGTANCTTGTATAG 17 5
mmu-let-7a-5p TGAGGTAGTANCTTGTATAG 17 5
mmu-let-7a-5p TGAGGTAGTAGGTNGTAT 30 4
mmu-let-7a-5p TGAGGTAGTAGGTNGTAT 30 4
mmu-let-7a-5p GTAGTAGGTTGTATAG 12 2
mmu-let-7a-5p GTAGTAGGTTGTATAG 12 2
mmu-let-7a-5p TGCGGTGGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p TGCGGTGGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p GAGGTAGTAGGTTGTTTAGTT 3 2
mmu-let-7a-5p GAGGTAGTAGGTTGTTTAGTT 3 2
mmu-let-7a-5p GTAGTAGGTTGTAAAGTT 2 7
mmu-let-7a-5p GTAGTAGGTTGTAAAGTT 2 7
mmu-let-7a-5p TGAGGTATGAGGTTGTATAGTTT 4 3
mmu-let-7a-5p TGAGGTATGAGGTTGTATAGTTT 4 3
mmu-let-7a-5p TNAGGTAGTAGGTTGTGTAGTTT 3 3
mmu-let-7a-5p TNAGGTAGTAGGTTGTGTAGTTT 3 3
mmu-let-7a-5p GAGGTAGTAGGTTGTGTAGTT 2 3
mmu-let-7a-5p GAGGTAGTAGGTTGTGTAGTT 2 3
mmu-let-7a-5p NGATGTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p NGATGTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p TTAGGTAGGAGGTTGTATAGTTTT 2 1
mmu-let-7a-5p TGANGTAGTAGATTGTATAGTTTA 4 2
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTG 6 5
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTG 6 5
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTC 2 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTC 2 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTA 27 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTA 27 3
mmu-let-7a-5p TGAGGTAGTAGGTNGTATTGTT 7 5
mmu-let-7a-5p TGAGGTAGTAGGTNGTATTGTT 7 5
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAGTTAT 8 1
mmu-let-7a-5p TAGTAGGTTGTATAGTT 552 2
mmu-let-7a-5p TAGTAGGTTGTATAGTT 552 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGTTGA 3 4
mmu-let-7a-5p GAGGTAGTAGGTTGTNTAG 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTNTAG 2 2
mmu-let-7a-5p TGNGGTAGTGGGTTGTATAGTT 2 2
mmu-let-7a-5p TGNGGTAGTGGGTTGTATAGTT 2 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATATT 3 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATATT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTGA 7 2
mmu-let-7a-5p TGAGGTGGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGAGGTGGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p GTAGGTTGTATAGTT 6011 7
mmu-let-7a-5p GTAGGTTGTATAGTT 6011 7
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTGA 4 2
mmu-let-7a-5p ANGTAGTAGGTTGTATAGTTA 2 4
mmu-let-7a-5p ANGTAGTAGGTTGTATAGTTA 2 4
mmu-let-7a-5p GAGGGAGTAGGTTNTATAGTT 2 2
mmu-let-7a-5p GAGGGAGTAGGTTNTATAGTT 2 2
mmu-let-7a-5p NAGGTAGTAGGTTGTATAGTTT 4 2
mmu-let-7a-5p NAGGTAGTAGGTTGTATAGTTT 4 2
mmu-let-7a-5p GGTAGTCGGTTGTATAGTT 2 2
mmu-let-7a-5p GGTAGTCGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGTTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGAGTTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGA 12 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGA 12 2
mmu-let-7a-5p TAGGTAGTAGGGTGTATAGTT 2 4
mmu-let-7a-5p TAGGTAGTAGGGTGTATAGTT 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTATAA 2 1
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGT 55 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGT 55 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTAA 75 1
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTATT 2 2
mmu-let-7a-5p TGAGGTAGTAGTTTGAATAGTT 5 8
mmu-let-7a-5p TGAGGTAGTAGTTTGAATAGTT 5 8
mmu-let-7a-5p TGCGGAAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGCGGAAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p GAGGTAGTAGCTTGTATAGTT 3 4
mmu-let-7a-5p GAGGTAGTAGCTTGTATAGTT 3 4
mmu-let-7a-5p TGAGGTGGTAGGCTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTGGTAGGCTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTCGTCGGTTGTATAGTT 6 2
mmu-let-7a-5p TGAGGTCGTCGGTTGTATAGTT 6 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATTGTT 15 5
mmu-let-7a-5p GAGGTAGTAGGTTGTATTGTT 15 5
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTTTA 5 1
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTTTT 3 1
mmu-let-7a-5p TGANGTAGTAGGTTG 10 15
mmu-let-7a-5p TGANGTAGTAGGTTG 10 15
mmu-let-7a-5p GAGGTAGTAGGTTGCATAGTTAA 19 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGT 220 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGT 220 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGA 3 5
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGA 3 5
mmu-let-7a-5p GAGGTAGTAGGTCGTATAGTT 22 2
mmu-let-7a-5p GAGGTAGTAGGTCGTATAGTT 22 2
mmu-let-7a-5p ATGAGGTAGTAGGTTGTATGGTT 14 3
mmu-let-7a-5p TGAGNTAGTAGGTTGTATATTT 3 3
mmu-let-7a-5p TGAGNTAGTAGGTTGTATATTT 3 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGT 64 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGT 64 3
mmu-let-7a-5p TGAGGTAGGANGTTGTATAGTTT 3 3
mmu-let-7a-5p TGAGGTAGGANGTTGTATAGTTT 3 3
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTAT 34 1
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGTTAA 53 1
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGT 234 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGT 234 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGA 3 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAGA 3 2
mmu-let-7a-5p TGATGTAGTAGGTTGTATA 2 4
mmu-let-7a-5p TGATGTAGTAGGTTGTATA 2 4
mmu-let-7a-5p TGAGGTAGTACGTTGTATAG 5 2
mmu-let-7a-5p TGAGGTAGTACGTTGTATAG 5 2
mmu-let-7a-5p CTGAGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p CTGAGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TTAGGTAGTAGGCTGTATAGTT 3 2
mmu-let-7a-5p TTAGGTAGTAGGCTGTATAGTT 3 2
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGT 111 3
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGT 111 3
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGG 2 10
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGG 2 10
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTTT 58 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTTT 58 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTTC 11 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTTC 11 4
mmu-let-7a-5p GAGNTAGTAGGTTGTATAG 3 2
mmu-let-7a-5p GAGNTAGTAGGTTGTATAG 3 2
mmu-let-7a-5p TGAGGCAGTAGGTTGAATAGTT 2 2
mmu-let-7a-5p TGAGGCAGTAGGTTGAATAGTT 2 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTT 1858 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTT 1858 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTA 2899 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTA 2899 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTC 83 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTC 83 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTG 318 4
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTG 318 4
mmu-let-7a-5p AGGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-5p AGGTAGTAGGTTGTATAGTC 2 2
mmu-let-7a-5p GCGGTAGTAGGTTGTATAGT 5 2
mmu-let-7a-5p GCGGTAGTAGGTTGTATAGT 5 2
mmu-let-7a-5p TAGGTTGTAGGTTGTATAGTT 5 3
mmu-let-7a-5p TAGGTTGTAGGTTGTATAGTT 5 3
mmu-let-7a-5p TGAGGTCGGAGGTTGTATAGTTT 3 4
mmu-let-7a-5p TGAGGTCGGAGGTTGTATAGTTT 3 4
mmu-let-7a-5p TGGTAGTAGGTTGTATAGTT 70 2
mmu-let-7a-5p TGGTAGTAGGTTGTATAGTT 70 2
mmu-let-7a-5p TGCGGTAGGAGGTTGTATAGTTT 38 4
mmu-let-7a-5p TGCGGTAGGAGGTTGTATAGTTT 38 4
mmu-let-7a-5p TGAGGTAGTAGGTCGTGTAGT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTCGTGTAGT 2 3
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTGTAG 3 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTTT 12 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTTT 12 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTTG 8 4
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTTG 8 4
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTTA 17 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTTA 17 2
mmu-let-7a-5p GGGCGTAGGTTGTATAGTT 4 11
mmu-let-7a-5p GGGCGTAGGTTGTATAGTT 4 11
mmu-let-7a-5p TGAGGAAGTAGGTTGTA 8 44
mmu-let-7a-5p TGAGGAAGTAGGTTGTA 8 44
mmu-let-7a-5p TGAGGTAGTAGGNTGTATTGT 2 5
mmu-let-7a-5p TGAGGTAGTAGGNTGTATTGT 2 5
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTTT 23 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTTT 23 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTTA 31 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTTA 31 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTAA 13 1
mmu-let-7a-5p GAGGTAGTANGTTGTATAGT 9 2
mmu-let-7a-5p GAGGTAGTANGTTGTATAGT 9 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNAT 38 4
mmu-let-7a-5p TGAGGTAGTAGGTTGNAT 38 4
mmu-let-7a-5p AGGGAGTAGGTTGTATAGTT 11 3
mmu-let-7a-5p AGGGAGTAGGTTGTATAGTT 11 3
mmu-let-7a-5p TGAGGTAGTATGTTGTATAGTTGT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTGA 5 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTGT 41 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTGT 41 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTGC 7 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTGC 7 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTGA 137 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTGA 137 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAA 60 16
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAA 60 16
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTGT 7 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTGA 10 2
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTGTA 27 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTAAA 12 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTAAT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTAAT 2 2
mmu-let-7a-5p GAGGTTGTAGGTTGTATAGTT 36 2
mmu-let-7a-5p GAGGTTGTAGGTTGTATAGTT 36 2
mmu-let-7a-5p TGAGGCAGTAGATTGTATAGTTTA 2 2
mmu-let-7a-5p TGGGGTAGTAGGTTGCATAGTT 11 4
