id_rna sequence raw_count mapping_loci
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTT 672027 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTT 2068 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTT 531 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTT 500 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGG 333 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTT 44 1
mmu-let-7b-5p GAGGTAGTAGGTCGTGTGGTTA 3 1
mmu-let-7b-5p TGAGGGAGGAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTCGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTTA 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTTT 8 3
mmu-let-7b-5p TNAGGTAGTAGGTCGTGTGG 2 1
mmu-let-7b-5p NAAGGTAGTAGGTTGTGTGGTTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTT 289 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTC 3 4
mmu-let-7b-5p TNGTAGGTTGTGTGGTTA 2 13
mmu-let-7b-5p GAGGTAGTAGGTTCTGTGGT 4 1
mmu-let-7b-5p TGATGTAGTAGGTTTTGTGGT 2 5
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTAT 3 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTAAG 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAG 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAT 22 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAA 24 1
mmu-let-7b-5p TGCGGTAGTAGGTTGT 6 12
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGG 5 1
mmu-let-7b-5p TAGGTTGTAGGTTGTGTGGTT 4 19
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGT 8 2
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGTTT 11 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACA 26 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACC 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACG 16 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTG 7 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGT 3 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTTT 4 2
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTA 60 1
mmu-let-7b-5p TGAGGTAGTAGTTTGAGTGGTT 3 2
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGG 8 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGA 2 13
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCTA 24 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTTGA 6 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTT 18 2
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTA 19 2
mmu-let-7b-5p GAGGTAGTAGTTTGTGTGGTTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTNGT 10 11
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTTAA 10 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGG 250 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGA 19 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGT 4 3
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTTC 2 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTTG 12 1
mmu-let-7b-5p TGANGTAGTAGGTTGTG 8 1
mmu-let-7b-5p TGAGGGAGTAGGGTGTGTGGTT 6 3
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTTA 14 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTG 11 4
mmu-let-7b-5p TGATAGTAGGTTGTGTGGT 2 32
mmu-let-7b-5p TGAGGGTGTAGGTTGTGTGGT 3 7
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTTA 103 2
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTGT 2 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGT 408 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGA 8 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTTGA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGT 101 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAT 225 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTA 6 2
mmu-let-7b-5p GTAGGTTGTGTGGTTTTA 3 9
mmu-let-7b-5p TGANGTAGTAGGTCGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTATG 2 9
mmu-let-7b-5p GGTAGTAGGTTGTGTNGTT 8 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGA 16 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGATT 2 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTAA 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTA 7 4
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGG 80 2
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTG 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGTTT 6 5
mmu-let-7b-5p GGTAGTGGGTTGTGTGGTT 3 3
mmu-let-7b-5p TGAGGCAGTAGGTCGTGTGGTT 3 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTG 4 3
mmu-let-7b-5p TGCGGTAGTGGGTTGTGTGG 2 6
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p TGAGGTAGTANTTTGTGTG 4 8
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTAC 4 1
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b-5p TGAGNTAGTCGGTTGTGTGG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAGAG 11 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGG 9 1
mmu-let-7b-5p GGTAGTCGGTTGTGTGGTTA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTC 175 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTA 11400 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTN 24 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTG 374 1
mmu-let-7b-5p TNAGGTAGTAGGTCGTGTGGTT 2 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTTA 17 2
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTTG 2 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTTT 15 2
mmu-let-7b-5p TGAGGCGGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p GTAGGTTGTGTGNTT 38 18
mmu-let-7b-5p TGAGNTAGTAGGTTGTTTGGT 2 5
mmu-let-7b-5p TGCGGTATTAGGTTGTGTGGTT 6 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTA 7 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTG 2 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGG 490 1
mmu-let-7b-5p GNAGGTTGTGTGGTTT 32 14
mmu-let-7b-5p GAGGTAGTANGTTGTGTGGTTT 25 1
mmu-let-7b-5p GGTAGAAGGTTGTGTGGTT 4 7
mmu-let-7b-5p GTAGGTTGTGTGGTTTAAT 2 41
mmu-let-7b-5p TGGGGTATTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p TGAGGTAGTTGGTTGCGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTAC 4 1
mmu-let-7b-5p TNAGCTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGAC 3 1
mmu-let-7b-5p GAGGTAGTAGGATGTGTGGTT 20 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTTTT 40 4
mmu-let-7b-5p TGAGGTCGNAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTAT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAG 3719 2
mmu-let-7b-5p TGATGTAGTAGGTNGTGTGGTT 8 2
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTTAA 12 1
mmu-let-7b-5p GAGGTAGTAGGTCGTGTGGT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTG 76 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p GAGGTTGTAGGTTGTGTGGTTTT 2 2
mmu-let-7b-5p AGGTAGTAGGTTNTGTGGT 2 1
mmu-let-7b-5p TAGGTGGTAGGTTGTGTGGTT 2 5
mmu-let-7b-5p TGAGGAGGTAGGTTGTGTGGTT 9 2
mmu-let-7b-5p TGAGGTAGTATGTNGTGTGGTTT 2 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGA 44 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGG 483 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTT 5627 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTA 99 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTGA 2 2
mmu-let-7b-5p TGACGTAGTAGGTTGAGTGGTT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGT 1624 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGA 24 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTG 2 1
mmu-let-7b-5p TGGNGTAGTAGGTTGTGTGGT 268 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGG 166 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCG 10 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGA 10 15
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTAT 8 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTAGTT 3 3
mmu-let-7b-5p TGAGGTAGTGGGNTGTGTGGTT 5 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTCTGGTT 2 3
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTG 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGG 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGA 4 40
mmu-let-7b-5p GAGGTAGTAGGTTGTCTGGT 9 3
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTAA 14 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTG 28 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTTT 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTTG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTTA 21 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTTA 6 2
mmu-let-7b-5p TGAGNTAGAAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGT 11 2
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGA 41 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTTT 6 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTTT 10 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTTA 6 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTGT 8 1
mmu-let-7b-5p GAGGTTGTAGGTTGTGTGGTT 58 1
mmu-let-7b-5p GAGGTTGTAGGTTGTGTGGTA 2 6
mmu-let-7b-5p TNAGGTAGTAGGTT 51 48
mmu-let-7b-5p TGCTAGTAGGTTGTGTGGT 2 25
mmu-let-7b-5p TGAGNTACTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGCGGTTT 3 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGGT 39 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTTA 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTTT 17 2
mmu-let-7b-5p TGAGGTAGTCGGCTGTGTGGTT 8 2
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTG 2 3
mmu-let-7b-5p GAGTAGTAGGTTGTGTGGTT 8 7
mmu-let-7b-5p TGAGGTAGTAGTTTGTCTGGTT 2 5
mmu-let-7b-5p TGGGGTCGTAGGTTGTGTGGTT 31 2
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGG 4 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGT 1240 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGA 25 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTG 2 3
mmu-let-7b-5p AGTAGGTTGTGTGNTT 5 5
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTT 63 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTA 47 1
mmu-let-7b-5p GAGGNAGTAGGTTGTGTGGTTA 2 1
mmu-let-7b-5p TTAGGTAGTAGGCTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTTTA 4 2
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTTTA 3 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGG 381 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGT 9 5
mmu-let-7b-5p TGAGGTAGTACGTNGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTTTGGTT 3 3
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTT 130 1
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTA 88 1
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTG 9 2
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTT 23 1
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTG 2 1
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTA 16 2
mmu-let-7b-5p NGAGGTAGTAGGTCGTGTGGTT 2 1
mmu-let-7b-5p GAGNTAGTAGGTTGTGTGG 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTG 43 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTA 672 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTC 22 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTT 956 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTA 910 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTGGGTT 2 7
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGTT 53 1
mmu-let-7b-5p TGGGGTAGTAGGTTGAGTGG 3 8
mmu-let-7b-5p TGGGGGAGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTG 2 5
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTTG 2 1
mmu-let-7b-5p GAGGTAGTAGNATGTGTGGT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGT 16 1
mmu-let-7b-5p TGCGGCAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TTAGGTAGTAGTTTGTGTGGTT 5 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTT 368 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTG 14 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTA 263 1
mmu-let-7b-5p GACNTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TNAGTTAGTAGGTTGTGTGGT 8 2
mmu-let-7b-5p ANTAGGTTGTGTGGT 4 23
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGGTT 17 1
mmu-let-7b-5p TGAGGTAGTANATTGTGTGGT 150 3
mmu-let-7b-5p TGNGGTAGTAGGTTTTGTGGT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGCTA 2 3
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGT 16 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTTAA 5 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTT 515 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTA 9 1
mmu-let-7b-5p GGTAGTAGGTTGNGTGGTT 10 1
mmu-let-7b-5p TNAGGTAGTAGGTTGT 45 9
mmu-let-7b-5p TNGTAGGTTGTGTGGTT 13 2
mmu-let-7b-5p TGAGGTAGTAGTTTGTGT 15 9
mmu-let-7b-5p GAGGTAGTAGGTTGTCTGGTT 90 3
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTTAA 5 1
mmu-let-7b-5p TGCGGTAGTAGGTTGAGTGGTTT 96 1
mmu-let-7b-5p TAGGTAGTAGGTTGTCTGGTT 3 4
mmu-let-7b-5p TAGTAGGTTGTGTGGTAT 9 6
mmu-let-7b-5p TGAGGTAGTAGGTTGTTAGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCTT 5 8
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGNTTA 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTCTGGTA 4 6
mmu-let-7b-5p TNAGGTAGTAGGTTGTATGGTTTC 12 3
mmu-let-7b-5p NGAGGCAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGT 3 1
mmu-let-7b-5p CAGGTAGTAGGTTGTGTGGTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTNTTGTGGTTT 3 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGT 266 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGA 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGG 21 2
mmu-let-7b-5p TGANGCAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTG 2 2
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTGA 5 1
mmu-let-7b-5p GAGGTAGTAGGTNGTGTGGTTA 16 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTC 14 2
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTT 617 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTA 423 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTG 29 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTATAA 2 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGT 8 2
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTAT 5 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTTA 8 2
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGA 2 1
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGT 73 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTA 28 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAAT 4 1
mmu-let-7b-5p AGTAGGTTGNGTGGTT 4 4
mmu-let-7b-5p TGAGGGAGTGGGTTGTGTGGTT 7 4
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTAC 2 1
mmu-let-7b-5p NGAGGAAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGTTT 16 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGTTA 13 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTAGTT 5 3
mmu-let-7b-5p AGTAGGTTGTGTGGTTTT 20 9
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGNTTTGTGGTT 3 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGG 35 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGA 2 21
mmu-let-7b-5p TGAGGTAGTAGGTTGTG 1264 1
mmu-let-7b-5p TGCGGTAGTAGGTTGCGTGGT 38 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGT 6 6
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAAT 251 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTTGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAAA 18222 1
mmu-let-7b-5p TAGTATGTTGTGTGGTT 2 24
mmu-let-7b-5p TGGGGTAGTAGGTTGTCTGGTTT 3 3
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTC 4 2
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTA 155 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTG 9 2
mmu-let-7b-5p TGAGGTAGTAGGGTGTTTGGTT 2 4
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTTA 62 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTCTGGTTT 3 3
mmu-let-7b-5p GAGGTGGTAGGTTGTGTGGTTT 10 1
mmu-let-7b-5p GAGGTGGTAGGTTGTGTGGTTA 13 1
mmu-let-7b-5p TGNCGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTTTGGTT 2 5
mmu-let-7b-5p TNAGGCAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TNAGGTACTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTG 4 24
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTG 164 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTAT 20 1
mmu-let-7b-5p ANTAGGTTGTGTGGTT 29 5
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTG 15 1
mmu-let-7b-5p TGAGGTAGTANTTTGTGTGGTT 516 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p ANGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TGAGNTAGTAGTTTGTGTGGTTT 2 3
mmu-let-7b-5p TGAGGTAGNAGGTTGTATGGTTTC 19 3
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGG 42 1
mmu-let-7b-5p GAGGTAGTAGGTGGTGTGGTTA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGA 6 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTT 129 1
mmu-let-7b-5p TAGTAGGTTGTGTG 6 15
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTG 12 4
mmu-let-7b-5p TGCGGTAGTAGGTTGAGTGGT 55 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGTT 2 2
mmu-let-7b-5p TAGTNGGTTGTGTGGTT 3 5
mmu-let-7b-5p TGGGGTAGTAGGTTGAGTGGT 6 2
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTA 2 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTT 333 1
mmu-let-7b-5p TGAGGGAGTAGGTTGCGTGGT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTTAA 8 2
mmu-let-7b-5p TAGNAGGTTGTGTGGTT 9 4
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTG 7 3
mmu-let-7b-5p TGCGGTGGTAGGTTGTGTGG 2 5