mmu-let-7a-5p TGGGGTAGTAGGTTGCATAGTT 11 4
mmu-let-7a-5p GANGTAGTAGGTTGTATAG 4 2
mmu-let-7a-5p GANGTAGTAGGTTGTATAG 4 2
mmu-let-7a-5p TGTAGGAGGTTGTATAGTTT 8 21
mmu-let-7a-5p TGTAGGAGGTTGTATAGTTT 8 21
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTATAG 12 2
mmu-let-7a-5p GNGGTAGTAGGTTGTATA 2 2
mmu-let-7a-5p GNGGTAGTAGGTTGTATA 2 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTTAA 3 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTTAA 3 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATTGT 2 9
mmu-let-7a-5p TGAGGTAGTAGGTAGTATTGT 2 9
mmu-let-7a-5p TGAGATAGTAGGTTGTATAGTTT 4 2
mmu-let-7a-5p TGAGATAGTAGGTTGTATAGTTT 4 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTGT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAG 43 3
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAG 43 3
mmu-let-7a-5p GGTAGTAGGTTGNATAGT 7 3
mmu-let-7a-5p GGTAGTAGGTTGNATAGT 7 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATNGTTA 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATNGTTA 2 4
mmu-let-7a-5p TNAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TNAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p AGGAGGTTGTATAGTTT 2 21
mmu-let-7a-5p AGGAGGTTGTATAGTTT 2 21
mmu-let-7a-5p GGTAGTAGGTTGTTTAGT 5 3
mmu-let-7a-5p GGTAGTAGGTTGTTTAGT 5 3
mmu-let-7a-5p TGAGGGAGGAGGTTGTATAGTTTT 2 1
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTAA 19 1
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTAT 12 1
mmu-let-7a-5p TGAGGTAGTAGTTTGGATAGTT 2 5
mmu-let-7a-5p TGAGGTAGTAGTTTGGATAGTT 2 5
mmu-let-7a-5p TTGCGGTAGTAGGTTGTATAGTT 11 1
mmu-let-7a-5p TGAGGTAGTAGGNTG 9 22
mmu-let-7a-5p TGAGGTAGTAGGNTG 9 22
mmu-let-7a-5p AGGGAGTAGGTTGTATAGT 3 6
mmu-let-7a-5p AGGGAGTAGGTTGTATAGT 3 6
mmu-let-7a-5p TGAGGTAGTANGTTGTA 4 7
mmu-let-7a-5p TGAGGTAGTANGTTGTA 4 7
mmu-let-7a-5p GNTAGTAGGTTGTATAGTTT 3 2
mmu-let-7a-5p GNTAGTAGGTTGTATAGTTT 3 2
mmu-let-7a-5p GNTAGTAGGTTGTATAGTTA 6 5
mmu-let-7a-5p GNTAGTAGGTTGTATAGTTA 6 5
mmu-let-7a-5p GNTAGTAGGTTGTATAGTTG 2 4
mmu-let-7a-5p GNTAGTAGGTTGTATAGTTG 2 4
mmu-let-7a-5p TAGGTAGTAGGTTGTATAG 7 4
mmu-let-7a-5p TAGGTAGTAGGTTGTATAG 7 4
mmu-let-7a-5p TGAGGAAGGAGGTTGTATAGTTT 9 3
mmu-let-7a-5p TGAGGAAGGAGGTTGTATAGTTT 9 3
mmu-let-7a-5p TGNGGTAGTAGGTTGTGTAGTT 3 3
mmu-let-7a-5p TGNGGTAGTAGGTTGTGTAGTT 3 3
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAG 4 2
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAG 4 2
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTTAAA 5 1
mmu-let-7a-5p GAGGTAGTAGGGTGTCTAGTT 5 5
mmu-let-7a-5p GAGGTAGTAGGGTGTCTAGTT 5 5
mmu-let-7a-5p GAGGNAGTAGGTTGTATAGTT 8 2
mmu-let-7a-5p GAGGNAGTAGGTTGTATAGTT 8 2
mmu-let-7a-5p GGGGTAGTAGGTTGTATAG 3 2
mmu-let-7a-5p GGGGTAGTAGGTTGTATAG 3 2
mmu-let-7a-5p TGAGNTAGTCGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGNTAGTCGGTTGTATAGTTT 2 2
mmu-let-7a-5p GGTAGTAGGTTGTTTAGTT 17 3
mmu-let-7a-5p GGTAGTAGGTTGTTTAGTT 17 3
mmu-let-7a-5p TGAGGTAGTACGTNGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTACGTNGTATAGTT 2 2
mmu-let-7a-5p NGAGGTAGTAGTTTGTATAGTT 5 5
mmu-let-7a-5p NGAGGTAGTAGTTTGTATAGTT 5 5
mmu-let-7a-5p TTAGGTAGTAGGNTGTATAGTT 11 2
mmu-let-7a-5p TTAGGTAGTAGGNTGTATAGTT 11 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGTT 780 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGTT 780 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGTA 6 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGTA 6 2
mmu-let-7a-5p NTAGGTTGTATAGTT 21 21
mmu-let-7a-5p NTAGGTTGTATAGTT 21 21
mmu-let-7a-5p TGCGGTAGTAGGCTGTATAGT 2 3
mmu-let-7a-5p TGCGGTAGTAGGCTGTATAGT 2 3
mmu-let-7a-5p GTAGTAGGTNGTATAGTT 8 2
mmu-let-7a-5p GTAGTAGGTNGTATAGTT 8 2
mmu-let-7a-5p GNTAGTAGGTTGTATAGTT 142 2
mmu-let-7a-5p GNTAGTAGGTTGTATAGTT 142 2
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTAA 5 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTGGTTTTA 2 3
mmu-let-7a-5p TAGTAGGTTGTATTGTT 6 44
mmu-let-7a-5p TAGTAGGTTGTATTGTT 6 44
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTT 78 3
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTT 78 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTTTT 11 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTTTC 2 1
mmu-let-7a-5p TGGGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGGGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGGGAGTAGGTTGTATAGTT 3 13
mmu-let-7a-5p TGGGAGTAGGTTGTATAGTT 3 13
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTAT 151 1
mmu-let-7a-5p TAGTAGGTTGTATAGT 84 2
mmu-let-7a-5p TAGTAGGTTGTATAGT 84 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTCA 6 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTCG 7 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTCG 7 2
mmu-let-7a-5p GAGGTAGTAGGTCGTATAGTTA 4 2
mmu-let-7a-5p GAGGTAGTAGGTCGTATAGTTA 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATACTA 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATACTA 2 3
mmu-let-7a-5p TGCTGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGCTGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAGT 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAGT 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAGA 3 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAGA 3 4
mmu-let-7a-5p TGAGGTAGTNGGTTGTATA 14 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATA 14 2
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAG 12 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAG 12 3
mmu-let-7a-5p TGCGGTAGTAGGTTGTATA 7 3
mmu-let-7a-5p TGCGGTAGTAGGTTGTATA 7 3
mmu-let-7a-5p GCTAGTAGGTTGTATAGTT 6 2
mmu-let-7a-5p GCTAGTAGGTTGTATAGTT 6 2
mmu-let-7a-5p TGATGTAGTAGGNTGTATAGTT 2 2
mmu-let-7a-5p TGATGTAGTAGGNTGTATAGTT 2 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTG 13 4
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTG 13 4
mmu-let-7a-5p GGTAGTAGGTTGTATCGT 2 5
mmu-let-7a-5p GGTAGTAGGTTGTATCGT 2 5
mmu-let-7a-5p TNAGGTAGTAGGTTATATAGTTT 2 2
mmu-let-7a-5p TNAGGTAGTAGGTTATATAGTTT 2 2
mmu-let-7a-5p TGAGGTAGTANGTTGTGTA 2 7
mmu-let-7a-5p TGAGGTAGTANGTTGTGTA 2 7
mmu-let-7a-5p GAGGTAGTAGGTCGTATAGT 3 2
mmu-let-7a-5p GAGGTAGTAGGTCGTATAGT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGTTTA 2 1
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGTTTT 3 1
mmu-let-7a-5p GGTAGTTGGTTGTATAGTT 2 3
mmu-let-7a-5p GGTAGTTGGTTGTATAGTT 2 3
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTA 37 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTA 37 2
mmu-let-7a-5p GAGGTAGTANGTTGTATAG 3 2
mmu-let-7a-5p GAGGTAGTANGTTGTATAG 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTCTAGTT 32 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTCTAGTT 32 2
mmu-let-7a-5p TGAGNTAGTAGGTTGTATAGTTGT 5 2
mmu-let-7a-5p TGAGNTAGTAGGTTGTATAGTTGA 9 2
mmu-let-7a-5p TGAGGTATTAGGTTGTAT 3 6
mmu-let-7a-5p TGAGGTATTAGGTTGTAT 3 6
mmu-let-7a-5p TGAGGTAGTAGGNTGTA 10 5
mmu-let-7a-5p TGAGGTAGTAGGNTGTA 10 5
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTT 913 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTT 913 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTA 4 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTA 4 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTA 6 4
mmu-let-7a-5p NGAGGTAGTAGGTTGTA 6 4
mmu-let-7a-5p TGANGTAGTAGGTTGT 4 8
mmu-let-7a-5p TGANGTAGTAGGTTGT 4 8
mmu-let-7a-5p TTAGGTAGTAGGTTGTA 2 14
mmu-let-7a-5p TTAGGTAGTAGGTTGTA 2 14
mmu-let-7a-5p NGAGGTAGTAGGTTGTATATTT 4 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATATTT 4 2
mmu-let-7a-5p TGAGGTAGGAGGTTGAATAGTTT 2 5
mmu-let-7a-5p TGAGGTAGGAGGTTGAATAGTTT 2 5
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGTTA 38 2
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGTTA 38 2
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGTTC 4 2
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGTTC 4 2
mmu-let-7a-5p TGATGTAGGAGGTTGTATAGTTT 33 3
mmu-let-7a-5p TGATGTAGGAGGTTGTATAGTTT 33 3
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTAT 4 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTAT 4 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTTA 3 1
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTTT 6 1
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTT 1082 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTT 1082 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTA 8 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTA 8 2
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGTTTT 3 2
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGTTTA 3 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTAT 2 5
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTAT 2 5
mmu-let-7a-5p TAAGTAGTAGGTTGTATAGTT 3 4
mmu-let-7a-5p TAAGTAGTAGGTTGTATAGTT 3 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTTGA 191 4
mmu-let-7a-5p TTAGGTAGTAGGTGGTATAGTT 2 2
mmu-let-7a-5p TTAGGTAGTAGGTGGTATAGTT 2 2
mmu-let-7a-5p TGCGGTAGTAGGTTGAATAGTTT 12 2
mmu-let-7a-5p TGCGGTAGTAGGTTGAATAGTTT 12 2
mmu-let-7a-5p GAGGTAGTAGATTGTATAGTTTA 5 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATATTT 4 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATATTT 4 2
mmu-let-7a-5p TTAGGTAGTAGTTTGTATAGTT 2 7
mmu-let-7a-5p TTAGGTAGTAGTTTGTATAGTT 2 7
mmu-let-7a-5p TGAGGTAGTAGGTTGTCTGGTTTTA 4 3
mmu-let-7a-5p TNAGGTAGTAGGTCGTATAGTT 3 2
mmu-let-7a-5p TNAGGTAGTAGGTCGTATAGTT 3 2
mmu-let-7a-5p GGTAGTAGGTTGTATTGTT 9 9
mmu-let-7a-5p GGTAGTAGGTTGTATTGTT 9 9
mmu-let-7a-5p TGAGGTAGTAAGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGGTAGTAAGTTGTATAGTTT 2 2
mmu-let-7a-5p TTGAGGTAGTAGGNTGTATAGTT 2 1
mmu-let-7a-5p TNGTAGGTTGTATAGTT 25 3
mmu-let-7a-5p TNGTAGGTTGTATAGTT 25 3
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAG 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAG 8 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTGT 4 2
mmu-let-7a-5p GAGGTAGTAGGTTGTNTAGTTAT 2 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7a-5p GAGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7a-5p GAGGTAGTAGGTTGTATGGTTTTA 13 2
mmu-let-7a-5p NAGTAGGTTGTATAGTT 5 3
mmu-let-7a-5p NAGTAGGTTGTATAGTT 5 3
mmu-let-7a-5p TGAGGTAGTCGGTTGTATCGTT 3 4
mmu-let-7a-5p TGAGGTAGTCGGTTGTATCGTT 3 4
mmu-let-7a-5p GTAGTAGGTTGTATAGTTAT 5 3
mmu-let-7a-5p TGAGTTAGTAGGTNGTATAGT 4 2
mmu-let-7a-5p TGAGTTAGTAGGTNGTATAGT 4 2
mmu-let-7a-5p TTGAGGTAGTAGNTTGTATAGT 2 1
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTGA 12 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTGT 5 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTAA 14 1
mmu-let-7a-5p TGCGGTAGTAGGTTGTA 14 5
mmu-let-7a-5p TGCGGTAGTAGGTTGTA 14 5
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGT 34 2
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGT 34 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTTT 3 1
mmu-let-7a-5p GAGGTAGTAGGATGTCTAGTT 3 4
mmu-let-7a-5p GAGGTAGTAGGATGTCTAGTT 3 4
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGA 5 2
mmu-let-7a-5p GNGGTAGTAGGTTGTATAGA 5 2
mmu-let-7a-5p TGAGGCAGTAGGNTGTATAGTT 2 2
mmu-let-7a-5p TGAGGCAGTAGGNTGTATAGTT 2 2
mmu-let-7a-5p GTAGTAGTTTGTATAGTTT 2 11
mmu-let-7a-5p GTAGTAGTTTGTATAGTTT 2 11
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTTTAG 3 1
mmu-let-7a-5p GGAGGTAGTAGGTTGTATAGTT 38 2
mmu-let-7a-5p GGAGGTAGTAGGTTGTATAGTT 38 2
mmu-let-7a-5p TGCGGTAGTAGGTTGCATAGTT 191 3
mmu-let-7a-5p TGCGGTAGTAGGTTGCATAGTT 191 3
mmu-let-7a-5p TGAGGCAGTAGGTTGCATAGTT 5 4
mmu-let-7a-5p TGAGGCAGTAGGTTGCATAGTT 5 4
mmu-let-7a-5p TGCTGTAGTAGGTTGTATAGT 3 5
mmu-let-7a-5p TGCTGTAGTAGGTTGTATAGT 3 5
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTTT 4 1
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAG 3 2
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAG 3 2
mmu-let-7a-5p TGAGGTAGTAGATTGNATAGTTTA 3 2
mmu-let-7a-5p GTTGAGGTAGTAGG 3 11
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTTA 3 1
mmu-let-7a-5p TGGGGTGGTAGGTTGTATAGTT 4 5
mmu-let-7a-5p TGGGGTGGTAGGTTGTATAGTT 4 5
mmu-let-7a-5p TTCGGTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-5p TTCGGTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAG 8 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAG 8 3
mmu-let-7a-5p AGNTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p AGNTAGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATANTT 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATANTT 8 2
mmu-let-7a-5p GAGGTAGTAGATTGTATAGTTAAG 2 2
mmu-let-7a-5p TGCGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGCGGTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGT 295 1
mmu-let-7a-5p TAGTAGGTTGTATAGTTAA 10 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATTGTTT 4 4
mmu-let-7a-5p TGAGGTAGTAGGTTGNATTGTTT 4 4
mmu-let-7a-5p TGGGGTAGTAGGTTGTATA 2 3
mmu-let-7a-5p TGGGGTAGTAGGTTGTATA 2 3
mmu-let-7a-5p TGANGTAGTAGGTTGTATA 6 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATA 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTATTA 7 2
mmu-let-7a-5p TGGGGTAGTAGGTTGAATAGTT 18 2
mmu-let-7a-5p TGGGGTAGTAGGTTGAATAGTT 18 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTA 611 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTA 611 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTG 51 4
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTG 51 4
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTC 17 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTC 17 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTT 380 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTTT 380 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGT 53 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTATAGT 53 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTTT 6 1
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTTA 5 1
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTTAA 3 1
mmu-let-7a-5p TGAGGTAGTNGGTTGTATGGTTTTA 5 2
mmu-let-7a-5p TTAGTAGGTTGTATAGTT 2 5
mmu-let-7a-5p TTAGTAGGTTGTATAGTT 2 5
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTC 5 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTC 5 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTA 119 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTA 119 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTG 20 4
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTG 20 4
mmu-let-7a-5p TGAGGTAGTTGGTTGTATAGTTAA 2 1
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAGTTA 18 4
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAGTTA 18 4
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAGTTT 13 2
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAGTTT 13 2
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAGTT 70 2
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAGTT 70 2
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAGTA 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTCTATAGTA 2 2
mmu-let-7a-5p TNAGGTAGAAGGTTGTATAGTT 2 3
mmu-let-7a-5p TNAGGTAGAAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGAGGTATTNGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTATTNGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTAT 37 1
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTAA 73 1
mmu-let-7a-5p TGAGGTAGTGGGTTGTAT 2 10
mmu-let-7a-5p TGAGGTAGTGGGTTGTAT 2 10
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTTAT 748 2
mmu-let-7a-5p TGCGTTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGCGTTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGGGGTCGTAGGTTGTATAGTT 13 2
mmu-let-7a-5p TGGGGTCGTAGGTTGTATAGTT 13 2
mmu-let-7a-5p TGAGGTAGTCGGTTGCATAGTT 3 3
mmu-let-7a-5p TGAGGTAGTCGGTTGCATAGTT 3 3
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGT 30 2
mmu-let-7a-5p TGAGGTCGTAGGTTGTATAGT 30 2
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTC 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTTC 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTT 4433 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTT 4433 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTAT 2 1
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTAA 14 1
mmu-let-7a-5p TGGCGTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-5p TGGCGTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-5p GAGGTAGTAGNTTGTATAGT 2 4
mmu-let-7a-5p GAGGTAGTAGNTTGTATAGT 2 4
mmu-let-7a-5p GGTAGTAGGTTGTATAGTTG 23 4
mmu-let-7a-5p GGTAGTAGGTTGTATAGTTG 23 4
mmu-let-7a-5p GGTAGTAGGTTGTATAGTTA 87 3
mmu-let-7a-5p GGTAGTAGGTTGTATAGTTA 87 3
mmu-let-7a-5p TGAGGTAGTANGTTG 4 19
mmu-let-7a-5p TGAGGTAGTANGTTG 4 19
mmu-let-7a-5p AGTAGGTTGTATNGTT 11 11
mmu-let-7a-5p AGTAGGTTGTATNGTT 11 11
mmu-let-7a-5p GTAGGTTGTATAGTTN 55 7
mmu-let-7a-5p GTAGGTTGTATAGTTN 55 7
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAG 59 2
mmu-let-7a-5p TGGGGTAGTAGGTTGTATAG 59 2
mmu-let-7a-5p TGTGGTAGTAGGTTGTATAGTTAA 4 1
mmu-let-7a-5p CGAGGGAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p CGAGGGAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGN 16 10
mmu-let-7a-5p TGAGGTAGTAGGTTGN 16 10
mmu-let-7a-5p TGAGGTAGTAGGTTGT 817 8
mmu-let-7a-5p TGAGGTAGTAGGTTGT 817 8
mmu-let-7a-5p TGCGGTAGTAGGTTGTGTAGTTT 2 3
mmu-let-7a-5p TGCGGTAGTAGGTTGTGTAGTTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAT 4 15
mmu-let-7a-5p TGAGGTAGTAGGTTGTAAAT 4 15
mmu-let-7a-5p TNAGGTATTAGGTTGTATAGTT 11 2
mmu-let-7a-5p TNAGGTATTAGGTTGTATAGTT 11 2
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTTT 32 2
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTTT 32 2
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTTG 2 5
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTTG 2 5
mmu-let-7a-5p TCAGGTAGGAGGTTGTATAGTTT 8 3
mmu-let-7a-5p TCAGGTAGGAGGTTGTATAGTTT 8 3
mmu-let-7a-5p TGAGGAAGTAGGTTGTAT 6 15
mmu-let-7a-5p TGAGGAAGTAGGTTGTAT 6 15
mmu-let-7a-5p TGAGGGAGTAGGCTGTATAGTT 4 3
mmu-let-7a-5p TGAGGGAGTAGGCTGTATAGTT 4 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAAT 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAAT 2 4
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTAT 3 1
mmu-let-7a-5p TGAAGTAGTAGGTTGTATAGTTAA 2 1
mmu-let-7a-5p TGAGGTAGTAGGTTATATAGTTG 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTATATAGTTG 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTATATAGTTA 10 2
mmu-let-7a-5p TGAGGTAGTAGGTTATATAGTTA 10 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTAT 9 6
mmu-let-7a-5p TCAGGTAGTAGGTTGTAT 9 6
mmu-let-7a-5p TGNGGTGGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGNGGTGGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TAGTAGGTTGTATAGTTTT 2 1
mmu-let-7a-5p GAGGTACTAGGTTGTATAGTT 2 2
mmu-let-7a-5p GAGGTACTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAG 3 3
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAG 3 3
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-5p TGAGGTGGTGGGTTGTATAGTT 6 2
mmu-let-7a-5p TGAGGTGGTGGGTTGTATAGTT 6 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGT 98 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGT 98 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGA 3 4