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGT 246 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGG 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGC 23 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGA 495 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGA 708 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGT 509 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGC 27 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTA 137 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTT 238 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTC 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTG 5 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTGC 2 1
mmu-let-7b-5p TGAGGTAGTANGTGGTGTGGTT 5 2
mmu-let-7b-5p TGAGGTAGTGGGTTGNGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGT 17 2
mmu-let-7b-5p GAGGTAGTAGGTTGGGTGGT 2 1
mmu-let-7b-5p TGCGGTAGTAGCTTGTGTGGTT 3 2
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTC 7 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTATGGTTTC 4 3
mmu-let-7b-5p TGAGGTAGTAGGCTGTGT 3 6
mmu-let-7b-5p GAGNTAGTAGGTTGTGTGGTT 61 1
mmu-let-7b-5p GAGNTAGTAGGTTGTGTGGTA 2 2
mmu-let-7b-5p GTAGGTTGTNTGGTTT 8 11
mmu-let-7b-5p TGACNTAGTAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGNTAGCAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTTGTTT 5 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGT 934 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGA 12 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTA 14 1
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGG 25 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGT 243 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTG 14 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTAT 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTTC 3 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTATGGTTTC 7 3
mmu-let-7b-5p NGAGGTAGTAGATTGTGTGGTT 4 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTAA 272 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGT 5 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGA 2 19
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTAT 4 3
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTTGTT 2 2
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTAC 4 1
mmu-let-7b-5p TAGTAGGTTGTGTGG 40 3
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p TGANGTGGTAGGTTGTGTGGTTT 5 1
mmu-let-7b-5p GAGGTAGTANGTTGTGTGG 9 1
mmu-let-7b-5p TGGGGTAGTAGGTTGNGTGGT 2 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTAC 17 1
mmu-let-7b-5p TNAGGTAGTAGGTTTTGTGGTTT 8 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTAGTT 12 3
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTAC 25 1
mmu-let-7b-5p TGAGNTAGGAGGTTGTGTGGT 2 1
mmu-let-7b-5p TGAGTTAGTAGGTTGNGTGG 2 5
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTA 24 2
mmu-let-7b-5p TNAGGCAGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTAA 33 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTTAA 54 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTTTGGTT 3 5
mmu-let-7b-5p GAGCTAGTAGGTTGTGTGGTTT 6 1
mmu-let-7b-5p CGNGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p AGGTAGTAGGTTGTGNGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGCNGTGTGGTT 3 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGT 51 3
mmu-let-7b-5p TGAGGTAGTAGGTNGTATGGTTTC 4 3
mmu-let-7b-5p TAGTAGGTTGTGCGGTTA 3 16
mmu-let-7b-5p GNTAGTAGGTTGTGTGGTTT 6 1
mmu-let-7b-5p GNTAGTAGGTTGTGTGGTTA 7 1
mmu-let-7b-5p TGAGNTAGTAGGTTGT 3 15
mmu-let-7b-5p TGAGGTAGTAGGTTTNGTGGTTT 2 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTT 93 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAGG 3 3
mmu-let-7b-5p TGCGGTCGTAGGTTGTGTGGT 32 1
mmu-let-7b-5p TGGGGTAGTAGGTGGTGTGGTTT 2 1
mmu-let-7b-5p NGAGGTAGTAGTTTGTGTGGTT 2 2
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTG 11 2
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTAT 14 2
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGA 3 10
mmu-let-7b-5p TGCGGTAGTAGGGTGTGTGGTT 4 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTCTGGTT 6 3
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTG 2 7
mmu-let-7b-5p GANGTAGTAGGTTGTGTGGTTT 17 1
mmu-let-7b-5p GANGTAGTAGGTTGTGTGGTTA 11 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTAT 25 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGT 1266 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGC 4 2
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGA 24 1
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTAGTT 2 4
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTG 2 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTAT 44 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTGT 3 1
mmu-let-7b-5p NGGGGTAGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTA 30 1
mmu-let-7b-5p TNGTAGGTTGTGTGGTTT 6 1
mmu-let-7b-5p GNGGTAGTAGGTTGTGTG 2 1
mmu-let-7b-5p TGACGTAGTAGGCTGTGTGGTT 3 1
mmu-let-7b-5p GAGTTAGTAGGTTGTGTGGT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTAT 9 1
mmu-let-7b-5p TANTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTG 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTA 36 2
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTT 47 2
mmu-let-7b-5p GAGGTAGTAGGTTNTGTGGT 13 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTAGTT 2 5
mmu-let-7b-5p GAGGTTGTAGGTTGTGTGG 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTA 127 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTC 3 3
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGG 111 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGA 6 9
mmu-let-7b-5p GAGGTAGTGGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGA 3229 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGG 48128 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGT 1261 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGA 129 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTT 1543 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTA 21 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAG 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCAA 4 1
mmu-let-7b-5p TTAGTTAGTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p GAGGTAGTAGGTTNTGTGG 7 1
mmu-let-7b-5p CGATGTAGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTANCTTGTGTGGT 114 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTAC 5 1
mmu-let-7b-5p TGAGGTAGTANATTGTGTG 9 5
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTAGTT 2 3
mmu-let-7b-5p TGAGGCAGTAGGTTGCGTGGTTT 3 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGA 3 11
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTA 22 3
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTT 1384 1
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTT 483 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCAGTT 3 6
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTG 10 1
mmu-let-7b-5p TGAGGTGGTCGGTTGTGTGGTT 2 3
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTAT 111 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTGGGT 6 10
mmu-let-7b-5p NGCGGTAGTAGGTTGTGTGGTT 17 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTTTA 15 1
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p TGCGGTCGTAGGTTGTGTGG 15 3
mmu-let-7b-5p TGAGGTAGTNGGTTCTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTT 138 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTA 130 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTC 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTG 8 1
mmu-let-7b-5p TGGGGTCGTAGGTTGTGTGGT 8 6
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTTT 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTTG 2 1
mmu-let-7b-5p TTAGGGAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p CGAGNTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGGAGTAGGCTGTGTGGT 4 11
mmu-let-7b-5p GGTAGTAGGTTGTGTGT 5 24
mmu-let-7b-5p GGTAGTAGGTTGTGTGG 30 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGA 7 5
mmu-let-7b-5p TNAGGTAGTAGGCTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGG 25 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGA 3 3
mmu-let-7b-5p TGGNGTAGTAGGTTGTGTGG 131 2
mmu-let-7b-5p GAGGTAGTAGGTTGGGTGGTT 5 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTTT 14 2
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTTC 3 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTTA 9 2
mmu-let-7b-5p GAGGTAGTCGGTTGTGTGGTTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGCGGT 2 1
mmu-let-7b-5p TGCNGTAGTAGGTTGTGTGGTT 307 1
mmu-let-7b-5p TNAGGTAGTGGGTTGTGTGG 3 5
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTGC 4 1
mmu-let-7b-5p TTAGGTAGTAGGTTTTGTGGTTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCAA 109 1
mmu-let-7b-5p CGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGGCGTAGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTTGA 2 2
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTAC 17 1
mmu-let-7b-5p GGANGTAGGTTGTGTGGTT 4 7
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTTC 5 1
mmu-let-7b-5p ANGTAGTAGGTTGTGTGGTT 13 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTATGGTTTC 2 3
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGT 261 1
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGA 3 2
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTT 1132 1
mmu-let-7b-5p TGAGGCAGTAGGTTGCGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTT 519 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTC 2 4
mmu-let-7b-5p GAGGTAGTAGGTGGTGTGGT 3 2
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTTC 76 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTA 254 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTT 315 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTG 14 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGT 88 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGA 2 4
mmu-let-7b-5p AAGGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TGAGGCGGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p TGAGGTAGTGGGATGTGTGGTT 3 2
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTAT 3 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGT 60 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGA 3 1
mmu-let-7b-5p TAGTAGGTTGTGTGGNT 6 2
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTG 6 1
mmu-let-7b-5p TGAGTTAGTAGGNTGTGTGGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGG 51 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTT 2596 1
mmu-let-7b-5p GAGGTAGTATGTTGTGTGGTTTT 2 2
mmu-let-7b-5p AGTAGGTTGTGTGGTTTAA 8 3
mmu-let-7b-5p GTAGGTTGTGNGGTT 4 13
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTC 3 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTG 11 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTTT 21 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTTA 15 1
mmu-let-7b-5p NTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGTTATTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTG 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGT 63 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGA 2 4
mmu-let-7b-5p TGAGGCAGTAGGTTCTGTGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGG 84 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGA 7 3
mmu-let-7b-5p TNCGGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGT 2 5
mmu-let-7b-5p GTNGGTTGTGTGGTTT 10 11
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGG 62 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTTAA 5 1
mmu-let-7b-5p TGACGTAGTNGGTTGTGTGGT 2 1
mmu-let-7b-5p TGAGGTAGTAGTTTTTGTGGTTT 3 4
mmu-let-7b-5p TCATGTAGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TNGTAGGTTGTGTGGT 2 5
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTT 318 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTA 9 4
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGG 97 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGA 6 26
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGC 191 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGA 5276 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGT 4976 2
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTT 6447 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTC 3 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTA 89 2
mmu-let-7b-5p TGGGGTAGTAGGTTGAGTGGTTT 10 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTG 2 13
mmu-let-7b-5p TGAGGGTGTAGGTTGTGTGGTTT 4 2
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTT 200 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTCA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTCT 7 3
mmu-let-7b-5p TNAGGTAGTAGTTTGTGTGGTT 14 2
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGT 103 1
mmu-let-7b-5p TGAGGTAGNAGGTTGTG 10 7
mmu-let-7b-5p GTAGNTTGTGTGGTTT 7 5
mmu-let-7b-5p TNAGGTAGTAGGTTGTTTGGTTT 14 3
mmu-let-7b-5p GAGTTAGTAGGTTGTGTGGTT 15 1
mmu-let-7b-5p GGTAGTAGGTTGTGTG 9 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGG 155 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGA 14 9
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGT 4 27
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTA 283 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTT 341 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTG 15 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTA 3 3
mmu-let-7b-5p TAGGTAGTAGGTNGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTATGGTTTC 3 3
mmu-let-7b-5p GTAGTAGGTTGTGTGGTA 8 7
mmu-let-7b-5p GTAGTAGGTTGTGTGGTT 379 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTT 402 1
mmu-let-7b-5p TNGGTAGTAGGTTGTGTGGT 2 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGGGGTT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTTTTTGGTT 8 4
mmu-let-7b-5p NAGTTAGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGCGGTTT 2 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTG 52 1
mmu-let-7b-5p TGAGGTACTAGGNTGTGTGGTT 3 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGTTT 2 3
mmu-let-7b-5p GAGGTAGTAGGTNGTGTGG 7 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTAT 16 1
mmu-let-7b-5p TGATGTAGTAGGATGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGCTTGAGTGGTTT 3 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTT 782 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTT 1517 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTA 1078 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTC 24 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTTAA 74 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATC 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATA 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGATT 27 1
mmu-let-7b-5p TGANGTAGTAGGTTGTATGGTTTC 3 3
mmu-let-7b-5p GAGGTAGTANGTTGTGTG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTATA 699 1
mmu-let-7b-5p NGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p TNAGGTAGTAGGTTG 28 14
mmu-let-7b-5p TGAGGTAGTANATTGTGTGG 67 4
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAC 4 2
mmu-let-7b-5p GTAGGTTGTNTGGTT 59 19
mmu-let-7b-5p TGAGGTAGTANGTTGTGG 2 23
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGT 758 1
mmu-let-7b-5p TGAGTTAGTAGGTNGTGTGGTT 18 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTT 263 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGA 33 2
mmu-let-7b-5p TGAGGTAGTANTTTGTGTGGT 81 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTG 2 17
mmu-let-7b-5p GGGGTAGTAGGTTGTGTGGT 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCTT 4 2
mmu-let-7b-5p TGCGGTAGTGGGTTGTGTGGTT 5 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTG 9 2
mmu-let-7b-5p GTAGGTTGTGTGGNT 29 17
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAAA 7 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGT 13 4
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTT 57 1
mmu-let-7b-5p GAGGNAGTCGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTCGTT 2 6
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGG 74 2
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTTTT 2 2
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTT 58 1
mmu-let-7b-5p AGTCGGTTGTGTGGTT 4 30
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTTA 21 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGA 5 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTT 182 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTC 4 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTA 140 2
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTTT 7 2
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTTTA 15 1
mmu-let-7b-5p TNAGGTAGTTGGTTGTGTGGTT 2 2
mmu-let-7b-5p GAGGTAGTAGGTTGTATGGTTTAAG 2 4
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTAGTT 2 5
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTTT 4 26