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGA 3 4
mmu-let-7a-5p AGTAGGTTGTATAGTTG 4 19
mmu-let-7a-5p AGTAGGTTGTATAGTTG 4 19
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAG 24 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAG 24 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGAA 87 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGAA 87 2
mmu-let-7a-5p GAGGTAGTAGGTTATATAGT 2 2
mmu-let-7a-5p GAGGTAGTAGGTTATATAGT 2 2
mmu-let-7a-5p TGAGGAAGTAGGTTGAATAGTT 2 3
mmu-let-7a-5p TGAGGAAGTAGGTTGAATAGTT 2 3
mmu-let-7a-5p TGATGTAGTAGGTTGNATAGT 3 2
mmu-let-7a-5p TGATGTAGTAGGTTGNATAGT 3 2
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTT 186 2
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTT 186 2
mmu-let-7a-5p GTAGGTTGTATAGTTTAGA 2 1
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTT 4864 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTT 4864 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTG 3 3
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTG 3 3
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTA 35 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTA 35 2
mmu-let-7a-5p GTTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p GTTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGATGTAGTAGGTTGTATAG 29 2
mmu-let-7a-5p TGATGTAGTAGGTTGTATAG 29 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTN 21 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTN 21 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTC 2097 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTC 2097 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTG 7514 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTT 45856 2
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAG 49 4
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAG 49 4
mmu-let-7a-5p AGNAGGTTGTATAGTT 4 4
mmu-let-7a-5p AGNAGGTTGTATAGTT 4 4
mmu-let-7a-5p TGAGGTAGCNGGTTGTATAGT 2 4
mmu-let-7a-5p TGAGGTAGCNGGTTGTATAGT 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTTT 12 1
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTTA 13 1
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTC 26 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTC 26 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTATA 93 2
mmu-let-7a-5p TAGTAGGTTGTATAGTTAT 5 3
mmu-let-7a-5p NGAAGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p NGAAGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TAGGTAGTAGGTTTTATAGTT 3 12
mmu-let-7a-5p TAGGTAGTAGGTTTTATAGTT 3 12
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTAT 9 2
mmu-let-7a-5p GAGGTAGTCGGTTGTATAGTT 2 2
mmu-let-7a-5p GAGGTAGTCGGTTGTATAGTT 2 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-5p TGNGGTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAT 4112 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAA 7592 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAC 55 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAC 55 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAG 2174 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAG 2174 2
mmu-let-7a-5p TTGGTAGTAGGTTGTATAGTT 2 4
mmu-let-7a-5p TTGGTAGTAGGTTGTATAGTT 2 4
mmu-let-7a-5p GTAGTAGGTTNTATAGTT 2 2
mmu-let-7a-5p GTAGTAGGTTNTATAGTT 2 2
mmu-let-7a-5p TGCGGTAGTAGGGTGTATAGTT 3 2
mmu-let-7a-5p TGCGGTAGTAGGGTGTATAGTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTAAG 2 1
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGA 11 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGA 11 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGA 10 5
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGA 10 5
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAA 3 9
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAA 3 9
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTTAA 2 3
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTTAA 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAATTA 20 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAATTA 20 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAATTT 10 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAATTT 10 2
mmu-let-7a-5p GGTAGTAGGTTGTA 3 15
mmu-let-7a-5p GGTAGTAGGTTGTA 3 15
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGGT 42 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGGT 42 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGGA 3 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGGA 3 3
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGC 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGC 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGG 13 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGG 13 2
mmu-let-7a-5p AGGTAGTAGATTGTATAGTTAA 2 4
mmu-let-7a-5p TGACGTAGGAGGTTGTATAGTTT 15 3
mmu-let-7a-5p TGACGTAGGAGGTTGTATAGTTT 15 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTGT 4 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTGA 12 2
mmu-let-7a-5p TGAGGTAGGAGGTGGTATAGTTT 12 3
mmu-let-7a-5p TGAGGTAGGAGGTGGTATAGTTT 12 3
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTTTT 4 1
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTTTA 2 1
mmu-let-7a-5p TGAGGGAGTAGGTTGTCTAGTT 2 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTCTAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTACTGTT 4 7
mmu-let-7a-5p TGAGGTAGTAGGTTGTACTGTT 4 7
mmu-let-7a-5p TGAGNTAGTAGGTTTTATAGTT 2 2
mmu-let-7a-5p TGAGNTAGTAGGTTTTATAGTT 2 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTTT 2 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTTT 2 2
mmu-let-7a-5p GTAGNTTGTATAGTTT 4 8
mmu-let-7a-5p GTAGNTTGTATAGTTT 4 8
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAG 34 2
mmu-let-7a-5p TANGTAGTAGGTTGTATAGT 4 3
mmu-let-7a-5p TANGTAGTAGGTTGTATAGT 4 3
mmu-let-7a-5p TGATGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGATGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATGGTTTTA 2 2
mmu-let-7a-5p GAGGTCGTAGGTTGTATAGTTA 3 3
mmu-let-7a-5p GAGGTCGTAGGTTGTATAGTTA 3 3
mmu-let-7a-5p GAGGTCGTAGGTTGTATAGTTG 2 4
mmu-let-7a-5p GAGGTCGTAGGTTGTATAGTTG 2 4
mmu-let-7a-5p TAGGTAGTANGTTGTATAGT 2 3
mmu-let-7a-5p TAGGTAGTANGTTGTATAGT 2 3
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTTTT 3 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTTTT 3 2
mmu-let-7a-5p GGNAGTAGGTTGTATAGT 13 4
mmu-let-7a-5p GGNAGTAGGTTGTATAGT 13 4
mmu-let-7a-5p GGTAGTAGGTTGTATAGT 1017 2
mmu-let-7a-5p GGTAGTAGGTTGTATAGT 1017 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGT 130 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGT 130 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGA 3 3
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGA 3 3
mmu-let-7a-5p TGAGGTAGTAGGTNGTGTAGTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTNGTGTAGTT 2 3
mmu-let-7a-5p NGAGTTAGTAGGTTGTATAGT 3 2
mmu-let-7a-5p NGAGTTAGTAGGTTGTATAGT 3 2
mmu-let-7a-5p TGAGGTAGAAGGTTGTATAGTTA 6 3
mmu-let-7a-5p TGAGGTAGAAGGTTGTATAGTTA 6 3
mmu-let-7a-5p GTAGTCGGTTGTATAGTT 5 2
mmu-let-7a-5p GTAGTCGGTTGTATAGTT 5 2
mmu-let-7a-5p CAGGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-5p CAGGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-5p TGATGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-5p TGATGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTT 444 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTT 444 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTA 5 4
mmu-let-7a-5p TGAGGTAGTAGGTTGCATAGTA 5 4
mmu-let-7a-5p TNAGGTAGTAGGTTTTATAGTT 5 3
mmu-let-7a-5p TNAGGTAGTAGGTTTTATAGTT 5 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTCTA 3 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTCTG 9 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTCTG 9 4
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTT 23 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTT 23 2
mmu-let-7a-5p TGAGGGAGTAGGTTGAATAGTT 2 3
mmu-let-7a-5p TGAGGGAGTAGGTTGAATAGTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGT 44 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGT 44 3
mmu-let-7a-5p AGTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p AGTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGNGGTAGTAGGTTATATAGTT 2 2
mmu-let-7a-5p TGNGGTAGTAGGTTATATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAAC 62 1
mmu-let-7a-5p TGAGGGAGTAGGGTGTATAGTT 6 3
mmu-let-7a-5p TGAGGGAGTAGGGTGTATAGTT 6 3
mmu-let-7a-5p TGAGGGCGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGGGCGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGGTAGTANGTTGTACAGT 12 3
mmu-let-7a-5p TGAGGTAGTANGTTGTACAGT 12 3
mmu-let-7a-5p GAGGTAGTAGGATGTATAGT 6 3
mmu-let-7a-5p GAGGTAGTAGGATGTATAGT 6 3
mmu-let-7a-5p TGAGGTAGTAGCTTGCATAGTT 4 5
mmu-let-7a-5p TGAGGTAGTAGCTTGCATAGTT 4 5
mmu-let-7a-5p TGAGGTAGTCGCTTGTATAGTT 2 5
mmu-let-7a-5p TGAGGTAGTCGCTTGTATAGTT 2 5
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTT 81 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGTTT 81 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTAA 45 1
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTAT 20 1
mmu-let-7a-5p GAGGTAGTAGGTTG 14 26
mmu-let-7a-5p GAGGTAGTAGGTTG 14 26
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTAT 4 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTAT 4 2
mmu-let-7a-5p TGAGTTAGTAGGTNGTATAGTT 7 2
mmu-let-7a-5p TGAGTTAGTAGGTNGTATAGTT 7 2
mmu-let-7a-5p TGAGNTAGCAGGTTGTATAGTT 10 3
mmu-let-7a-5p TGAGNTAGCAGGTTGTATAGTT 10 3