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTTAA 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAC 56 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAG 202 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAA 965 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAT 401 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTT 2123 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTG 121 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTA 1506 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTC 39 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTG 5 3
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTN 48 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTG 9250 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTC 3371 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTA 139829 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTT 194870 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTGT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTGA 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGGA 14 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTA 1508 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTC 66 2
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTA 230 1
mmu-let-7b-5p TGGGTTAGTAGGTTGTGTGGTT 5 4
mmu-let-7b-5p AGTAGGTTGTGTGG 64 20
mmu-let-7b-5p NGAGGTAGTAGGTTGTGT 3 2
mmu-let-7b-5p AGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTC 6 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTT 113 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTA 59 1
mmu-let-7b-5p TGAGGTAGNATGTTGTGTGGTT 9 1
mmu-let-7b-5p GGACGTAGGTTGTGTGGTT 2 12
mmu-let-7b-5p AGTAGGTTGTGTGGTTC 5 14
mmu-let-7b-5p TGGGGTAGTNGGTTGTGTGGTT 3 1
mmu-let-7b-5p GTAGTAGGTTNGGTGGTT 2 13
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGT 79 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGA 3 3
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTTTA 20 1
mmu-let-7b-5p GAGGTAGTAGGGTGTGTGGTTA 2 2
mmu-let-7b-5p TGAGNTAGCAGGTTGTGTGGTT 10 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTC 6 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTT 441 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTA 5 3
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGG 21 2
mmu-let-7b-5p TGAGGTAGTGGGTTGTTTGGTT 2 5
mmu-let-7b-5p TGACGTAGTAGGTTGTGTG 2 1
mmu-let-7b-5p GTAGGTTGTGTGNTTT 10 6
mmu-let-7b-5p TCACGTAGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGCTGTAGGTTGTGTGGTT 6 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGCT 6 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGAT 7 1
mmu-let-7b-5p TGAGGTATTAGGTTTTGTGGTT 4 2
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGT 23 3
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTG 14 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGCTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTATGGTTTC 4 3
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGT 157 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGT 192 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTT 64 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTG 7 1
mmu-let-7b-5p TGAGGCCGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTTT 4 2
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTTCGGTTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGGTTGGTT 7 10
mmu-let-7b-5p TGAGGTATTAGGTTGNGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTAT 10 2
mmu-let-7b-5p GAGGTAGTAGNGTGTGTGG 3 13
mmu-let-7b-5p TGAGGTAGTNGGTTGTG 5 3
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTTC 5 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTTA 153 2
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTTG 11 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTAGT 3 3
mmu-let-7b-5p GAANTAGTAGGTTGTGTGGT 4 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTA 8 16
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTTT 3 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGT 41 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGTTT 3 1
mmu-let-7b-5p GTCGTAGGTTGTGTGGTT 4 3
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGT 12 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGTTT 4 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTC 140 1
mmu-let-7b-5p GAGGTTGTAGGTTGTGTGGT 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACAA 8 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGG 3 2
mmu-let-7b-5p TGAGGAAGTGGGTTGTGTGGTT 2 4
mmu-let-7b-5p TGAGGCAGTAGGTTGTGT 3 8
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGGTTT 41 3
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGGTTA 26 3
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGGTTG 2 3
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTT 419 1
mmu-let-7b-5p GAGCTAGTAGGTTGTGTGGT 2 2
mmu-let-7b-5p TGCGGTAGTAGGTTG 6 34
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTG 16 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTC 3 1
mmu-let-7b-5p GAGGTAGTAGATTGTGTGGTTT 2 2
mmu-let-7b-5p NGAGGTGGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGGGGTAGTNGGTTGTGTGGT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTTTT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTTTA 3 1
mmu-let-7b-5p TNAGGTAGTAGGTTATGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGT 56 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTAC 4 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTTAA 11 1
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGGTT 39 1
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGGTA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGTTT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTTGTT 4 9
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTAT 20 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGG 726 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGA 57 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGT 21 3
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTT 1688 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTG 76 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTA 1201 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTC 25 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTC 6 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTT 283 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTG 16 3
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTA 214 1
mmu-let-7b-5p TGAGTGAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p GGCAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGA 17 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGC 3 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGT 1114 1
mmu-let-7b-5p TGAGGTAGTAGATTGTATGGTTTC 2 4
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTTGTT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGTT 2 3
mmu-let-7b-5p AGTAGGTTGTGTNGTTT 2 3
mmu-let-7b-5p AGTAGGTTGTGTNGTTA 2 48
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTT 443 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTG 23 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTC 9 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTA 286 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTTTGGTT 9 3
mmu-let-7b-5p TGAGGCAGTAGGTTTTGTGGTTT 2 2
mmu-let-7b-5p TGAGNTAGTAGGTTTTGTGGTTT 2 1
mmu-let-7b-5p TGGNGTAGTAGGTTGTGTGGTT 1663 1
mmu-let-7b-5p GTAGNTTGTGTGGTT 25 14
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTTTA 2 1
mmu-let-7b-5p TGATNTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGG 10 4
mmu-let-7b-5p TGAGGTAGTANTTTGTGTGGTTTC 2 1
mmu-let-7b-5p CTGGGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTTA 13 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTTT 8 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGTT 6 8
mmu-let-7b-5p GGTTGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTTA 26 2
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTTT 46 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTGA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTC 4 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGG 30 1
mmu-let-7b-5p NGAGGTATTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTG 3 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTT 803 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTA 519 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTG 39 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTC 20 1
mmu-let-7b-5p TGCGGTGGTAGGTTGTGTGGT 4 3
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTGT 3 1
mmu-let-7b-5p GAGGTAGTAGGATGTCTGGT 3 10
mmu-let-7b-5p TGANGTAGTAGGTTGTCTGGTTT 70 3
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTT 8014 1
mmu-let-7b-5p GAGGTAGTAGTTTGTGTGGTT 8 2
mmu-let-7b-5p TGAGNTAGGAGGTTGTGTGGTTT 4 1
mmu-let-7b-5p TNAGGTAGTAGGTTTTGTGGT 5 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGATTT 2 1
mmu-let-7b-5p GAGGTGGTAGGTTGTGTGG 3 1
mmu-let-7b-5p GTAGTAGGTTGTGAGGTT 2 3
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTTGA 2 1
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTAC 5 1
mmu-let-7b-5p GNAGTAGGTTGTGTGGTTTA 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGG 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTTTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGCTTGTCTGGTT 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTGC 2 1
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTT 267 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTAGTTT 3 3
mmu-let-7b-5p TGATGTAGTAGGTTGNGTGGTT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTAGTT 2 3
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTG 64 1
mmu-let-7b-5p TGCGGTGGTAGGTTGTGTGGTT 10 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTTAAG 4 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTTTGGTTT 3 4
mmu-let-7b-5p TNGTAGTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTA 55 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTG 3 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTT 3150 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTAT 4 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTAT 92 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGT 272 1
mmu-let-7b-5p GAGGTAGAAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p TAGGGTAGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGT 38 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGC 2 5
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGG 106 2
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTT 409 1
mmu-let-7b-5p GGTCGTAGGTTCTGTGGTT 2 24
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTG 24 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTTTT 5 2
mmu-let-7b-5p TGACNTAGTAGGTTGTGTGGT 3 2
mmu-let-7b-5p TAGGTTGTGTGGTT 319 27
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTT 63 1
mmu-let-7b-5p GAGGTTGTAGGTTGTGTGGTTA 9 1
mmu-let-7b-5p TGAGGTCGTCGGTTGTGTGGTT 19 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTTT 2 3
mmu-let-7b-5p GAGGTAGTAGGTTATGTGG 4 3
mmu-let-7b-5p TCTGAGGTAGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGAT 2 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTAT 28 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTAA 7 1
mmu-let-7b-5p TGATGTAGTAGGNTGTGTGGTT 5 1
mmu-let-7b-5p GAGGTAGTATGTTGTGTGGTT 4 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGTTTT 8 1
mmu-let-7b-5p TGGTAGGTTGTGTGGTT 2 33
mmu-let-7b-5p GANGTAGTAGGTTGTGTGGT 14 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTAC 2 1
mmu-let-7b-5p GGAGTAGGTTGTGTGGTTT 2 3
mmu-let-7b-5p TGAGGGGGTAGGTTGTGTGGTT 9 2
mmu-let-7b-5p AGTAGGTTGTGTGCTTT 2 22
mmu-let-7b-5p TGANGTAGTAGGTTG 10 15
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p NGACGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p NGAGGTAGTAGGTGGTGTGGTT 3 1
mmu-let-7b-5p TCGTAGGTTGTGTGGTT 2 7
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTT 1166 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTA 19 3
mmu-let-7b-5p GAGGTAGTAGGTTNTGTGGTTT 12 1
mmu-let-7b-5p GAGGTAGTAGGTTNTGTGGTTA 12 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTTT 9 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTTA 10 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGT 8 1
mmu-let-7b-5p GAGGTAGTAGGTTATGTGGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTT 387 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTA 12 1
mmu-let-7b-5p TGCGGTAGTAGGTTGGGTGGT 19 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGCT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTG 2 4
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTTT 20 2
mmu-let-7b-5p GGTCGTAGGTTGTGTGGTT 15 1
mmu-let-7b-5p TGAGGGAGTAGTTTGTGTGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTTA 32 2
mmu-let-7b-5p TTAGGTAGTAGGTTTTGTGGTT 3 10
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTA 5 3
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTAGT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTAT 103 1
mmu-let-7b-5p TAGTAGGTTGTGCGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGAT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTNGTT 3 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTAA 7 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGTT 4 4
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTA 16 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGT 83 2
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGG 416 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGA 28 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGT 9 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTG 14 4
mmu-let-7b-5p TGATGTAGTNGGTTGTGTGGTT 5 1
mmu-let-7b-5p GAGGTATTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAA 60 16
mmu-let-7b-5p GAGGTAGTAGGTNGTGTGGTTTA 2 2
mmu-let-7b-5p TGAGGAAGTCGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTT 19 1
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTA 4 1
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTG 3 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTAT 6 4
mmu-let-7b-5p TGAGGAAGNAGGTTGTGTGGTTTC 3 1
mmu-let-7b-5p TGAGNTAGTAGGTTTTGTGGTT 2 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGG 101 1
mmu-let-7b-5p GTAGGTTGTGTGGT 538 15
mmu-let-7b-5p TGAGGTCGTCGGTTGTGTGGT 6 3
mmu-let-7b-5p TGAGGGAGTAGGTGGTGTGGTT 11 3
mmu-let-7b-5p GGTAGTAGGTTGTNTGGT 2 3
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGCT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGAT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAT 147 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAG 30 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAC 10 2
mmu-let-7b-5p TNAGGTAGTCGGTTGTGTGGTTT 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTAC 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGAA 841 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTC 11 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGAT 5 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGTTTT 2 3
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTAT 23 2
mmu-let-7b-5p GGTAGTAGGTTGAGTGGTT 2 2
mmu-let-7b-5p TGCGGGAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGCGGTAGTAAGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTT 6011 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTC 3 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTA 109 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTTT 46 2
mmu-let-7b-5p TGAGGTAGTAGATTGTG 5 27
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGTT 166 1
mmu-let-7b-5p TGCAGTAGTAGGTTGTGTGGTT 3 2
mmu-let-7b-5p TGAGGGGGTAGGTTGTGTGGTTT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTTTGGTTT 3 3
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTTTA 4 1
mmu-let-7b-5p TGAGGGAGNAGGTTGTGTGGTT 28 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGA 6 14
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTTTT 10 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGTT 2 2
mmu-let-7b-5p TTAGGTAGTNGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGGT 14 1
mmu-let-7b-5p TTAGGTAGTAGGNTGTGTGGTT 5 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGT 2 2
mmu-let-7b-5p TGGGGTAGTCGGTTGTGTGGTT 2 1
mmu-let-7b-5p NGAGGTAGTAGATTGTGTGGTTT 2 2
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGTTA 12 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTAT 16 1
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGTTG 2 4
mmu-let-7b-5p TGAGGTAGTAGGNTG 9 22
mmu-let-7b-5p TGANGTAGTAGGTTGTTTGGTT 22 3
mmu-let-7b-5p TGAGGAAGTAGGTTGTGT 3 10
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGCTT 2 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p GAGGTAGTAGNTTGTGTGG 2 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTAT 9 4
mmu-let-7b-5p TGNGGTATTAGGTTGTGTGGT 3 3
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTT 201 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTA 4 2
mmu-let-7b-5p TAGTAGGTTGTGNGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCG 5 1
mmu-let-7b-5p TAGGAGGTTGTGTGGTTT 3 13
mmu-let-7b-5p GNAGGTTGTGTGGTT 142 30
mmu-let-7b-5p TGAGGTAGTAGGTTGGTTGGTTT 4 4
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTAGTT 3 3
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTA 1201 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTT 1728 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTG 72 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTC 28 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTTT 13 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTTA 7 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGTTT 31 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGCTT 2 1
mmu-let-7b-5p NGAGTTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p GTAGGTTGTGTGGTTAC 9 5
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGT 48 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGTTT 12 2
mmu-let-7b-5p TGAGNTAGTAGGTTGTTTGGTT 6 5
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTT 62 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGGTA 3 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGTTTT 2 1
mmu-let-7b-5p TGAGGGAGNAGGTTGTGTGGT 5 2
mmu-let-7b-5p TGAGGTAGTNGGTTGTGT 16 3
mmu-let-7b-5p TAGTAGGTTNTGTGG 2 24
mmu-let-7b-5p AGTAGGTTGTGTGGTTTG 2 11
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTGT 3 9
mmu-let-7b-5p TGCGGTAGTAGGTTTTGTGGTTT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGG 4 5
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAGT 13 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAC 21 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAA 756 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAG 92 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAT 777 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTTA 2 3
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGTT 27 2
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTAT 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGTTT 6 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTT 1552 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTC 25 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTG 85 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTA 1160 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTTAA 66 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGTAG 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTT 285 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTG 10 3
mmu-let-7b-5p GAGGTAGTAGNATGTGTGGTT 15 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTCTT 2 1
mmu-let-7b-5p TTAGGTAGTAGATTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAGA 4 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGG 218 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGT 5 15
mmu-let-7b-5p TNAGGTTGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGCTGTAGTAGGTTGTGTGGTT 5 2
mmu-let-7b-5p TGAGGTGGTGGGTTGTGTGGTTT 2 3
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTTAA 6 2
mmu-let-7b-5p TGAGGTAGCAGGNTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTTA 2 2
mmu-let-7b-5p TGANGTACTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p GAGGTAGTAGNGTGTGTGGTT 6 2
mmu-let-7b-5p TGAGGTATTAGGTNGTGTGGTTT 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTTTGGTT 3 4
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTA 137 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTC 4 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTT 7065 1
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTGTT 9 3
mmu-let-7b-5p NGCGGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TGANCTAGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p TGACGGAGTAGGTTGTGTGGTT 7 2
mmu-let-7b-5p TNGGGTAGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTG 14 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTA 2 7
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTA 134 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTT 7374 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTC 3 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTTT 7 2
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p TGAGGTAGTAGTTNGTGTGGTTT 3 2
mmu-let-7b-5p TGNGTTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGAT 5 3
mmu-let-7b-5p TGAGTTAGTAGGCTGTGTGGTT 4 3
mmu-let-7b-5p GNTAGTAGGTTGTGTGGTT 60 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTA 112 20
mmu-let-7b-5p AGTAGGTTGTGTGGTTT 201 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTG 13 19
mmu-let-7b-5p CGAGGGAGTAGGTTGTGTGGTT 3 3
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTC 6 3
mmu-let-7b-5p GGTAGTAGGTTGTNTGGTTT 6 3
mmu-let-7b-5p GGTAGTAGGTTGTNTGGTTA 2 3
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTTA 28 2
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGGTT 2 2
mmu-let-7b-5p TGANGTAGTAGGTTGTGT 14 1
mmu-let-7b-5p GAGGTAGTAGGTGGTGTGGTTT 4 1
mmu-let-7b-5p TGAGGTAGNAGGTTGTCTGGT 10 3
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTA 5756 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTG 383 1
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGTTT 10 2
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGTTA 6 2
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGTTG 2 6
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTA 61 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTC 3 1
mmu-let-7b-5p GAGGTAGTAGNTTGTGTGGTT 4 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTG 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTG 3 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTTTGGTT 2 6
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTGA 3 6
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTGT 7 16
mmu-let-7b-5p TGAGGTAGTAGGNTGTG 9 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTG 3 2
mmu-let-7b-5p TTAGGTAGTAGGTGGTGTGGTT 3 2
mmu-let-7b-5p TGANGTAGTAGGTTGT 4 8
mmu-let-7b-5p TGAGGGCGTAGGTTGTGTGGTT 13 1
mmu-let-7b-5p TGANGTAGTAGGTTCTGTGGTT 2 3
mmu-let-7b-5p TAGGTTGTGTGGTTTC 2 3
mmu-let-7b-5p GNTAGTAGGTTGTGTGG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTAA 9 2
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTG 5 4
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGT 42 1
mmu-let-7b-5p TGGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCT 101 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCC 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCG 42 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCA 54 2
mmu-let-7b-5p GTAGGTTGTGTGGTTT 553 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTTT 21 2
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTAT 80 1
mmu-let-7b-5p TGAGGAAGNAGGTTGTGTGGTT 6 2
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTTTA 15 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTAT 15 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTGA 191 4
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGTTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTTTA 4 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGCGGTT 2 2
mmu-let-7b-5p GAGATAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTT 656 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTG 36 2
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTA 437 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTTA 10 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTTTA 4 3
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTG 21 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTTTGGTTT 5 3
mmu-let-7b-5p TGAGGTACTAGGTTGNGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGCTNGTGTGGT 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGCGTGGTTT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTAT 77 1
mmu-let-7b-5p TGAGGGAGTACGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGT 47 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGA 3 2
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTTTA 16 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTCTGGTTT 5 3
mmu-let-7b-5p AGTAGGTTGTGTGGTNT 2 2
mmu-let-7b-5p AGGTAGTAGGTTNTGTGGTT 2 1
mmu-let-7b-5p TGANGCAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p GGAGTAGGTTGTGTGGTT 5 4
mmu-let-7b-5p TAGGTAGTAGGTTGTNTGGTT 10 3
mmu-let-7b-5p GANGTAGTAGGTTGTGTGGTTTT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTTGA 2 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTTG 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAATT 2 2
mmu-let-7b-5p TGAGGGAGGAGGTTGTGTGGTT 5 3
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTT 43 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTA 35 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p GAGGTAGTAGGTGGTGTGGTT 4 1
mmu-let-7b-5p TCAGGTAGTAGGTTTTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTAC 3 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTTTA 12 1
mmu-let-7b-5p CGAGGAAGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGT 3 17
mmu-let-7b-5p TGAGGTAGCAGGTTGTCTGGTT 2 4
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTTCC 5 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTTAAG 5 1
mmu-let-7b-5p TGANGTAGTAGGTTGTTTGGT 4 3
mmu-let-7b-5p TGTAGTAGGTTGTGTGG 8 16
mmu-let-7b-5p TNAGGTAGTAGGTTGTGCGGTTT 6 1
mmu-let-7b-5p TNAGGGAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTGA 4 2
mmu-let-7b-5p GAGTTAGTAGGTTGTGTGGTTA 2 3
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTAT 389 1
mmu-let-7b-5p TGAGGCAGNAGGTTGTGTGGTTTC 2 1
mmu-let-7b-5p GAGGTGGTAGGTTGTGTGGT 19 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTG 38 1
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGTT 30 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAG 56 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAA 166 1
mmu-let-7b-5p GAGGTAGTAGGGTGTGTGGTT 24 1
mmu-let-7b-5p GATAGTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTT 172 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTC 3 2
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTA 109 2
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTG 8 1
mmu-let-7b-5p NGAGGTAGTAGGTTTTGTGGT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTTT 18 1
mmu-let-7b-5p TTAGGTATTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTG 3 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTA 27 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGT 1070 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGA 15 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTGA 36 1
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGGTTA 11 1
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGGTTT 17 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGTTT 2 1
mmu-let-7b-5p TGTAGTAGGTTGTGCGGTT 2 12
mmu-let-7b-5p TGAGGTAGTGGGTNGTGTGGTTT 2 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTTA 14 1
mmu-let-7b-5p TNAGCTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTG 4 1
mmu-let-7b-5p GAGGTAGTAGGGTGTGTGGT 6 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTT 79 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTG 6 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTA 62 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATC 19 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATG 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATT 41 2
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTC 27 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTA 1237 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTT 1718 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTG 94 1
mmu-let-7b-5p TGAGGTAGTAGATTGCGTGGTTT 2 1
mmu-let-7b-5p TGAGGGAGTCGGTTGTGTGGTT 14 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCT 69 1
mmu-let-7b-5p TGNGGTAGTAGTTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTG 3 17
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATTA 23 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGA 15 3
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTGT 2 2
mmu-let-7b-5p TCCGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGATTGTGTG 5 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTGT 2 6
mmu-let-7b-5p TGGGGTAGTAGGTTGTG 5 18
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTGT 2 1
mmu-let-7b-5p TNAGGTAGTGGGTTGTGTGGT 5 1
mmu-let-7b-5p GTAGTAGGTTGTGTGNTT 4 1
mmu-let-7b-5p GAGGTAGTAGGTTATGTGGTT 8 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTTTTA 4 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTTT 129 2
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTTC 2 1
mmu-let-7b-5p TTANGTAGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGGTAGTANGTTG 4 19
mmu-let-7b-5p GAGGTAGTANGTTGTGTGGT 18 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTC 3 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTT 184 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTG 8 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTA 105 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGGTTT 9 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGGTTA 6 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTTTA 3 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTTT 6 2
mmu-let-7b-5p GAGGNAGTCGGTTGTGTGGTT 12 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTGT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGN 16 10
mmu-let-7b-5p TGAGGTAGTAGGTTGT 817 8
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTT 39 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTA 21 1
mmu-let-7b-5p TGNGGTAGTAGTTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTATNAGGTTGTGTGGTT 4 1
mmu-let-7b-5p GTGGTAGTAGGTTGTGTGGT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCA 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCC 2 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTAGTTT 2 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTGAA 13 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGT 224 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTAA 24 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGTTTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTCTTGTGGTTT 2 2
mmu-let-7b-5p TGAGGTAGTNGTTTGTGTGGT 2 3
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGA 5 4
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTAT 6 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTG 39 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAAT 2 4
mmu-let-7b-5p TGAGGTAGTAGATTGGGTGGTT 4 2
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTTG 7 1
mmu-let-7b-5p TGATGTAGTAGGTTGTTTGGTT 2 4
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTGA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTT 1841 2
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGTTTT 3 3
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTC 22 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGT 247 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGA 3 5
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTT 103 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGCT 2 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTNTTGTGGTT 7 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTT 472 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTA 5 2
mmu-let-7b-5p TGAGGTAGTAGGTNGTGCGGTT 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGCGGTT 2 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGCGGTT 2 1
mmu-let-7b-5p GAGGCAGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGG 15 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGA 2 14
mmu-let-7b-5p TGAGGTATTAGGTTGTTTGGTT 2 6
mmu-let-7b-5p GGCNGTAGGTTGTGTGGTT 3 2
mmu-let-7b-5p CGAGGTAGTAGGCTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGCTGTG 3 25
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTG 2 1
mmu-let-7b-5p TAGGTTGTGTGGTTT 78 13
mmu-let-7b-5p GTANTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGGATGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGG 12 3
mmu-let-7b-5p TGAGGTAGTAGTTTGCGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTAC 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTGA 56 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTGT 17 2
mmu-let-7b-5p TNAGGTATTAGGTTGTGTGGTT 21 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGTTT 2 4
mmu-let-7b-5p GAGGTAGTAGGTTGTGT 13 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTT 139 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTG 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTC 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGAGTGGTT 27 1
mmu-let-7b-5p TGAGGGAGTAGGTTGAGTGGTT 3 1
mmu-let-7b-5p GTAGGTTGTGTCGTTT 2 12
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTT 176 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTG 18 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTA 83 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTC 5 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGGT 8 4
mmu-let-7b-5p TTAGGTAGTAGGTTGTG 4 15
mmu-let-7b-5p TTANGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTTTGGTTT 4 3
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTTC 4 1