mmu-let-7a-5p TGACGTAGTAGATTGTATAGTTTA 3 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-5p TGANGTAGTAGGTTGTATCGTT 2 4
mmu-let-7a-5p TGAGGTCGNAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGAGGTCGNAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTT 551860 2
mmu-let-7a-5p CTGAGGTAGTAGGTTGTATAGTTAA 3 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGT 379 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGT 379 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGA 8 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGA 8 2
mmu-let-7a-5p TGAGGTAGTAGCTTGAATAGTT 9 4
mmu-let-7a-5p TGAGGTAGTAGCTTGAATAGTT 9 4
mmu-let-7a-5p TGAGGTAGTAGGTNGTATATTTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATATTTT 3 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTA 9 6
mmu-let-7a-5p TGAGGTAGTNGGTTGTA 9 6
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGT 37 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGT 37 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGA 3 4
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGA 3 4
mmu-let-7a-5p TAGTATGTTGTATAGTT 4 38
mmu-let-7a-5p TAGTATGTTGTATAGTT 4 38
mmu-let-7a-5p TGAGGTAGTANGTTGTAT 11 5
mmu-let-7a-5p TGAGGTAGTANGTTGTAT 11 5
mmu-let-7a-5p TAGGTAGTAGGTTGTATATTT 2 7
mmu-let-7a-5p TAGGTAGTAGGTTGTATATTT 2 7
mmu-let-7a-5p TTGGGGTAGTAGGTTGTATAGTT 4 1
mmu-let-7a-5p NGAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p NGAGGCAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGAGGTAGTAGGTTGCAT 3 8
mmu-let-7a-5p TGAGGTAGTAGGTTGCAT 3 8
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAG 50 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAG 50 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGT 564 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGT 564 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGA 12 3
mmu-let-7a-5p TGCGGTAGTAGGTTGTATAGA 12 3
mmu-let-7a-5p TGAGCTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGAGCTAGTAGGTTGNATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGGATAGTT 34 2
mmu-let-7a-5p TGAGGTAGTAGGTTGGATAGTT 34 2
mmu-let-7a-5p GCTAGTAGGTTGTATAGTTA 2 8
mmu-let-7a-5p GCTAGTAGGTTGTATAGTTA 2 8
mmu-let-7a-5p TGAGGGGGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGGGGGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTT 288 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTT 288 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTA 2 3
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGTA 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAG 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAG 8 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATA 5 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATA 5 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATA 2 1
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATT 2 2
mmu-let-7a-5p TGGGGGAGTAGGTTGTATAGTT 8 3
mmu-let-7a-5p TGGGGGAGTAGGTTGTATAGTT 8 3
mmu-let-7a-5p TGAGGTAGTAGGTGGTATA 4 5
mmu-let-7a-5p TGAGGTAGTAGGTGGTATA 4 5
mmu-let-7a-5p TGNGGTAGTAGGTTGTAG 2 17
mmu-let-7a-5p TGNGGTAGTAGGTTGTAG 2 17
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTTAT 2 1
mmu-let-7a-5p TGAGGTAGTAGGCTGTATTGTT 6 5
mmu-let-7a-5p TGAGGTAGTAGGCTGTATTGTT 6 5
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGTTAA 2 1
mmu-let-7a-5p GAGGTAGCAGGTTGTATAGTT 3 3
mmu-let-7a-5p GAGGTAGCAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGTTT 64 4
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGTTT 64 4
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGTTA 131 5
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGTTA 131 5
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGTTC 8 5
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAGTTC 8 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATACTTAA 4 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATACTTAT 3 1
mmu-let-7a-5p GAGGTAGTAGGTTCTATAGT 2 2
mmu-let-7a-5p GAGGTAGTAGGTTCTATAGT 2 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAA 4 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAA 4 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAG 667 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAG 667 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTTTA 2 1
mmu-let-7a-5p GGAGTAGGTTGTATAGTTT 2 3
mmu-let-7a-5p GGAGTAGGTTGTATAGTTT 2 3
mmu-let-7a-5p TGCGGTAGGAGGTTGTATAGTTTA 3 2
mmu-let-7a-5p GGGAGTAGGTTGTATCGTT 2 14
mmu-let-7a-5p GGGAGTAGGTTGTATCGTT 2 14
mmu-let-7a-5p TGAGGTATTAGGTTGTATAG 8 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAG 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAG 53 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAG 53 3
mmu-let-7a-5p GTCGGTTGTATAGTT 31 37
mmu-let-7a-5p GTCGGTTGTATAGTT 31 37
mmu-let-7a-5p TGCGGTAGTAGGTTGTATGGTTTTA 5 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTC 2 4
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTC 2 4
mmu-let-7a-5p TGGNGTAGTAGGTTGTATA 4 6
mmu-let-7a-5p TGGNGTAGTAGGTTGTATA 4 6
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTT 400 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTT 400 2
mmu-let-7a-5p GCGGTAGTAGGTTGTATAGTT 40 2
mmu-let-7a-5p GCGGTAGTAGGTTGTATAGTT 40 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAAT 79 1
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTAA 2 1
mmu-let-7a-5p TGCGGTAGTAGGTTGAATAG 7 5
mmu-let-7a-5p TGCGGTAGTAGGTTGAATAG 7 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTAA 175 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTAA 175 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTAG 52 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTAT 61 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTG 14 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTG 14 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTC 2 16
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTC 2 16
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTA 13 15
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTA 13 15
mmu-let-7a-5p TGAGGTAGTGGGNTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTGGGNTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTT 711 23
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTT 711 23
mmu-let-7a-5p TGACTTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGACTTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TTGAGGTAGTAGNTTGTATAGTT 8 1
mmu-let-7a-5p TGCGGTAGTAGGTTGCATAGTTT 16 3
mmu-let-7a-5p TGCGGTAGTAGGTTGCATAGTTT 16 3
mmu-let-7a-5p GAGATAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p GAGATAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAGTTT 11 2
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAGTTT 11 2
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAGTTA 12 3
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAGTTA 12 3
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAGTTG 4 4
mmu-let-7a-5p TGAGGTAGTAGGTTTTATAGTTG 4 4
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTTTAT 2 1
mmu-let-7a-5p TGAGGTAGTAGGTTGNATA 8 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATA 8 2
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGTTAT 7 1
mmu-let-7a-5p TATGTAGTAGGTTGTATAGTT 5 6
mmu-let-7a-5p TATGTAGTAGGTTGTATAGTT 5 6
mmu-let-7a-5p AGAGGTAGTAGGTTGNATAGTTTA 3 2
mmu-let-7a-5p TGAGGTACTAGGTTGTAT 2 10
mmu-let-7a-5p TGAGGTACTAGGTTGTAT 2 10
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAG 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAG 6 2
mmu-let-7a-5p TGATGCAGTAGGTTGTATAGTT 4 3
mmu-let-7a-5p TGATGCAGTAGGTTGTATAGTT 4 3
mmu-let-7a-5p TGAGTTAGGAGGTTGTATAGTTT 4 3
mmu-let-7a-5p TGAGTTAGGAGGTTGTATAGTTT 4 3
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTT 1035 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTT 1035 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTA 4 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTA 4 2
mmu-let-7a-5p TTGAGGTAGTAGATTGTATAGTT 4 3
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAGT 290 2
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAGT 290 2
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAGA 2 2
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAGA 2 2
mmu-let-7a-5p GGNAGTAGGTTGTATAGTT 20 3
mmu-let-7a-5p GGNAGTAGGTTGTATAGTT 20 3
mmu-let-7a-5p TGAGGTAGTAGGTT 4543 17
mmu-let-7a-5p TGAGGTAGTAGGTT 4543 17
mmu-let-7a-5p TGAGGTAGNACGTTGTATAGTT 2 3
mmu-let-7a-5p TGAGGTAGNACGTTGTATAGTT 2 3
mmu-let-7a-5p TCTGAGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TCTGAGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTATC 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTATC 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTATA 2 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTATT 2 1
mmu-let-7a-5p TGCGGTAGTAGGTTGTAAA 2 10
mmu-let-7a-5p TGCGGTAGTAGGTTGTAAA 2 10
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTATG 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTATG 2 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTAA 26 1
mmu-let-7a-5p TGGAGGTAGTAGGTTGTATAGT 3 1
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTC 3 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTC 3 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTA 36 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATAGTA 36 2
mmu-let-7a-5p TNAGGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TNAGGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTT 442 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTT 442 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTC 4 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTC 4 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTA 5 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCGTA 5 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTANAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTANAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTC 2 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTC 2 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGA 10 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGA 10 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTTT 14 15
mmu-let-7a-5p TGAGGTAGTAGGTTGTTT 14 15
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTT 154 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGTT 154 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTG 2 1
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTT 55 1
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTA 44 1
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTT 1701 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTT 1701 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTA 8 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTA 8 2
mmu-let-7a-5p AGGTNGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p AGGTNGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCG 5 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATCG 5 4
mmu-let-7a-5p TGAGGTAGGAGCTTGTATAGTTT 10 4
mmu-let-7a-5p TGAGGTAGGAGCTTGTATAGTTT 10 4
mmu-let-7a-5p TGAGGTAGTAGGTGGTATATTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTATATTT 2 2
mmu-let-7a-5p CGAGGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-5p CGAGGTAGTAGGTCGTATAGTT 2 2
mmu-let-7a-5p TGNGGTACTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGNGGTACTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTATTGTT 7 5
mmu-let-7a-5p TGCGGTAGTAGGTTGTATTGTT 7 5
mmu-let-7a-5p TNAGGTAGCAGGTTGTATAGTT 4 3
mmu-let-7a-5p TNAGGTAGCAGGTTGTATAGTT 4 3
mmu-let-7a-5p TGAGGTAGTAGGTGGTATAGTTAAGA 2 1
mmu-let-7a-5p TAGTAGGTTGTATAGNTA 2 17
mmu-let-7a-5p TAGTAGGTTGTATAGNTA 2 17
mmu-let-7a-5p TCAGCTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TCAGCTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAGT 27 3
mmu-let-7a-5p TGAGGTAGCAGGTTGTATAGT 27 3
mmu-let-7a-5p GAGGTAGAAGGTTGTATAGTT 4 3
mmu-let-7a-5p GAGGTAGAAGGTTGTATAGTT 4 3
mmu-let-7a-5p TNAGATAGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p TNAGATAGTAGGTTGTATAGTT 5 2
mmu-let-7a-5p TTAGGGAGTAGGTTGTATAGTT 7 2
mmu-let-7a-5p TTAGGGAGTAGGTTGTATAGTT 7 2
mmu-let-7a-5p GAGCTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-5p GAGCTAGTAGGTTGTATAGTT 9 2
mmu-let-7a-5p TGNTGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-5p TGNTGTAGTAGGTTGTATAGT 3 2
mmu-let-7a-5p NGACGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-5p NGACGTAGTAGGTTGTATAGT 2 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTA 52 4
mmu-let-7a-5p TNAGGTAGTAGGTTGTA 52 4
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTAT 5 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTAT 5 2
mmu-let-7a-5p TGTGGTAGTAGGTTGTATAGT 20 2
mmu-let-7a-5p TGTGGTAGTAGGTTGTATAGT 20 2
mmu-let-7a-5p GTGGTAGTAGGTTGTATAGTT 7 2
mmu-let-7a-5p GTGGTAGTAGGTTGTATAGTT 7 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTTAA 3 1
mmu-let-7a-5p GAGGTAGTAGGTTNTATAGT 7 2
mmu-let-7a-5p GAGGTAGTAGGTTNTATAGT 7 2
mmu-let-7a-5p TGATTTAGTAGGTTGTATAGTTT 2 3
mmu-let-7a-5p TGATTTAGTAGGTTGTATAGTTT 2 3
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTTT 3 1
mmu-let-7a-5p AGTAGGTTGTATAGTTC 2 17
mmu-let-7a-5p AGTAGGTTGTATAGTTC 2 17
mmu-let-7a-5p ATGAGGTAGTAGGTTGTATAGT 24 1
mmu-let-7a-5p TGAGGTAGTGGGTTGTATAGTTGT 2 2
mmu-let-7a-5p TGAGGTAGTANCTTGTATAGT 170 4
mmu-let-7a-5p TGAGGTAGTANCTTGTATAGT 170 4
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGT 44 2
mmu-let-7a-5p TGAGCTAGTAGGTTGTATAGT 44 2
mmu-let-7a-5p TGAGGTAGGAGGTTGTGTAGTTT 3 6
mmu-let-7a-5p TGAGGTAGGAGGTTGTGTAGTTT 3 6
mmu-let-7a-5p TAGGTAGGAGGTTGTATAGTTT 4 4
mmu-let-7a-5p TAGGTAGGAGGTTGTATAGTTT 4 4
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTTGT 3 2
mmu-let-7a-5p GTAGGTTGTATAGTTTT 8 2
mmu-let-7a-5p GTAGGTTGTATAGTTTA 2 1
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTAAG 2 1
mmu-let-7a-5p TNAGGTAGTAGGTTGTATTGTT 16 6
mmu-let-7a-5p TNAGGTAGTAGGTTGTATTGTT 16 6
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTA 708 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTA 708 2
mmu-let-7a-5p TGCNGTAGTAGGTTGTATAGT 31 2
mmu-let-7a-5p TGCNGTAGTAGGTTGTATAGT 31 2
mmu-let-7a-5p GAGGTAGTAGGTTGTCTAGTT 20 2
mmu-let-7a-5p GAGGTAGTAGGTTGTCTAGTT 20 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTTTGA 2 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAAGA 18 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAAGC 3 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAAGT 6 1
mmu-let-7a-5p TGATTTAGTAGGTTGTATAGTT 8 4
mmu-let-7a-5p TGATTTAGTAGGTTGTATAGTT 8 4
mmu-let-7a-5p NGAGGTAGGAGGTTGTATAGTTT 27 3
mmu-let-7a-5p NGAGGTAGGAGGTTGTATAGTTT 27 3
mmu-let-7a-5p GAGGTTGTAGGTTGTATAG 4 4
mmu-let-7a-5p GAGGTTGTAGGTTGTATAG 4 4
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAG 23 5
mmu-let-7a-5p TGAGGTAGTAGTTTGTATAG 23 5
mmu-let-7a-5p TGCNGTAGTAGGTTGTATAGTT 223 2
mmu-let-7a-5p TGCNGTAGTAGGTTGTATAGTT 223 2
mmu-let-7a-5p GAGGTAGTAGGTTGTGTA 2 6
mmu-let-7a-5p GAGGTAGTAGGTTGTGTA 2 6
mmu-let-7a-5p GAGGTTGTAGGTTGTATAGTTT 8 2
mmu-let-7a-5p GAGGTTGTAGGTTGTATAGTTT 8 2
mmu-let-7a-5p GAGGTTGTAGGTTGTATAGTTA 6 2
mmu-let-7a-5p GAGGTTGTAGGTTGTATAGTTA 6 2
mmu-let-7a-5p TGAGGTTGTAGGTNGTATAGTT 2 2
mmu-let-7a-5p TGAGGTTGTAGGTNGTATAGTT 2 2
mmu-let-7a-5p TGCGGTGGTAGGTTGTATAGT 3 2
mmu-let-7a-5p TGCGGTGGTAGGTTGTATAGT 3 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAGTTC 2 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAGTTC 2 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAGTTA 28 3
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAGTTA 28 3
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAGTTT 18 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAGTTT 18 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAGTTG 5 4
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAGTTG 5 4
mmu-let-7a-5p TGCGGTAGTCGGTTGTATAGTT 6 2
mmu-let-7a-5p TGCGGTAGTCGGTTGTATAGTT 6 2
mmu-let-7a-5p TGAGGTAGTAGTTTGTACAGTTTAG 8 2
mmu-let-7a-5p GAGGTAGTAGNGTGTATAGT 2 6
mmu-let-7a-5p GAGGTAGTAGNGTGTATAGT 2 6
mmu-let-7a-5p TGAGGTAGAAGGTTGTATAGTTT 3 2
mmu-let-7a-5p TGAGGTAGAAGGTTGTATAGTTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTT 4713 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTT 4713 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTA 22 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTA 22 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTG 2 2
mmu-let-7a-5p TGAGGTAGTAGGTNGTATAGTG 2 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTAT 2 4
mmu-let-7a-5p CGAGGTAGTAGGTTGTAT 2 4
mmu-let-7a-5p GGACGTAGGTTGTATAGTT 2 10
mmu-let-7a-5p GGACGTAGGTTGTATAGTT 2 10
mmu-let-7a-5p GAGNTAGTAGGTTGTATAGTTT 5 2
mmu-let-7a-5p GAGNTAGTAGGTTGTATAGTTT 5 2
mmu-let-7a-5p GAGNTAGTAGGTTGTATAGTTA 14 2
mmu-let-7a-5p GAGNTAGTAGGTTGTATAGTTA 14 2
mmu-let-7a-5p NGCGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p NGCGGTAGTAGGTTGTATAGTTT 2 2
mmu-let-7a-5p AGGTTGTATAGTTT 25 36
mmu-let-7a-5p AGGTTGTATAGTTT 25 36
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTA 598 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTA 598 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTG 76 4
mmu-let-7a-5p TGAGGTAGTAGGNTGTATAGTTG 76 4
mmu-let-7a-5p GGTTGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p GGTTGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTAGTTTGTAT 4 12
mmu-let-7a-5p TGAGGTAGTAGTTTGTAT 4 12
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTAA 22 1
mmu-let-7a-5p TCAGGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTAT 6 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTAT 6 2
mmu-let-7a-5p TAGGTTGTATAGTTT 36 11
mmu-let-7a-5p TAGGTTGTATAGTTT 36 11
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTT 22179 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTT 22179 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTA 132 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTA 132 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTC 6 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTC 6 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTG 4 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTATAGTG 4 2
mmu-let-7a-5p GTAGTAGTTTGTATAGTT 3 18
mmu-let-7a-5p GTAGTAGTTTGTATAGTT 3 18
mmu-let-7a-5p TGAGGTAGGCGGTTGTATAGTTT 3 4
mmu-let-7a-5p TGAGGTAGGCGGTTGTATAGTTT 3 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAAA 83 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTAAT 29 1
mmu-let-7a-5p TGAGGTAGTNGGTTGTATTGTT 7 5
mmu-let-7a-5p TGAGGTAGTNGGTTGTATTGTT 7 5
mmu-let-7a-5p TGAGGGATTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGAGGGATTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGAGGTAGTCGGTTGTAT 2 5
mmu-let-7a-5p TGAGGTAGTCGGTTGTAT 2 5
mmu-let-7a-5p TNAGGTAGTAGGTTGTATTGTTT 6 5
mmu-let-7a-5p TNAGGTAGTAGGTTGTATTGTTT 6 5
mmu-let-7a-5p GAGGTAGTAGGTAGTATAGTTT 2 2
mmu-let-7a-5p GAGGTAGTAGGTAGTATAGTTT 2 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTC 9 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTC 9 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTG 86 4
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTG 86 4