mmu-let-7b-5p TCTGAGGTAGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGG 12 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTAT 4 4
mmu-let-7b-5p GTAGTAGGTTGTGTGGTAA 11 28
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGT 467 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGA 6 6
mmu-let-7b-5p GGTNGTAGGTTGTGTGGTT 8 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTTAA 13 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTT 605 1
mmu-let-7b-5p TGAGGTAGTNTGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTATTAGGNTGTGTGGTT 2 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCGA 16 1
mmu-let-7b-5p NGAGGTAGTAGCTTGTGTGGTT 3 1
mmu-let-7b-5p GGTAGGAGGTTGTGTGGTTA 2 12
mmu-let-7b-5p GGTAGGAGGTTGTGTGGTTT 2 2
mmu-let-7b-5p GTGGTAGTAGGTTGTGTGGTTT 4 1
mmu-let-7b-5p GTGGTAGTAGGTTGTGTGGTTA 3 1
mmu-let-7b-5p TGAGGTAGTGGATTGTGTGGTT 2 2
mmu-let-7b-5p TGAGNTAGTCGGTTGTGTGGTTT 15 1
mmu-let-7b-5p GAGNTAGTAGGTTGGGTGGT 2 5
mmu-let-7b-5p TGAGGTAGTAGTNTGTGTGGT 2 1
mmu-let-7b-5p TGCGGTAGTAGGCTGTGTGGTT 9 2
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGT 106 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGG 8 1
mmu-let-7b-5p GGTAGTAGGTTGTG 2 9
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGC 5 1
mmu-let-7b-5p TGAGGTAGGAGGTNGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGT 16 1
mmu-let-7b-5p TGTGGTAGTAGGTNGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCG 5 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGTTT 4 3
mmu-let-7b-5p TGNGGTAGTAGGTTTTGTGGTTT 4 1
mmu-let-7b-5p GTAGGTTGTGTGGTTTT 43 41
mmu-let-7b-5p GTAGGTTGTGTGGTTTA 19 24
mmu-let-7b-5p TGAGGTAGTAGGATGTGTG 2 2
mmu-let-7b-5p TGAGNTAGTAGGTTGTG 4 1
mmu-let-7b-5p GAGGTAGTAGGATGTCTGGTT 11 5
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTAT 65 1
mmu-let-7b-5p GTANGTTGTGTGGTTT 3 8
mmu-let-7b-5p TGAGGTAGTAGGTTTTCTGGTT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTGG 3 3
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTTT 9 1
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTT 158 3
mmu-let-7b-5p AGTAGGTTGTGTGGTT 519 1
mmu-let-7b-5p AGTAGGTTGTGTGGTN 3 7
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTA 72 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTA 423 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTGC 2 1
mmu-let-7b-5p TGANGTAGTAGGTTGTCTGGT 63 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAA 68461 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAC 1844 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAG 15477 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTAGTT 2 3
mmu-let-7b-5p TNAGGTAGTAGGTTGTGCGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGTTT 5 1
mmu-let-7b-5p GGGAGTAGGTTGTGTGGTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTC 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATT 209 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATA 7 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTATA 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGGTT 62 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTT 596 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTA 29 4
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTT 58 1
mmu-let-7b-5p TGATTTAGTAGGTTGTGTGGT 3 5
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGT 223 1
mmu-let-7b-5p TNGGTAGTAGGTTGTGTGGTT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTACA 4 1
mmu-let-7b-5p TGATTTAGTAGGTTGTGTGGTT 7 3
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTTAA 7 1
mmu-let-7b-5p TAGTAGGTTGNGTGGTT 2 2
mmu-let-7b-5p GAGGTAGTAGGCTGTCTGGTT 12 4
mmu-let-7b-5p GGGNGTAGGTTGTGTGGTT 2 7
mmu-let-7b-5p TCAGGTAGTAGGTTGTTTGGTT 2 5
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGGTA 11 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTTG 4 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTTA 28 2
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTTTT 35 2
mmu-let-7b-5p GAGNTAGTAGGTTGGGTGGTT 8 3
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGG 9 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGT 2 6
mmu-let-7b-5p TGNGGTAGTAGGTTGTTTGGTT 11 3
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTTT 211 2
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTAC 5 1
mmu-let-7b-5p GAGGTAGTAGGTTG 14 26
mmu-let-7b-5p TGAGGTGGTNGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGGGTGG 5 1
mmu-let-7b-5p TGCGGTAGTAGGTTGGGTGGTTT 19 1
mmu-let-7b-5p TGATNTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TGANTTAGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TAGNTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGCTTGAGTGGTT 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCAAG 9 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTTA 111 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATA 162 2
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTAT 101 1
mmu-let-7b-5p GAGGTAGTAGGATGTGTGGT 6 2
mmu-let-7b-5p TGTAGTAGGTTGTGTGGT 31 7
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGCTT 4 4
mmu-let-7b-5p TGCGGTAGTAGGTTGAGTGGTT 323 1
mmu-let-7b-5p TGAGGTAGTNGGTTTTGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTG 5 4
mmu-let-7b-5p TGAGGTAGTANCTTGTGTG 6 5
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTAT 6 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTAC 12 1
mmu-let-7b-5p TGNGGGAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTTA 91 2
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTTT 137 2
mmu-let-7b-5p TGAGGAAGTAGGTTGTTTGGTT 4 5
mmu-let-7b-5p TGAGGTAGTGGGTCGTGTGGTT 3 1
mmu-let-7b-5p TGGNGTAGTAGGTTGTGTGGTTT 481 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTTA 4 2
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTTT 17 2
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGTTT 5 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGTT 37 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAAA 163 1
mmu-let-7b-5p CAGGTAGTAGGTTGTGTGGTT 12 2
mmu-let-7b-5p TGAGGTAGTANGTAGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTATAG 71 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTTA 15 3
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTTTT 26 2
mmu-let-7b-5p TAGTACGTTGTGTGGTTT 2 2
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGG 542 1
mmu-let-7b-5p GANGTAGTAGGTTGTGTGG 7 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAC 11 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAA 314 5
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAT 58 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAG 21 2
mmu-let-7b-5p TNAGGTAGTAGTTTGTGTGG 4 3
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGT 88 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGCGGT 2 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTTGA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAG 53 3
mmu-let-7b-5p GATGTAGTAGGTTGTGTGGTT 12 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGG 29 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGA 8 5
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTAC 2 1
mmu-let-7b-5p GAANTAGTAGGTTGTGTGGTT 9 1
mmu-let-7b-5p TGCGGTAGTCGGTTGTGTGGTTT 4 1
mmu-let-7b-5p NGTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGA 2 1
mmu-let-7b-5p GGGGTAGTAGGTTGTGTGGTTG 2 2
mmu-let-7b-5p TGAGGGAGTTGGTTGTGTGGTT 3 4
mmu-let-7b-5p TGAGGTCGTAGGTTGCGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGT 28 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGA 3 3
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTT 1764 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTG 87 1
mmu-let-7b-5p TGAGGTAGTAGGTTTCGTGGTT 2 1
mmu-let-7b-5p GTAGTAGGTTGTGTG 2 5
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTAC 5 1
mmu-let-7b-5p CTAGGTAGTAGGTTGTGTGG 2 8
mmu-let-7b-5p GGTAGTAGGTNGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTNA 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAT 220 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAG 56 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAC 16 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGAA 893 2
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTTAA 13 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGT 67 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGG 42 2
mmu-let-7b-5p GGGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTGA 6 1
mmu-let-7b-5p TGAGGCAGTAGGCTGTGTGGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGNTGTTTGG 2 3
mmu-let-7b-5p NCAGGTAGTAGGTTGTGTGGTT 5 2
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGT 42 1
mmu-let-7b-5p TAGGTGGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTAC 18 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGT 114 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGA 3 7
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTT 276 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTA 9 2
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTTT 164 2
mmu-let-7b-5p GNAGTAGGTTGTGTGGTTT 10 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTTG 9 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTATGGTTTC 2 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTGGGGTT 4 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTT 91 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTC 28 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTA 52 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTG 3 3
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTA 94 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTT 135 2
mmu-let-7b-5p TNAGGTAGTAAGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTT 4543 17
mmu-let-7b-5p GAGGTACTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p NGGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGCNGTAGTAGGTTGTGTGGTTT 87 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGAT 2 1
mmu-let-7b-5p TGAGGTAGTGGGTNGTGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGT 108 1
mmu-let-7b-5p TCATGTAGTAGGTTGTGTGG 2 6
mmu-let-7b-5p NGCGGTAGTAGGTTGTGTGGTTT 5 1
mmu-let-7b-5p TGAGGTAGNACGTTGTGTGGTT 2 1
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGGTTTT 2 2
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b-5p GAGGTAGTAGNCTGTGTGGTT 6 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTTGA 9 1
mmu-let-7b-5p TGAGGGAGCAGGTTGTGTGGTT 2 3
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTTT 10 2
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTTA 8 13
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTTG 6 13
mmu-let-7b-5p TGAGGTAGTAGGTTGTTT 14 15
mmu-let-7b-5p GAGGTAGTAGGTTGTTTGGTT 23 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTT 89 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTA 67 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTG 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTTC 4 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTGT 2 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTTT 198 2
mmu-let-7b-5p GAGGTAGTAGGTTGGGTGGTTA 2 2
mmu-let-7b-5p TGNGGTGGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGCGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTGGG 3 18
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTTA 4 2
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTTT 5 2
mmu-let-7b-5p GAGGTAGTAGGTTGCGTGGTTT 2 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTTA 59 2
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTTG 8 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGCT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGTTT 2 1
mmu-let-7b-5p TANTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTA 32 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTC 2 1
mmu-let-7b-5p CTGAGGTAGNAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTCGNAGGTTGTGTGGT 3 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTTA 28 2
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTTG 3 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTTT 43 2
mmu-let-7b-5p TGAGNTATTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGG 22 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGA 4 15
mmu-let-7b-5p TGAGGTAGTAGCTCGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGTT 2 1
mmu-let-7b-5p TGGGAGTAGGTTGTGTGGTT 4 24
mmu-let-7b-5p GTNGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TNGTAGGTTGTGTGGTTTA 2 9
mmu-let-7b-5p TGCGGTCGTAGGTTGTGTGGTT 142 1
mmu-let-7b-5p TTGAGGTAGTAGGTTGTGTGGTT 5 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGT 4750 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGA 67 1
mmu-let-7b-5p TNAGGTAGTAGGTTCTGTGGTT 8 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTT 1023 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTA 16 3
mmu-let-7b-5p TGGGGTCGTAGGTTGTGTGGTTT 7 1
mmu-let-7b-5p TGAGGTAGCAGGTTTTGTGGTT 2 4
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGG 15 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGA 2 31
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTA 4 3
mmu-let-7b-5p TNAGGTAGTAGGTTGTG 45 2
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTT 182 1
mmu-let-7b-5p TGANGTAGTGGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTTT 3 3
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p GGGGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGT 553 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGA 15 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTTGTT 2 1
mmu-let-7b-5p TGNGGTAGTGGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTAA 51 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTTTAA 21 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGA 9 2
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGG 115 1
mmu-let-7b-5p TGAGGCAGNAGGTTGTGTGGTT 4 2
mmu-let-7b-5p TGAGGGATTAGGTTGTGTGGTT 4 4
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTT 1290 1
mmu-let-7b-5p TGGTAGTAGGTTGTGTGGTT 113 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTA 29 3
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTG 44 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTTT 19 2
mmu-let-7b-5p AGTAGGTTGTGTNG 3 47
mmu-let-7b-5p TGAGGTCGTCGGTTGTGTGGTTT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTTAA 15 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTTG 3 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTATGGTTTC 2 3
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTAGTTT 3 6
mmu-let-7b-5p TTNGGTAGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGG 81 1
mmu-let-7b-5p TGNGCTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGCGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGG 121 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGA 11 10
mmu-let-7b-5p TGAGGCAGCAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGTTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGNT 23 1
mmu-let-7b-5p AGGGAGTAGGTTGTGTGGTT 3 2
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGG 33 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTAG 4 17
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTAA 10 11
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGTTT 9 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGT 214 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTTGA 4 1
mmu-let-7b-5p GAGGTAGCAGGTTGTGTGGT 2 3
mmu-let-7b-5p NGAGGTAGTAGGTTCTGTGGTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTG 71 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTA 2 6
mmu-let-7b-5p TGCNGTAGTAGGTTGTGTGGT 59 2
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGGT 46 3
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTT 804 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGTA 27 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTT 73 1
mmu-let-7b-5p TGAGGTAGTANGTGGTGTGGTTT 2 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTTA 9 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGG 9 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTGC 5 1
mmu-let-7b-5p TGAGGGCGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGCGGTAGTGGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTTT 4 2
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTTA 21 2
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTTT 22 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGAC 4 1
mmu-let-7b-5p ACGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAAA 9 3
mmu-let-7b-5p GTTAGTAGGTTGTGTGGTT 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCT 111 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCG 2 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTGC 2 1
mmu-let-7b-5p TGAGGTAGTAGTTTGGGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTGT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTCAA 2 1
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTTGC 2 1
mmu-let-7b-5p TGATAGTAGGTTGTGTGGTT 4 14
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTTA 3 2
mmu-let-7b-5p TGAGGGAGTAGGTTGCGTGGTTT 8 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTTAG 4 1