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTT 477 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGTTT 477 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTTAA 2 2
mmu-let-7a-5p GAGGNAGTCGGTTGTATAGTT 8 2
mmu-let-7a-5p GAGGNAGTCGGTTGTATAGTT 8 2
mmu-let-7a-5p TGAGGTAGTGGGTTGTATAGTT 186 2
mmu-let-7a-5p TGAGGTAGTGGGTTGTATAGTT 186 2
mmu-let-7a-5p TGCGGTCGTAGGTTGTATAGT 7 2
mmu-let-7a-5p TGCGGTCGTAGGTTGTATAGT 7 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTT 263 2
mmu-let-7a-5p TGAGGTATTAGGTTGTATAGTT 263 2
mmu-let-7a-5p GAGGTAGTAGNTTGTATAGTTA 2 4
mmu-let-7a-5p GAGGTAGTAGNTTGTATAGTTA 2 4
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGA 20 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGA 20 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGT 767 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAGT 767 2
mmu-let-7a-5p TGAGGTACTAGGTTGTATAG 4 2
mmu-let-7a-5p TGAGGTACTAGGTTGTATAG 4 2
mmu-let-7a-5p TGAGGTAGTAAGTTGTATTGTTTA 49 3
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTC 4 2
mmu-let-7a-5p TAAGGTAGTAGGTTGTATAGTTC 4 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTC 5 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTC 5 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTA 135 2
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTA 135 2
mmu-let-7a-5p TGAGGTAGTAGGTTATATAGTTT 10 2
mmu-let-7a-5p TGAGGTAGTAGGTTATATAGTTT 10 2
mmu-let-7a-5p TGAGGTGGTAGGTTGTATAGTTTT 3 1
mmu-let-7a-5p GAGGTAGTAGNATGTATAGTT 22 5
mmu-let-7a-5p GAGGTAGTAGNATGTATAGTT 22 5
mmu-let-7a-5p TGNGGTAGTAGGTTGTAT 27 4
mmu-let-7a-5p TGNGGTAGTAGGTTGTAT 27 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGTT 860 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGTT 860 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGTC 2 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGTC 2 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGTA 6 7
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTGTA 6 7
mmu-let-7a-5p TGNCGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGNCGTAGTAGGTTGTATAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTAT 2 2
mmu-let-7a-5p TGAGGTAGTAGGCTGTATAGTAT 2 2
mmu-let-7a-5p TGGTAGTAGATTGTATAGTTTA 2 3
mmu-let-7a-5p TNAGGTAGTAGGTTCTATAGTT 3 2
mmu-let-7a-5p TNAGGTAGTAGGTTCTATAGTT 3 2
mmu-let-7a-5p TGANGTAGGAGGTTGTATAGTTT 29 3
mmu-let-7a-5p TGANGTAGGAGGTTGTATAGTTT 29 3
mmu-let-7a-5p TNAGGTAGTAGGTTGTAA 8 21
mmu-let-7a-5p TNAGGTAGTAGGTTGTAA 8 21
mmu-let-7a-5p TNTAGTAGGTTGTATAGT 4 26
mmu-let-7a-5p TNTAGTAGGTTGTATAGT 4 26
mmu-let-7a-5p TGAGGTAGTTGGTTGTATAGT 15 2
mmu-let-7a-5p TGAGGTAGTTGGTTGTATAGT 15 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATATTT 2 2
mmu-let-7a-5p TGAGGTAGTNGGTTGTATATTT 2 2
mmu-let-7a-5p GGAGTAGGTTGTATAGTT 7 8
mmu-let-7a-5p GGAGTAGGTTGTATAGTT 7 8
mmu-let-7a-5p GAGGTAGTAGGTAGTATAGTT 4 2
mmu-let-7a-5p GAGGTAGTAGGTAGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTAA 26 1
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTAT 12 1
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTTT 3 1
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTTA 8 1
mmu-let-7a-5p TAGTAGGTTGTATNGTT 4 6
mmu-let-7a-5p TAGTAGGTTGTATNGTT 4 6
mmu-let-7a-5p GGTCNTAGGTTGTATAGTT 6 11
mmu-let-7a-5p GGTCNTAGGTTGTATAGTT 6 11
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTT 200 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTT 200 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTA 364 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTA 364 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTC 7 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTC 7 2
mmu-let-7a-5p GAGGTAGTAGGTTGTCTAGTTA 6 2
mmu-let-7a-5p GAGGTAGTAGGTTGTCTAGTTA 6 2
mmu-let-7a-5p TGAGGTAGGACGTTGTATAGTTT 3 3
mmu-let-7a-5p TGAGGTAGGACGTTGTATAGTTT 3 3
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTC 3 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTC 3 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTA 52 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTA 52 2
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTG 7 4
mmu-let-7a-5p TGAGGTAGTAGGGTGTATAGTTG 7 4
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTTAA 5 1
mmu-let-7a-5p TTAGGTAGTAGGTTGTATAGTTTT 2 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAGTT 41 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTTTAGTT 41 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTAT 4 3
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTAT 4 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTTAA 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTTAA 2 3
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTG 34 4
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTG 34 4
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTA 351 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTA 351 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTT 206 2
mmu-let-7a-5p NGAGGTAGTAGGTTGTATAGTTT 206 2
mmu-let-7a-5p GAGGTAGTAGGTTCTATAGTT 16 2
mmu-let-7a-5p GAGGTAGTAGGTTCTATAGTT 16 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTCTAGTT 2 2
mmu-let-7a-5p TGAGGTAGTCGGTTGTCTAGTT 2 2
mmu-let-7a-5p NGGTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p NGGTAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTTTT 84 6
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTTTT 84 6
mmu-let-7a-5p TGAGGGAGTCGGTTGTATAGTTT 2 2
mmu-let-7a-5p TGAGGGAGTCGGTTGTATAGTTT 2 2
mmu-let-7a-5p TNAGTTAGTAGGTTGTATAGT 9 2
mmu-let-7a-5p TNAGTTAGTAGGTTGTATAGT 9 2
mmu-let-7a-5p TNAGGTAGTAGGTTGTGTAG 2 3
mmu-let-7a-5p TNAGGTAGTAGGTTGTGTAG 2 3
mmu-let-7a-5p CGAGGTAGTAGGTNGTATAGTT 2 2
mmu-let-7a-5p CGAGGTAGTAGGTNGTATAGTT 2 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTTGA 5 2
mmu-let-7a-5p TNACGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TNACGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p TGNTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGNTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p AGTAGGTTGTATAGTTT 32 2
mmu-let-7a-5p AGTAGGTTGTATAGTTT 32 2
mmu-let-7a-5p TTGAGGTAGTAGGTTGT 3 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGCT 6 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGCT 6 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAG 163 2
mmu-let-7a-5p TGNGGTAGTAGGTTGTATAG 163 2
mmu-let-7a-5p TGTNGTAGTAGGTTGTATAGTT 38 2
mmu-let-7a-5p TGTNGTAGTAGGTTGTATAGTT 38 2
mmu-let-7a-5p TGNGGTAGCAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGNGGTAGCAGGTTGTATAGTT 2 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTT 182 3
mmu-let-7a-5p AGAGGTAGTAGGTTGTATAGTT 182 3
mmu-let-7a-5p TGGAGGTAGTAGGTTGTATAGTT 8 1
mmu-let-7a-5p TGATGGAGTAGGTTGTATAGT 2 5
mmu-let-7a-5p TGATGGAGTAGGTTGTATAGT 2 5
mmu-let-7a-5p NGACGTAGTAGGTTGTATAGTT 8 2
mmu-let-7a-5p NGACGTAGTAGGTTGTATAGTT 8 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTT 1592 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTT 1592 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTA 9 3
mmu-let-7a-5p TGAGGCAGTAGGTTGTATAGTA 9 3
mmu-let-7a-5p GAGGTAGTAGGCTGTATAGT 2 2
mmu-let-7a-5p GAGGTAGTAGGCTGTATAGT 2 2
mmu-let-7a-5p TGATGTAGTNGGTTGTATAGTT 2 2
mmu-let-7a-5p TGATGTAGTNGGTTGTATAGTT 2 2
mmu-let-7a-5p GGTAGTGGGTTGTATAGTT 2 3
mmu-let-7a-5p GGTAGTGGGTTGTATAGTT 2 3
mmu-let-7a-5p GAGGTAGTAGGTTGTA 19 4
mmu-let-7a-5p GAGGTAGTAGGTTGTA 19 4
mmu-let-7a-5p TGAGCTAGTNGGTTGTATAGTT 3 2
mmu-let-7a-5p TGAGCTAGTNGGTTGTATAGTT 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNA 9 5
mmu-let-7a-5p TGAGGTAGTAGGTTGNA 9 5
mmu-let-7a-5p TNAGCTAGTAGGTTGTATAGT 5 2
mmu-let-7a-5p TNAGCTAGTAGGTTGTATAGT 5 2
mmu-let-7a-5p TGAGGCAGGAGGTTGTATAGTTT 10 6
mmu-let-7a-5p TGAGGCAGGAGGTTGTATAGTTT 10 6
mmu-let-7a-5p GTAGTTGGTTGTATAGTTT 3 5
mmu-let-7a-5p GTAGTTGGTTGTATAGTTT 3 5
mmu-let-7a-5p TGAGGGAGTAGGTTGTATAGTTAT 33 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAA 137 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAA 137 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAG 15206 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAG 15206 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAT 123 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAT 123 3
mmu-let-7a-5p TGAGGTAGGAGGTTGTATACTTT 2 3
mmu-let-7a-5p TGAGGTAGGAGGTTGTATACTTT 2 3
mmu-let-7a-5p TGACGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGACGGAGTAGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAT 3400 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTAT 3400 4
mmu-let-7a-5p TGAGGTAGGAGGTAGTATAGTTTA 2 2
mmu-let-7a-5p TGACGTAGGAGGTTGTATAGTTTT 2 1
mmu-let-7a-5p TGAGGTAGTAGGTTATATAGT 18 2
mmu-let-7a-5p TGAGGTAGTAGGTTATATAGT 18 2
mmu-let-7a-5p TGATGTAGTAGGTTGTATAGTA 5 5
mmu-let-7a-5p TGATGTAGTAGGTTGTATAGTA 5 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTT 1668 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATATTT 1668 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAGG 5 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAGA 369 1
mmu-let-7a-5p TANTAGGTTGTATAGTT 4 3
mmu-let-7a-5p TANTAGGTTGTATAGTT 4 3
mmu-let-7a-5p TGAGNTAGTAGGTTG 3 23
mmu-let-7a-5p TGAGNTAGTAGGTTG 3 23
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGTTGA 21 2
mmu-let-7a-5p TGTAGTAGGTTGTATAGT 42 12
mmu-let-7a-5p TGTAGTAGGTTGTATAGT 42 12
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTTT 4 2
mmu-let-7a-5p TGAGGTAGTAGCTTGTATAGTTTA 2 1
mmu-let-7a-5p GGTCGTAGGTTGTATAGT 3 4
mmu-let-7a-5p GGTCGTAGGTTGTATAGT 3 4