mmu-let-7b-5p TGGNGTAGTAGGTTGTGTGGTTTC 3 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTT 331 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTA 7 4
mmu-let-7b-5p GGTAGTAGGTTGTCTGGTT 6 3
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTCT 3 3
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTGT 2 1
mmu-let-7b-5p TGANGTAGTAGCTTGTGTGGTTT 2 1
mmu-let-7b-5p GGGGTAGTAGGTTGTGTGGTA 3 3
mmu-let-7b-5p TAGTAGGTTGTGTTGTT 5 33
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTG 3 1
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGTTTT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCAGGTT 2 5
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTTA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTTGA 2 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTTTA 4 1
mmu-let-7b-5p TGANGTAGTAGGTTGTCTGG 11 4
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTAA 36 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGT 48 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAGC 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAGA 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAGT 6 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTG 2 4
mmu-let-7b-5p NTAGGTTGTGTGGTT 14 27
mmu-let-7b-5p GGGGTAGTAGGTTGTGTGGTT 77 1
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTT 71 1
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTA 2 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTG 8 1
mmu-let-7b-5p TNAGGTAGTAGTTTGTGTGGTTT 5 2
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGGT 14 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTG 12 1
mmu-let-7b-5p TGAGNTAGTTGGTTGTGTGGTT 2 5
mmu-let-7b-5p TGAGGGAGTAGGGTGTGTGGTTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAAT 32 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTT 52 1
mmu-let-7b-5p TGGGGTAGTAGGTTGCGTGGTT 12 1
mmu-let-7b-5p AGTAGGTTGNGTGGTTT 2 1
mmu-let-7b-5p TGAGGGAGTCGGTTGTGTGGT 2 4
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTA 293 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTGT 2 1
mmu-let-7b-5p TGACGTAGTAGGTNGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGT 10 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTTGT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGNGA 3 19
mmu-let-7b-5p TGAGGTAGTAGGTTGNGG 2 32
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGN 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGG 39 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGA 1862 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGC 127 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGGTTA 2 2
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTAC 3 1
mmu-let-7b-5p TTATGTAGTAGGTTGTGTGGTT 3 3
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTC 9 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTC 4 1
mmu-let-7b-5p TGAGCTATTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGT 33 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p TGCGGTAGTAGCTTGTGTGG 2 6
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTTTAAG 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGT 403 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGG 2 9
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTTA 71 1
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTTT 73 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p GATGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p GGTAGTAGGTTGTNTGG 2 3
mmu-let-7b-5p GAGGTAGTAGGCTGTGTGGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTTA 10 2
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTTTT 14 2
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGTTT 2 4
mmu-let-7b-5p TGGTAGTAGGTTGTGTG 2 20
mmu-let-7b-5p TNAGGTAGTAGGTTGTCTGGTT 7 3
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTT 436 1
mmu-let-7b-5p TGAGGCAGTAGGTTTTGTGGTT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTTTAA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTTAA 6 1
mmu-let-7b-5p TTAGGTAGTAGGTNGTGTGGTT 7 1
mmu-let-7b-5p TGAGGGTGTAGGTTGTGTGGTT 7 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTT 162 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGT 116216 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTT 5106 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTA 107 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTC 2 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTG 4 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTCTGGTT 4 3
mmu-let-7b-5p TGAGNTAGTAGTTTGTGTGG 2 5
mmu-let-7b-5p TGCGGTAGTAGGTTGCGTGG 19 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTTAA 6 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTTAA 9 1
mmu-let-7b-5p TNAGGTAGTATGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTC 3 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTG 4 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTA 95 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTT 162 2
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGT 19 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGNTT 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGNTA 3 1
mmu-let-7b-5p AGTAGGTTGTGTNGTT 4 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTA 39 2
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGTTT 7 2
mmu-let-7b-5p GAGGTAGTAGGCTGTGTGGTTT 6 1
mmu-let-7b-5p GAGGTAGTAGGCTGTGTGGTTA 4 1
mmu-let-7b-5p NGAGGCAGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p AGNAGGTTGTGTGGTT 7 11
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTG 2 5
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGT 223 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTGGA 6 4
mmu-let-7b-5p TGNGGTACTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGTTT 13 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTAG 2 3
mmu-let-7b-5p TCGTAGTAGGTTGTGTGGTT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTAT 14 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTTGT 2 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTT 1320 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTA 20 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTC 2 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTTTAA 77 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTAAA 14 8
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTG 8 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTC 8 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTT 111 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTG 38 1
mmu-let-7b-5p TGAGTTAGTAGGTNGTGTGGTTT 2 1
mmu-let-7b-5p GTAGTAGGTTGCGTGGTT 2 1
mmu-let-7b-5p GGAGGTAGTAGGTTGTGTGGT 10 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTTT 11 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTAT 6 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTAT 103 1
mmu-let-7b-5p GGTAGTAGGTTGCGTGGTT 7 1
mmu-let-7b-5p GAGGTAGTAGGTTGTG 13 2
mmu-let-7b-5p TGAGGTAGTAGGTTGNG 4 2
mmu-let-7b-5p TGAGGGAGTAGGTTGTTTGGTT 5 3
mmu-let-7b-5p GAGGTAGTAGNCTGTGTGGT 6 1
mmu-let-7b-5p GAGGNAGTAGGTTGTGTGGTT 8 1
mmu-let-7b-5p NAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGGCAGTAGGTTGTGTGGTT 4 14
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTT 1500 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGCGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGA 3 8
mmu-let-7b-5p TGAGGTCGTAGGTTGTCTGGTT 5 3
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTT 1328 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTA 33 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTA 39 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTG 11 4
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTAT 5 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGT 61 1
mmu-let-7b-5p TGAGNTAGTAGGTTG 3 23
mmu-let-7b-5p GAGGTAGTAGGGTGTGTGGTAT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTT 74 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTG 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTA 47 1
mmu-let-7b-5p TGAGGACGTAGGTTGTGTGGTT 2 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGGTT 2 1
mmu-let-7b-5p TGAGGTAGNATGTTGTGTGGT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGTTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTTTA 3 1
mmu-let-7b-5p AGGTATTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGCCGTAGTAGGTTGTGTGGTT 12 1
mmu-let-7b-5p TGAGGTAGTANGTTGT 2 12
mmu-let-7b-5p GTCGTAGGTTGTGTGGTTA 3 10
mmu-let-7b-5p TGATGTAGTAGATTGTGTGGTT 2 3
mmu-let-7b-5p NGATGTAGTAGGTTGTGTGGTT 9 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGTT 2 2
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCTG 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCTA 3 1
mmu-let-7b-5p GAGNTAGTAGGTTGTGTGGTTT 24 1
mmu-let-7b-5p TNAGATAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGNTAGTGGGTTGTGTGGTT 5 1
mmu-let-7b-5p NGACGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGGT 37 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTTTGGT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTG 681 10
mmu-let-7b-5p GAGGTAGTAGGTTGTCTGGTTT 10 3
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTTA 10 2
mmu-let-7b-5p GAGGTAGTAGGTTGTCTGGTTA 12 3
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTT 1911 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTA 1368 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTC 28 1
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGTTA 7 2
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTG 3 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAG 8 12
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAA 66 5
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTATA 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTTAA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTGA 2 1
mmu-let-7b-5p TGAGGTCGNAGGTTGTGTGGTT 4 1
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGGTAT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGG 67 7
mmu-let-7b-5p TGAGGTAGTAGGTTGTGT 1142 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGA 130 6
mmu-let-7b-5p NGAGGTAGTAGTTTGTGTGGTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTT 212 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTA 4 1
mmu-let-7b-5p TGAGTTAGTAGTTTGTGTGGTT 2 3
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGTTTAA 14 1
mmu-let-7b-5p TANGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGTAT 2 7
mmu-let-7b-5p TGTNGTAGTAGGTTGTGTGG 2 4
mmu-let-7b-5p TGAGGTATTNGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTACGTTGTGTGG 13 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAGA 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTA 102 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTT 157 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTG 7 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGGGGTT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTT 35 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTA 26 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCTG 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGAAT 2 2
mmu-let-7b-5p TGATGCAGTAGGTTGTGTGGTT 2 3
mmu-let-7b-5p TTAGGTAGTAGGNTGTGTGG 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTAC 7 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTAT 2 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTAC 23 1
mmu-let-7b-5p TGAGGTCGNAGGTTGTGTGGTTTC 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGT 61 1
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGC 12 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTAGA 26 1
mmu-let-7b-5p TNAGGTAGTAGTTTGTGTGGT 6 2
mmu-let-7b-5p NGTAGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p GGTAGGAGGTTGTGTGGTT 10 3
mmu-let-7b-5p CNGAGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTATGGTTTC 2 3
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTAT 14 1
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTTAA 3 1
mmu-let-7b-5p GGTGGTAGGTTGTGTGGTT 15 4
mmu-let-7b-5p GAGGTAGTAGGTTNTGTGGTT 55 1
mmu-let-7b-5p GAGGTAGTAGGTTNTGTGGTA 2 2
mmu-let-7b-5p GAGGTAGTAGGTTNTGTGGTTTA 2 3
mmu-let-7b-5p GAGGTAGTAGGTTNTGTGGTTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGT 46 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGG 3 10
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTTTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTAC 9 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTAT 24 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGGTT 34 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGG 406 2
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGT 8 17
mmu-let-7b-5p GCTAGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGGT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTCTGG 4 4
mmu-let-7b-5p TGTNGTAGTAGGTTGTGTGGT 13 3
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGTTT 6 1
mmu-let-7b-5p GTGGTAGTAGGTTGTGTGGTT 15 1
mmu-let-7b-5p GAGGTAGTAGGGTGTGTGG 3 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAG 14 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAA 40 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAT 80 6
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTTA 14 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTAT 48 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTGT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTTG 4 1
mmu-let-7b-5p GTAGNAGGTTGTGTGG 2 10
mmu-let-7b-5p TGAGGAAGGAGGTTGTGTGGTT 2 5
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTAGTT 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTTT 59 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTTA 64 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGTTG 6 5
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGGTT 232 3
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGGTA 4 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAAC 3 2
mmu-let-7b-5p TNAGGTAGTAGCTTGTGTGGTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTGC 2 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTTTGGT 4 3
mmu-let-7b-5p TGCGGTGGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTGA 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTATGGTTTGA 2 4
mmu-let-7b-5p NGATGTAGTAGGTTGTGTGGTTT 4 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGA 2 7
mmu-let-7b-5p TGNGGTAGTAGGTTGT 9 10
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTCGTT 3 1
mmu-let-7b-5p GAGGTAGTAGGTAGTGTGGTT 8 1
mmu-let-7b-5p GAGGTAGTAGGATGTGTGGTTA 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTGC 147 3
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGG 7 1
mmu-let-7b-5p TGCGGTAGTAGGTTGGGTGG 5 4
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTA 20 1
mmu-let-7b-5p NGAGGTAGTAGGATGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTTA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTA 103 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTT 22 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTG 3 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGTTA 14 1
mmu-let-7b-5p GTAGTAGGTTGTTTGGTTT 2 10
mmu-let-7b-5p GAGGTTGTAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTAT 2 1
mmu-let-7b-5p TNAGGTATTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p GAGGTAGTAGNCTGTGTGGTTT 3 1
mmu-let-7b-5p GTAGNAGGTTGTGTGGTT 6 2
mmu-let-7b-5p TGNGGTAGTAGTTTGTGTGGT 3 1
mmu-let-7b-5p TGAGGTGGTAGGCTGTGTGGTT 3 5
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTAA 195 2
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGTTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGGT 2 4
mmu-let-7b-5p GAGGTAATAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTT 128 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTA 3 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTC 2 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTA 6 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTT 1459 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTNT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTNA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGG 9 3
mmu-let-7b-5p TGAGGTAGTAGGTGGTGT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGTA 6 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGTT 7 2
mmu-let-7b-5p TGANGTAGTAGGTTGTCTG 3 5
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGA 14 1
mmu-let-7b-5p GTNGGTTGTGTGGTT 50 27
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTTTC 23 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGGTAT 71 1
mmu-let-7b-5p GAGGTAGTAGGTTTTGTGGT 9 3
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGG 29 3
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGGT 2 8
mmu-let-7b-5p GAANTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTTGA 8 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGCTT 2 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTA 8 2
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTTT 18 2
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGGGGTT 2 1
mmu-let-7b-5p GTAGTAGGTTGTGTGTTT 2 11