mmu-let-7a-5p TGAGTTAGTNGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGTTAGTNGGTTGTATAGTT 4 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGT 124 2
mmu-let-7a-5p TGAGGAAGTAGGTTGTATAGT 124 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAG 6 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTATAG 6 2
mmu-let-7a-5p GTGNTAGGTTGTATAGTT 2 11
mmu-let-7a-5p GTGNTAGGTTGTATAGTT 2 11
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCT 94 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCT 94 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCC 4 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGCC 4 2
mmu-let-7a-5p GAGGTAGGAGGTTGTATAGTTAT 14 2
mmu-let-7a-5p GAGGTAGTAAGTTGTATAGT 2 3
mmu-let-7a-5p GAGGTAGTAAGTTGTATAGT 2 3
mmu-let-7a-5p TGAGGTAGTANGTTGT 2 12
mmu-let-7a-5p TGAGGTAGTANGTTGT 2 12
mmu-let-7a-5p TTAGGTAGTNGGTTGTATAGTT 5 2
mmu-let-7a-5p TTAGGTAGTNGGTTGTATAGTT 5 2
mmu-let-7a-5p TGAGGTAGTAGGTGGTAT 5 11
mmu-let-7a-5p TGAGGTAGTAGGTGGTAT 5 11
mmu-let-7a-5p TGAGGTAGGTGGTTGTATAGTTT 2 5
mmu-let-7a-5p TGAGGTAGGTGGTTGTATAGTTT 2 5
mmu-let-7a-5p TGAGGTAGGAGGTTGCATAGTTT 3 4
mmu-let-7a-5p TGAGGTAGGAGGTTGCATAGTTT 3 4
mmu-let-7a-5p TGCGGTAGTAGGTTGTAT 19 5
mmu-let-7a-5p TGCGGTAGTAGGTTGTAT 19 5
mmu-let-7a-5p TGCGGTAGTAGGTTGTAA 3 28
mmu-let-7a-5p TGCGGTAGTAGGTTGTAA 3 28
mmu-let-7a-5p TGAGGGCGTAGGTTGTATAGT 4 4
mmu-let-7a-5p TGAGGGCGTAGGTTGTATAGT 4 4
mmu-let-7a-5p TGAGGTAGTAGGTTGGATAGTTA 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGGATAGTTA 6 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAATGT 4 14
mmu-let-7a-5p TGAGGTAGTAGGTTGTAATGT 4 14
mmu-let-7a-5p TGANGTAGTAGGTTGTCTAGTTT 16 2
mmu-let-7a-5p TGANGTAGTAGGTTGTCTAGTTT 16 2
mmu-let-7a-5p TTGAGGTAGTAGGCTGTATAGTT 2 1
mmu-let-7a-5p TGAGGTAGTAGGTTG 681 10
mmu-let-7a-5p TGAGGTAGTAGGTTG 681 10
mmu-let-7a-5p TGGTAGTAGGTTGTATAGTTA 8 4
mmu-let-7a-5p TGGTAGTAGGTTGTATAGTTA 8 4
mmu-let-7a-5p TNAGGTAGTAGATTGTATAGTTTA 14 2
mmu-let-7a-5p GTCGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p GTCGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p AGTAGGTTGTATAGTT 516 3
mmu-let-7a-5p AGTAGGTTGTATAGTT 516 3
mmu-let-7a-5p AGTAGGTTGTATAGTN 4 9
mmu-let-7a-5p AGTAGGTTGTATAGTN 4 9
mmu-let-7a-5p NAAGGTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p NAAGGTAGTAGGTTGTATAGTT 3 3
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTA 3 4
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTA 3 4
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTT 378 2
mmu-let-7a-5p TGAGGTAGTAGGATGTATAGTT 378 2
mmu-let-7a-5p TGGNGTAGTAGGTTGTATAG 36 3
mmu-let-7a-5p TGGNGTAGTAGGTTGTATAG 36 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAG 6 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAG 6 4
mmu-let-7a-5p TGNGGTAGGAGGTTGTATAGTTTA 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAGAGTTA 2 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTAGAGTTA 2 2
mmu-let-7a-5p TGANGTAGTAGGTTGTCTAGT 25 2
mmu-let-7a-5p TGANGTAGTAGGTTGTCTAGT 25 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGT 36 2
mmu-let-7a-5p CGAGGTAGTAGGTTGTATAGT 36 2
mmu-let-7a-5p TGAGGGAGTCGGTTGTATAGTT 7 3
mmu-let-7a-5p TGAGGGAGTCGGTTGTATAGTT 7 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTAAAA 25 1
mmu-let-7a-5p TGAGGGAGTAGGTTGCATAGTT 17 3
mmu-let-7a-5p TGAGGGAGTAGGTTGCATAGTT 17 3
mmu-let-7a-5p TGAGGTCGTAGGTTGTAT 2 4
mmu-let-7a-5p TGAGGTCGTAGGTTGTAT 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATGGTTTTAA 54 3
mmu-let-7a-5p TGAGGCAGTAGGTTGTATA 6 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATA 6 2
mmu-let-7a-5p GGTGGTAGGTTGTATAGT 5 3
mmu-let-7a-5p GGTGGTAGGTTGTATAGT 5 3
mmu-let-7a-5p CGAGGTAGTAGGNTGTATAGTT 2 2
mmu-let-7a-5p CGAGGTAGTAGGNTGTATAGTT 2 2
mmu-let-7a-5p GAGGTAGTAGGTTATATAGTT 14 2
mmu-let-7a-5p GAGGTAGTAGGTTATATAGTT 14 2
mmu-let-7a-5p GTGGTAGGTTGTATAGTT 2 5
mmu-let-7a-5p GTGGTAGGTTGTATAGTT 2 5
mmu-let-7a-5p CTAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p CTAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGA 9 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGA 9 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGT 599 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGT 599 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGT 18 2
mmu-let-7a-5p TGAGGTAGTAGGTTGAATAGT 18 2
mmu-let-7a-5p TAGGTAGTAGGTTGTNTAGT 3 3
mmu-let-7a-5p TAGGTAGTAGGTTGTNTAGT 3 3
mmu-let-7a-5p GAGGTCGTAGGTTGTATAG 3 2
mmu-let-7a-5p GAGGTCGTAGGTTGTATAG 3 2
mmu-let-7a-5p TNGAGGTAGTAGGTTGTATAGTTT 2 1
mmu-let-7a-5p TGCNGTAGTAGGTTGTATAGTTT 20 2
mmu-let-7a-5p TGCNGTAGTAGGTTGTATAGTTT 20 2
mmu-let-7a-5p TAGGAGGTTGTATAGTTTA 2 3
mmu-let-7a-5p TTGAGGTAGNAGGTTGTATAGTT 9 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTA 70549 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGTTA 70549 2
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTG 37 4
mmu-let-7a-5p TGANGTAGTAGGTTGTATAGTTG 37 4
mmu-let-7a-5p TGAGGTAGTAGGTAGTATAGTTGA 3 2
mmu-let-7a-5p TGAGGCAGTAGGTTGTATGGTTTTA 3 2
mmu-let-7a-5p TGAGTTAGTAGGTTGTAT 2 8
mmu-let-7a-5p TGAGTTAGTAGGTTGTAT 2 8
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTTC 3 2
mmu-let-7a-5p TGAGGTAGTAGGTTGNATAGTTTC 3 2
mmu-let-7a-5p TTAGGTAGTNGGTTGTATAGT 3 2
mmu-let-7a-5p TTAGGTAGTNGGTTGTATAGT 3 2
mmu-let-7a-5p TGATGAGGTAGTAGGTTGTATGGTT 2 3
mmu-let-7a-5p GNAGGTTGTATAGTTT 6 6
mmu-let-7a-5p GNAGGTTGTATAGTTT 6 6
mmu-let-7a-5p TGCGGTCGTAGGTTGTATAGTT 95 2
mmu-let-7a-5p TGCGGTCGTAGGTTGTATAGTT 95 2
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGGT 2 4
mmu-let-7a-5p TAGGTAGTAGGTTGTATAGGT 2 4
mmu-let-7a-5p TTGAGGTAGTAGGTTGTATAGTTGA 2 1
mmu-let-7a-5p TGNGGTAGTAGGTTGTATTGT 2 5
mmu-let-7a-5p TGNGGTAGTAGGTTGTATTGT 2 5
mmu-let-7a-5p TGNGTTAGTAGGTTGTATAGTT 4 3
mmu-let-7a-5p TGNGTTAGTAGGTTGTATAGTT 4 3
mmu-let-7a-5p TGAGGTAGTGGGTTGTATAGTTTT 2 1
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTAT 113 5
mmu-let-7a-5p TGAGGTAGGAGGTTGTATAGTAT 113 5
mmu-let-7a-5p TGCGGTAGTAGGTTGTATCGT 2 4
mmu-let-7a-5p TGCGGTAGTAGGTTGTATCGT 2 4
mmu-let-7a-5p TGAGGGAGTAGGTTGTTTAGTT 2 2
mmu-let-7a-5p TGAGGGAGTAGGTTGTTTAGTT 2 2
mmu-let-7a-5p TGAGGTAGTAGGNTGTATGGTTTTA 3 2
mmu-let-7a-5p TGAGGTAGTANGTTGTATAGTTGA 4 2
mmu-let-7a-5p TGCGGTAGTAGGTTGTGTAGTT 2 3
mmu-let-7a-5p TGCGGTAGTAGGTTGTGTAGTT 2 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTT 59 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTT 59 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTA 64 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTA 64 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTG 6 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTGTAGTTG 6 5
mmu-let-7a-5p CGATGAGGTAGTAGGTTGTATGGTT 2 3
mmu-let-7a-5p TAAGGTAGTAGGTTGTA 4 12
mmu-let-7a-5p TAAGGTAGTAGGTTGTA 4 12
mmu-let-7a-5p GTAGTAGGTTGTANAGT 3 3
mmu-let-7a-5p GTAGTAGGTTGTANAGT 3 3
mmu-let-7a-5p TGAGGTAGTAGATNGTATAGTTTA 4 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATTGT 7 5
mmu-let-7a-5p GAGGTAGTAGGTTGTATTGT 7 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGTTT 44 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGTTT 44 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGTTA 39 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGTTA 39 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGTTG 8 5
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGTTG 8 5
mmu-let-7a-5p ATGAGGTAGGAGGTTGTATAGTTT 2 1
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTTT 118 10
mmu-let-7a-5p TGAGGTAGTAGGTTGTATTTT 118 10
mmu-let-7a-5p GGTAGTAGGTTGTATNGTT 34 4
mmu-let-7a-5p GGTAGTAGGTTGTATNGTT 34 4
mmu-let-7a-5p GAGGTAGTAGGTTGTATGGTTTGA 2 4
mmu-let-7a-5p TGAGGTAGNAGCTTGTATAGTT 4 5
mmu-let-7a-5p TGAGGTAGNAGCTTGTATAGTT 4 5
mmu-let-7a-5p TGNGGTAGTAGGTTGTATATTT 7 3
mmu-let-7a-5p TGNGGTAGTAGGTTGTATATTT 7 3
mmu-let-7a-5p GAGGTAGTAGGTTCTATAGTTT 2 2
mmu-let-7a-5p GAGGTAGTAGGTTCTATAGTTT 2 2
mmu-let-7a-5p GAGGTAGTAGGTTCTATAGTTA 2 2
mmu-let-7a-5p GAGGTAGTAGGTTCTATAGTTA 2 2
mmu-let-7a-5p TNATGTAGTAGGTTGTATAG 2 3
mmu-let-7a-5p TNATGTAGTAGGTTGTATAG 2 3
mmu-let-7a-5p TGNGGTAGTAGGTTGT 9 10
mmu-let-7a-5p TGNGGTAGTAGGTTGT 9 10
mmu-let-7a-5p GAGGTAGTAGGTTGGATAGTT 4 3
mmu-let-7a-5p GAGGTAGTAGGTTGGATAGTT 4 3
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGAAT 9 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAGAAT 9 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATC 2 4
mmu-let-7a-5p TGAGGTAGTAGGTTGTATC 2 4
mmu-let-7a-5p TNAGGTAGTAGGTTGTACAGTT 3 3
mmu-let-7a-5p TNAGGTAGTAGGTTGTACAGTT 3 3
mmu-let-7a-5p ATGNGGTAGTAGGTTGTATAGTT 2 1
mmu-let-7a-5p TGAGGTAGTAGGTCGTATAGTTAT 4 1
mmu-let-7a-5p TNAGGTAGTGGGTTGTATAGTT 3 2
mmu-let-7a-5p TNAGGTAGTGGGTTGTATAGTT 3 2
mmu-let-7a-5p AGGTAGTAGGTTGTATAGTTAT 4 2
mmu-let-7a-5p NTAGGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p NTAGGTAGTAGGTTGTATAGTT 3 2
mmu-let-7a-5p ATAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p ATAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7a-5p GGTAGTAGGTTGTNTAGT 9 2
mmu-let-7a-5p GGTAGTAGGTTGTNTAGT 9 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAATT 99 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTATAATT 99 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGCTT 2 2
mmu-let-7a-5p GAGGTAGTAGGTTGTATAGCTT 2 2
mmu-let-7a-5p TGAGGTAGTGGGTTGTATAGTTG 2 4
mmu-let-7a-5p TGAGGTAGTGGGTTGTATAGTTG 2 4
mmu-let-7a-5p TNAGTTAGTAGGTTGTATAGTT 18 2
mmu-let-7a-5p TNAGTTAGTAGGTTGTATAGTT 18 2
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGA 2 6
mmu-let-7a-5p TGAGGTAGTAGGTTGTACAGA 2 6