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTAGA 8 4
mmu-let-7b-5p GAGGTAGTAGGGTGTGTGGTTT 4 1
mmu-let-7b-5p CNAGGTAGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p GAACACGGACACCGCAGGGG 2 1
mmu-let-7b-5p CNAGGTAGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TGAGGTAGTAGCTTGGGTGGT 2 2
mmu-let-7b-5p TGAGGTAGTAGGTNGCGTGGTT 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTAA 25 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGTTTT 3 1
mmu-let-7b-5p NGAGGTAGTAGGTTTTGTGGTTT 3 2
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTTG 10 1
mmu-let-7b-5p TGCGGTAGTAGGTTGAGTGG 20 2
mmu-let-7b-5p AGTNGGTTGTGTGGTT 4 9
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGT 33 1
mmu-let-7b-5p TGATGGAGTAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCTGTTT 57 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTG 11 20
mmu-let-7b-5p GGNAGTAGGTTGTGTGGTT 11 1
mmu-let-7b-5p GTAGTAGGTTGTNTGGTT 8 3
mmu-let-7b-5p GAGGTAGTAGGGTGTCTGGT 2 10
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGT 960 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGA 15 6
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGC 3 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAGC 24 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTT 7 1
mmu-let-7b-5p NGAGGTAGTAGGCTGTGTGGTT 5 1
mmu-let-7b-5p TGGGGTTGTAGGTTGTGTGGTT 3 4
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGG 80 2
mmu-let-7b-5p TAGTAGGTTGTGTCGTT 3 6
mmu-let-7b-5p GAGGTAGTAGGTTGTNTGGTTAC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTTC 3 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTTT 155 2
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTTA 106 2
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTTG 12 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATGA 30 1
mmu-let-7b-5p TGAGGTAGTANGTTGTG 3 1
mmu-let-7b-5p TCNGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGA 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTT 494 1
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGGTA 12 3
mmu-let-7b-5p TGAGGTAGTAGCTTGCGTGGTT 6 1
mmu-let-7b-5p TGAGNTAGTCGGTTGTGTGGT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTATTT 3 5
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTG 9 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTA 101 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTC 7 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTTT 144 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGGTCT 2 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTTGTT 5 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTT 27088 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTA 454 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGTT 12 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGT 34 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGA 2 13
mmu-let-7b-5p TGAGGTAGTAGGTNGTG 12 3
mmu-let-7b-5p TGANGTAGTAGGTTGTGTG 42 1
mmu-let-7b-5p TGANGTAGTAGGTTGCGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTT 6102 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTG 5 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTA 81 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTA 2 2
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTGC 2 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTA 1254 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTC 29 1
mmu-let-7b-5p TGAGGTACTNGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTAGTT 2 3
mmu-let-7b-5p CGANGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTAC 3 1
mmu-let-7b-5p TGCGGTAGTAGGTTGGGTGGTT 51 1
mmu-let-7b-5p TGNGGTAGTGGGTTGTGTGG 2 4
mmu-let-7b-5p TNAGGTAGTAGGTTGCGTGGT 2 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGTTT 4 3
mmu-let-7b-5p GAGGTAGTAGTTTGTGTGGT 5 2
mmu-let-7b-5p TGTAGTAGGTTGNGTGGTT 3 7
mmu-let-7b-5p TGGGGTGGTAGGTTGTGTGGTT 9 5
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTTA 4 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGT 41 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGA 3 17
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTNT 4 2
mmu-let-7b-5p TGAGGTAGTAGGCTTTGTGGTT 2 6
mmu-let-7b-5p GAGGTAGTAGGTTCTGTGGTTT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGTTT 2 4
mmu-let-7b-5p GAGGTAGTAGGTTCTGTGGTTA 5 2
mmu-let-7b-5p TGAGGTAGTAGATTGTGCGGTT 2 2
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTTTGGTT 5 3
mmu-let-7b-5p GGAAGTAGGTTGTGTGGTT 6 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTAT 3 4
mmu-let-7b-5p GGTAGTAGGTTGTGGGGTT 2 2
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGA 2 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGG 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTC 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTA 93 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTG 13 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTT 2717 1
mmu-let-7b-5p TGGGTAGTAGGTTGTGTGGTT 25 7
mmu-let-7b-5p GAAGTAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p GAGGTAGTANGTTGTGTGGTA 3 1
mmu-let-7b-5p GAGGTAGTANGTTGTGTGGTT 63 1
mmu-let-7b-5p GAGGTAGTTGGTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGTCGGTTGTCTGGTT 10 3
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTTTT 2 2
mmu-let-7b-5p TNAGGTAGTAGGTTCTGTGGTTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTAAG 2 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTAT 6 1
mmu-let-7b-5p TNAGGTGGTAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTTAA 2 1
mmu-let-7b-5p GGGGTAGTAGGTTGTGTGGTTT 16 1
mmu-let-7b-5p GGGGTAGTAGGTTGTGTGGTTA 20 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGTTT 3 2
mmu-let-7b-5p TGAGGTAGTAGGTTGNTTGGTT 4 3
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTAT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTATC 26 3
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTT 321 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTG 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTTTA 8 1
mmu-let-7b-5p TANTAGGTTGTGTGGTTA 2 15
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTGAA 2 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGAT 3 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAAA 20 1
mmu-let-7b-5p GGTAGTAGGTTGTTTGGTT 12 3
mmu-let-7b-5p GAGGCAGTAGGTTGTGTGGT 6 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGG 19 1
mmu-let-7b-5p TGAGGTAGTAGGTGTTGTGGTT 2 4
mmu-let-7b-5p NAAGGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTG 12 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTTTAA 6 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTT 102 1
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGGTA 3 1
mmu-let-7b-5p TGATGTAGTAGGTNGTGTGGT 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGAGTGGTTTT 6 2
mmu-let-7b-5p GAGGTAGTAGGGTGTCTGGTT 17 3
mmu-let-7b-5p TNAGGTGGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p GTAGGTTGTGTGGTT 3435 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTT 20 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTA 7 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTG 2 1
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGGTTTA 7 2
mmu-let-7b-5p TNTAGTAGGTTGTGTGGTT 8 7
mmu-let-7b-5p TGTAGTAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGTAGTAGGNTGT 13 10
mmu-let-7b-5p AGGGAGTAGGTTGTGTGGT 2 4
mmu-let-7b-5p TATGTAGTAGGTTGTGTGGTT 3 3
mmu-let-7b-5p GAGGTAGTAGGTTGTCTG 5 9
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTA 312 2
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTG 23 2
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTC 6 2
mmu-let-7b-5p GTANGTTGTGTGGTT 25 21
mmu-let-7b-5p TGAGGTAGTAGGTTATGTGA 3 4
mmu-let-7b-5p CTGAGGTAGTAGNTTGTGTGGT 2 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGT 1079 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGA 25 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGCGGTT 5 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTAGT 3 3
mmu-let-7b-5p AGNAGGTTGTGTGGTTT 4 6
mmu-let-7b-5p GGTAGTAGGTTGTGTGTT 2 3
mmu-let-7b-5p TGGGGTAGTAGGTTGTTTGGTTT 4 3
mmu-let-7b-5p GGTAGTAGGNTGTGTGGTT 14 1
mmu-let-7b-5p TGNGGTAGTAGGTTTTGTGG 2 6
mmu-let-7b-5p TGNGGCAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGNGGTAGTAGGTTG 8 16
mmu-let-7b-5p TTAGGTAGTANGTTGTGTGGT 2 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTG 5 2
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTT 24 3
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTGA 4 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTGT 6 1
mmu-let-7b-5p TGAGGTAGTANTTTGTGTGG 56 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGTTTTT 3 2
mmu-let-7b-5p TGCGGGAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p NGAGGGAGTAGGTTGTGTGGTT 7 2
mmu-let-7b-5p GGTAGTCGGTTGTGTGGTT 2 1
mmu-let-7b-5p GAGGTCGTAGGTTGTGTGG 6 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTTT 20 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTA 44 2
mmu-let-7b-5p TGAGGTGGTAGGTTGTGTGTTT 3 2
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTT 129 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGTTA 67 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTA 38 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTG 3 7
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGGTAT 24 1
mmu-let-7b-5p GAGGTAGTAGGTCGTGTGG 2 1
mmu-let-7b-5p TGAGTTAGTANGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTAC 920 3
mmu-let-7b-5p NTAGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p GAGGTAGTAGGTTGTATGGTATC 3 3
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTT 1430 1
mmu-let-7b-5p GTNGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p TGAGGGAGTAGGTTGAGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGGTTTAA 56 1
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTTGT 2 3
mmu-let-7b-5p TGAGGGAGTAGGCTGTGTGGTT 12 4
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTTA 33 2
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTTT 58 2
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTT 4158 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTG 2 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGGGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTAA 3 1
mmu-let-7b-5p CGAGGTAGTAGGTTGTGTGGTA 6 1
mmu-let-7b-5p TTNGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTC 7 2
mmu-let-7b-5p TGAGGTAGTAGGTGGTGTGGTTA 314 1
mmu-let-7b-5p GAGGTAGTAGGTTATGTGGTTT 4 1
mmu-let-7b-5p GAGGTAGTAGGTTATGTGGTTA 4 1
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTA 2 3
mmu-let-7b-5p TGAGGTAGTAGGTTGATTGGTT 2 8
mmu-let-7b-5p GAGGTTGTAGGTTGTGTGGTTT 9 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTAC 101 1
mmu-let-7b-5p TGAGGTAGNAGGTTGTCTGGTT 19 3
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTG 2 1
mmu-let-7b-5p TGAGGTAGTATGTTGTGTGGTTA 27 1
mmu-let-7b-5p TGAGNTAGTCGGTTGTGTGGTT 51 1
mmu-let-7b-5p TGCGGTAGTAGGTNGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTATTAGATTGTGTGGTT 2 2
mmu-let-7b-5p GAGGTAGTAGGCTGTCTGGT 2 8
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTG 5 2
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTTTT 79 2
mmu-let-7b-5p GTAGTAGGTTGTGNGGTTA 2 2
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTAAA 3 1
mmu-let-7b-5p TNAGGTAGTGGGTTGTGTGGTTT 5 1
mmu-let-7b-5p GAGGTAGTAGGTNGTGTGGT 16 1
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGTTT 7 1
mmu-let-7b-5p GAGCTAGTAGGTTGTGTGGTTA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTTGTT 2 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGTTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTAC 2 1
mmu-let-7b-5p TGNGGCAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTCGGTT 2 3
mmu-let-7b-5p TGAGGCAGTAGGTNGTGTGGTT 2 1
mmu-let-7b-5p TTCGGTAGTAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGGGGGAGTAGGTTGTGTGGTT 11 2
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTA 72 1
mmu-let-7b-5p TGCGTTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTT 273 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGGTA 4 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTG 28 1
mmu-let-7b-5p TGGTGTAGTAGGTTGTGTGGTT 3 2
mmu-let-7b-5p TAGTAGGTTGTGTGGTTC 4 5
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGT 16 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGCTT 3 1
mmu-let-7b-5p GACGTAGTAGGTTGTGTGGTTA 2 1
mmu-let-7b-5p TGCTGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TAGTAGGTTGTGTNGTT 3 1
mmu-let-7b-5p TNAGGTAGTAGGTTGCGTGGTT 7 1
mmu-let-7b-5p TAGGTATTAGGTTGTGTGGTT 2 5
mmu-let-7b-5p TGAGGAGGTAGGTTGTGTGGT 5 3
mmu-let-7b-5p TGNTGTAGTAGGTTGTGTGGTT 5 2
mmu-let-7b-5p GACGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGT 16 3
mmu-let-7b-5p TNAGGTAGTAGGTTATGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTCTGGTTCC 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAAC 178 1
mmu-let-7b-5p GAGGTAGTAGGTTGTNTG 3 3
mmu-let-7b-5p TGAGGTAGTANATTGTGTGGTT 862 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTATAA 87 1
mmu-let-7b-5p GTAGGTTGTGTGGNTT 4 6
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGG 459 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGA 36 2
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGT 4 4
mmu-let-7b-5p CGCGGTAGTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TTAGNTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p GGGAGTAGGTTGTGTGGTT 7 2
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTT 17 3
mmu-let-7b-5p TCAGGTAGTAGGNTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTANTTTGTGTGGTTT 182 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTAC 4 1
mmu-let-7b-5p GTAGTAGGTTGTGTAGTT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGCTTTTA 4 1
mmu-let-7b-5p TGACNTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGT 15 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGA 19 2
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTTT 33 2
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTTA 16 2
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTTG 3 1
mmu-let-7b-5p TGGGGTAGTAGGTTTTGTGGT 2 9
mmu-let-7b-5p AGTAGGTTGTGTGGT 68 7
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAGA 5481 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGCAT 6 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTAC 3 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGTT 2 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTCTGGTT 4 3
mmu-let-7b-5p TGANGTAGTAGGTTTTGTGGTT 5 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGGT 10 1
mmu-let-7b-5p TGAGTTAGTAGGNTGTGTGGTT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTTTGGT 8 3
mmu-let-7b-5p NGATGTAGTAGGTTGTGTGGT 6 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTT 366 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTA 262 2
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTC 6 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGTTTT 2 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTG 11 1
mmu-let-7b-5p TGAGGTAGAAGGTTGTGTGGTT 54 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTATA 3 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTT 58 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGTTA 36 2
mmu-let-7b-5p GGTCGTAGGTTGTGTGG 2 4
mmu-let-7b-5p AGTAGGTTGTGTGGTTAAA 18 36
mmu-let-7b-5p TGAGGTAGTAGGTTGNATGGTTTC 4 3
mmu-let-7b-5p TGAGGTAGTAGGCTGTTTGGTT 5 3
mmu-let-7b-5p AAGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGGAGTAGGCTGTGTGGTTT 3 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGGGTTTT 2 1
mmu-let-7b-5p TNAGGTAGTCGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTANCTTGTGT 2 19
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTAT 10 1
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGT 1047 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGTTT 210 1
mmu-let-7b-5p TGAGGTAGTNGGTTGT 5 13
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTA 49 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTG 3737 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTT 7 4
mmu-let-7b-5p TGAGGTAGTAGGGTGTATGGTTTC 2 4
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTAA 4 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTAT 2 14
mmu-let-7b-5p GAGGTAGCAGGTTGTGTGGTT 6 2
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTAT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTATG 4 1
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTT 77 1
mmu-let-7b-5p TGCTAGTAGGTTGTGTGGTT 4 10
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAT 10277 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAC 863 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTAA 17503 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTC 36 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTA 1653 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTT 2043 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTTTGA 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAA 6909 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAC 164 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAT 5771 2
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTT 75 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGC 10 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTC 3 1
mmu-let-7b-5p NGAGGTAGTAGGTTGTGTGGTTTA 56 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTT 66 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTA 2 1
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTTT 16 2
mmu-let-7b-5p TGAGGTATTAGGTTGTGTGGTTTA 5 2
mmu-let-7b-5p GGTAGTAGGTTATGTGGTT 3 2
mmu-let-7b-5p TGAGGTAGTCGGCTGTGTGGTTT 5 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTAC 14 1
mmu-let-7b-5p TGAGGGAGTATGTTGTGTGGTT 3 3
mmu-let-7b-5p TGGNGTAGTAGGTTGTGT 4 18
mmu-let-7b-5p TGAGGTAGTANCTTGTGTGGTTT 207 1
mmu-let-7b-5p TNAGTTAGTAGGTTGTGTGGTT 18 2
mmu-let-7b-5p TGAGGTAGTANATTGTGTGGTTT 261 1
mmu-let-7b-5p NGAGGCAGTAGGTTGTGTGGT 2 1
mmu-let-7b-5p GAGGGAGTAGGTTGTGTGGT 3 3
mmu-let-7b-5p GGTAGTAGGTTGTGTAGTT 9 4
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTT 23 1
mmu-let-7b-5p TAGGTAGTAGGTTGTGTGGTTA 30 1
mmu-let-7b-5p CAGGTAGTAGGTTGTGTGGT 2 2
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGGTA 25 1
mmu-let-7b-5p TGAGGTAGTANGTTGTGTGTTT 3 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTGTGGTAT 6 1
mmu-let-7b-5p TGAGGGCGTAGGTTGTGTGGT 3 3
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTT 5654 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTA 93 2
mmu-let-7b-5p GAGTTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTAC 15 1
mmu-let-7b-5p GAGGTAGGAGGTTGTGTGGT 3 3
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGA 3 3
mmu-let-7b-5p TGAGGTAGTAGGTTGNTTGGTTT 4 3
mmu-let-7b-5p TAGTAGGTTGTGTGGTTGA 9 23
mmu-let-7b-5p TGGCGTAGTAGGTTGTGTGGT 3 2
mmu-let-7b-5p NAGGTAGTAGGTTGTGTGG 2 1
mmu-let-7b-5p AGTAGGTTGTGTGGTTTA 10 10
mmu-let-7b-5p GANGTAGTAGGTTGTGTGGTT 65 1
mmu-let-7b-5p TAGGTAGTANGTTGTGTGGTT 2 1
mmu-let-7b-5p TGCGGTAGTAGGTTGCGTGGTTT 85 1
mmu-let-7b-5p TGAGGGAGTAGTTTGTGTGGT 4 9
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTGTTT 58 1
mmu-let-7b-5p TGCGGTTGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TGAGNTAGTAGGTTTTGTGGT 3 3
mmu-let-7b-5p GAGGTAGTAGGTTGTATGGTTAC 12 3
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGTTTAA 3 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGCTT 2 1
mmu-let-7b-5p GAGCTAGTAGGTTGTGTGGTT 12 1
mmu-let-7b-5p TGAGGTAGCAGGTTGTGTGGT 38 1
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTTTA 13 2
mmu-let-7b-5p TGAGGTAGTAGGCCGTGTGGTT 2 1
mmu-let-7b-5p TGAATTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGNGGTAGTAGTTTGTGTGG 2 3
mmu-let-7b-5p GTAGTAGGTTNGGTGGTTT 2 7
mmu-let-7b-5p AGGTAGTAGNTTGTGTGGTT 2 2
mmu-let-7b-5p TGAGGTAGNAGGTTGTCTGGTTTC 6 1
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTAT 5 2
mmu-let-7b-5p GGTCGTAGGTTATGTGGTT 2 12
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTA 24 2
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTTT 31 2
mmu-let-7b-5p TGGTAGGTTGTGTGGTTT 3 13
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAT 81577 2
mmu-let-7b-5p TGAGGTAGTAGGNTGTGTGGTTTGA 5 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTTT 2 30
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTC 2 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTA 169 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTG 10 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTTT 229 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGTTTAA 2 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTG 39 1
mmu-let-7b-5p TAGTAGGTTGTGTGGT 58 1
mmu-let-7b-5p TCAGGTAGTAGGTTTTGTGGTT 2 2
mmu-let-7b-5p TGANGTAGTAGGTTGTGTGCTT 2 1
mmu-let-7b-5p GCGGTAGTAGGTTGTGTGT 2 11
mmu-let-7b-5p TNAGGTAGTAGGTTTTGTGGTT 28 1
mmu-let-7b-5p GAGGTAGTAGGTTGGGTGG 2 12
mmu-let-7b-5p AGGTAGTATGTTGTGTGGTT 2 2
mmu-let-7b-5p AAGGTAGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGT 2 7
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGA 6 3
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTT 108 1
mmu-let-7b-5p TGAGGTAGTAGGTTCTGTGGTTG 5 2
mmu-let-7b-5p TGAGGTAGTAGGNTGTGT 11 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTAG 5 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTC 20 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTG 40 1
mmu-let-7b-5p GAGGTAGTAGGGTGTGTGGTTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGATTGTTTGGTT 3 8
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAT 63 2
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTAA 62 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTAAAG 226 1
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTTA 24 1
mmu-let-7b-5p TGAGGTAGTAGGCTTTGTGGTTT 2 6
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGG 116 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGA 7 9
mmu-let-7b-5p TAGGTTGTGTGGTTAC 2 35
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTT 297 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTC 6 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGTTG 13 1
mmu-let-7b-5p TGANGTGGTAGGTTGTGTGGTT 5 1
mmu-let-7b-5p GTAGTAGGTTGTGTGG 33 2
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTT 549 1
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGGTA 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGG 29 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTCTGGTT 3 3
mmu-let-7b-5p TGAGGTAGTAGCNTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTGTGTT 2 1
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTTT 39 2
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTTA 24 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTAAAG 4 2
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTTT 137 2
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTTC 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTTG 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGNGTGGTTTA 95 2
mmu-let-7b-5p GAGNTAGTAGGTTGGGTGGTTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTACAT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGTTTTC 2 3
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTGGTA 53 2
mmu-let-7b-5p TGANGTAGTAGGTTGTTTGG 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGAGT 3 2
mmu-let-7b-5p TNGTAGGTTGTGTGG 3 13
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTCC 8 3
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGGT 14 1
mmu-let-7b-5p TNATGTAGTAGGTTGTGTGGTT 21 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTT 81 2
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTTG 9 1
mmu-let-7b-5p NGGGGTAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p GTAGTTGGTTGTGTGGTT 3 16
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGAAG 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTC 433 3
mmu-let-7b-5p TGNGGTAGTAGGTTTTGTGGTT 6 1
mmu-let-7b-5p TGAGGTATTAGGTNGTGTGGTT 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTTTTTT 5 3
mmu-let-7b-5p TAGGTAGTAGGTTNTGTGGTT 2 4
mmu-let-7b-5p TGAGGTAGTAGTTNGTGTGGT 4 2
mmu-let-7b-5p TGGNGTAGTAGGTTGTGTG 12 9
mmu-let-7b-5p TGAGGTAGTAGGTTGGTTGGT 6 10
mmu-let-7b-5p GAGGTAGTAGGTCGTGTGGTT 21 1
mmu-let-7b-5p TNAGGTAGTGGGTTGTGTGGTT 17 1
mmu-let-7b-5p TGCGGTCGTAGGTTGTGTGGTTT 35 1
mmu-let-7b-5p TGAGGTAGTAGCTTGGGTGGTTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAAG 9 13
mmu-let-7b-5p TGNAGTAGGTTGTGTGGTT 2 7
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGATTTAA 4 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTA 203 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTT 290 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGGTTTCT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTCTAG 3 1
mmu-let-7b-5p GAGGTAGTAGGTNGTGTGGTT 59 1
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTTAA 66 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTT 2220 1
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGTA 28 3
mmu-let-7b-5p GNGGTAGTAGGTTGTGTGGTAT 5 1
mmu-let-7b-5p GAGGTAGTAAGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTCGTGGGTTGTGTGGTT 3 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGTTTTA 12 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGGGGTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGATTGTGTGGTTTT 34 4
mmu-let-7b-5p TGTNGTAGTAGGTTGTGTGGTT 51 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTTA 9 2
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTTTT 13 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTTTA 4 1
mmu-let-7b-5p TGANGTAGTAGTTTGTGTGGTT 5 2
mmu-let-7b-5p CTGAGGTAGTAGGTTGTGTGG 4 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGGGT 2 4
mmu-let-7b-5p TGAGGCAGTAGGTTGTG 3 24
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTTAC 9 1
mmu-let-7b-5p TGAGGTAGTGGGTTGTGTGGGT 2 5
mmu-let-7b-5p TGAGGGAGTAGGTTGTGT 8 6
mmu-let-7b-5p GTAGGTTGTGTGGTTTAA 10 3
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTTAA 17 1
mmu-let-7b-5p TGCGGTAGTAGGTTGTGTGTTT 7 1
mmu-let-7b-5p GAGGTAGGAGGTTGTCTGGTT 2 9
mmu-let-7b-5p TGAGGAAGTAGGTTGTGTGGTTAC 5 1
mmu-let-7b-5p TGAGGTAATAGGTTGTGTGGT 9 1
mmu-let-7b-5p TGCGGTAGTAGGTTGCGTGGTT 237 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGG 17 2
mmu-let-7b-5p TNACGTAGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTTTGGTT 22 3
mmu-let-7b-5p TGACGTAGTAGGTTGTG 2 2
mmu-let-7b-5p GAGGTAGTAGNCTGTGTGG 3 6
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTACC 4 1
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTAT 7 2
mmu-let-7b-5p GAGNTAGTAGGTTGTGTGGTTA 15 1
mmu-let-7b-5p GAGGTAGGAGGTTGTGTGGTT 12 2
mmu-let-7b-5p TGAGGTAGTAGGTTTNGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTCTGGTT 2 3
mmu-let-7b-5p TGAGGTGGTGGGTTGTGTGGTT 3 4
mmu-let-7b-5p GAGGTGGTAGGTTGTGTGGTT 47 1
mmu-let-7b-5p TGAGGTAGTCGGTTGTTTGGTT 2 4
mmu-let-7b-5p TGAGGGAGTAGGTTGCGTGGTT 19 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTT 713 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTA 12 4
mmu-let-7b-5p GGTAGGTTGTGTGGTTT 2 30
mmu-let-7b-5p TGAGGGAGTAGGTTGAGTGG 2 9
mmu-let-7b-5p TGAGGTAGTAGGTTGCGTGTTTT 2 1
mmu-let-7b-5p GAGGTAGTAGGTTCTGTGGTT 12 1
mmu-let-7b-5p TGNGGTAGTAGGCTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTATGGTTTAAG 51 4
mmu-let-7b-5p TGAGGTAGTTGGTTGTGTGGTTTT 3 2
mmu-let-7b-5p TGNGGTAGTAGGTTGTGT 11 1
mmu-let-7b-5p GAGNTAGTAGGTTGTGTGGT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTN 8 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTG 845 1
mmu-let-7b-5p TGAGGGGGTAGGTTGTGTGGT 2 5
mmu-let-7b-5p GTAGTAGGTTGGGTGGTT 4 5
mmu-let-7b-5p TGAGGTAGTAGATTGCGTGGTT 6 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTTA 19 2
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTTTT 40 2
mmu-let-7b-5p TGGGGTAGTAGGTTGCGTGGT 4 1
mmu-let-7b-5p GNAGTAGGTTGTGTGGTTA 5 8
mmu-let-7b-5p TAAGGTAGTAGGTTGTGTGGA 5 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTATT 2 7
mmu-let-7b-5p TGAGGTAGTAGGTTTTGTGG 40 2
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTT 8 1
mmu-let-7b-5p AGGTAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p TGANGTAGTAGGTTGTCTGGTT 552 3
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTTT 8 2
mmu-let-7b-5p GAGGTAGTAGGCTGTGTGGTT 19 1
mmu-let-7b-5p TTAGGTAGTAGGTTGTGTGGA 4 6
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTTT 62 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTTA 37 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTCTGGTTT 2 3
mmu-let-7b-5p ANTAGGTTGTGTGGTTT 11 3
mmu-let-7b-5p TGAGNTAGTAGGTTCTGTGGTT 2 2
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTA 8 2
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTT 242 1
mmu-let-7b-5p TGAGGTAGTAGTTTGTGTTGTTT 5 2
mmu-let-7b-5p TGNGGTAGTAGGTTGTGTGGTTG 87 1
mmu-let-7b-5p TGCGGTTGTAGGTTGTGTGGTT 7 1
mmu-let-7b-5p TGAGGTAGTAGGTNG 5 20
mmu-let-7b-5p TAGGTCGTAGGTTGTGTGGTT 2 4
mmu-let-7b-5p TGANGTATTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCT 22 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCA 35 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTCG 3 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTTAA 52 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGGTC 2 2
mmu-let-7b-5p GAGGTATTAGGTTGTGTGGT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCT 15 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCA 11 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTTCC 3 1
mmu-let-7b-5p TGAGNTAGTAGGTTGTGTGGTTAC 16 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTTGTA 142 1
mmu-let-7b-5p TGCGGTAGTAGGGTGTGTGGTTT 2 1
mmu-let-7b-5p TNAGGTAATAGGTTGTGTGGTT 6 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGGTTAC 3 1
mmu-let-7b-5p TGCGGTAGTAGGTTTTGTGGTT 4 1
mmu-let-7b-5p GAGGGAGGAGGTTGTGTGGTT 2 13
mmu-let-7b-5p TGAGGTAGTAGCTTGAGTGGT 2 2
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGGTTTA 3 2
mmu-let-7b-5p TGAGNTATTAGGTTGTGTGGT 2 2
mmu-let-7b-5p TGAGGTAGTANCTTGTGTGGTT 726 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTT 722 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTG 40 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTA 430 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTTC 10 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGGTTTG 2 5
mmu-let-7b-5p GAGGTAGTAGGTTGT 10 11
mmu-let-7b-5p GAGGCAGTAGGTTGTGTGGTTT 3 1
mmu-let-7b-5p TGTNGTAGTAGGTTGTGTGGTTT 17 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTTGA 8 1
mmu-let-7b-5p TGACGTAGTAGGTTGTGTGGTT 891 1
mmu-let-7b-5p TGAGGTAGTAGCTTGTGTGGTTAC 4 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTAC 2 2
mmu-let-7b-5p TAGTAGGTTGTGTGGTTAA 71 24
mmu-let-7b-5p TGAGGTAGTAGGGTGTGTGGTA 13 2
mmu-let-7b-5p GNAGTAGGTTGTGTGGTT 15 1
mmu-let-7b-5p TGAGCTAGTAGGTTGTGTGGT 39 1
mmu-let-7b-5p TGAGGTAGTANCTTGTGTGG 51 2
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGG 22 1
mmu-let-7b-5p TGAGGTCGTAGGTTGTGTGA 2 5
mmu-let-7b-5p TGAGGTAGTNGGTTGTGCGGTTT 2 1
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTAT 67 12
mmu-let-7b-5p TGAGATAGTAGGTTGTGTGGTTG 2 1
mmu-let-7b-5p TAAGGTAGTAGGTTGTGCGGTT 2 1
mmu-let-7b-5p TGCGGTAGTCGGTTGTGTGGTT 8 1
mmu-let-7b-5p TGAGGTAGTNGGTTGTTTGGTT 6 4
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGGTTACA 2 1
mmu-let-7b-5p TGAGGTTGTAGGTTGTGTGGT 9 1
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGGTT 1151 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGT 22 1
mmu-let-7b-5p TGAGNTAGTAGGTTATGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTTTGG 49 3
mmu-let-7b-5p TGGGGTAGTAGGTTGTGTGGA 6 4
mmu-let-7b-5p GGTAGTAGGTTGTGTGGTTAGA 3 2
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTT 71 1
mmu-let-7b-5p TGAAGTAGTAGGTTGTGTGGTTA 42 2
mmu-let-7b-5p GAGGTAGTAGNGTGTGTGGTTT 5 1
mmu-let-7b-5p TGAGGTAGTAGGATGTGTGGTAT 8 2
mmu-let-7b-5p TGAGTTAGTAGGTTGTGTGCTTT 2 1
mmu-let-7b-5p TGATGTAGTAGGTTGTGTGGT 202 1
mmu-let-7b-5p TAAGGGAGTAGGTTGTGTGGTTT 2 1
mmu-let-7b-5p TCGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p TGTGGTAGTAGGTTGTGTGGTAT 3 1
mmu-let-7b-5p TGAGGTAGTAGATTGTGT 5 7
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTA 2 2
mmu-let-7b-5p TGAGGTACTAGGTTGTGTGGTT 177 1
mmu-let-7b-5p TGAGGTAGNAGGTTGTGTGGTT 92 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTTTGGTT 2 4
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGT 153 1
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGA 2 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAG 9 4
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAT 8 38
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGC 82 2
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTGG 1932 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGCGGTAT 5 1
mmu-let-7b-5p GAGGTAGTGGGTTGTGTGGTT 2 1
mmu-let-7b-5p GTACGTTGTGTGGTTT 2 34
mmu-let-7b-5p GTAGTAGGTTGTGTGGTTTAA 13 1
mmu-let-7b-5p GANGTAGTAGGTTGTGTGGTAT 2 1
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTTTAA 16 1
mmu-let-7b-5p TGAGGTAGTAGATTGAGTGGTT 7 1
mmu-let-7b-5p TGAGGTAGTNGGTTG 3 19
mmu-let-7b-5p TGGAGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGTTAT 80 1
mmu-let-7b-5p NGAAGTAGTAGGTTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTGGTGTAA 7 1
mmu-let-7b-5p ATGAGGTAGTAGGTTGTGTGGTT 4 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGAT 5 1
mmu-let-7b-5p GAGGTAGTAGGTTGTGTGGAA 7 5
mmu-let-7b-5p TAGTAGGTTGTGTGGTTT 178 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTA 142 4
mmu-let-7b-5p TGNGGTATTAGGTTGTGTGGTT 3 1
mmu-let-7b-5p GAGGTAGTGGGTTGTGTGGT 2 1
mmu-let-7b-5p TAGTAGGTTGTGTGGTTTA 13 3
mmu-let-7b-5p TGAGGTAGTANATTGTGTGGTTTC 2 1
mmu-let-7b-5p TGAGNTAGGAGGTTGTGTGGTT 16 1
mmu-let-7b-5p TCAGGTAGTAGGTTGTGTGA 7 5
mmu-let-7b-5p TAAGGTAGTAGGNTGTGTGGTT 2 1
mmu-let-7b-5p TGAGGGAGTAGGTTGTGTGGTTTTA 15 1
mmu-let-7b-5p TGAGGTAGTAGGNTTTGTGGTTT 2 2
mmu-let-7b-5p TGAGGTAGTAGGCTGTGTG 18 3
mmu-let-7b-5p TGAGGCAGTAGGTTGTGTGGTAT 24 1
mmu-let-7b-5p GAGGTAGTANGTTGTGTGGTTA 27 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGT 28 1
mmu-let-7b-5p AGAGGTAGTAGGTTGTGTGGA 2 6
mmu-let-7b-5p TGAGGTAGTAGGTTTTTTGGTTT 2 3
mmu-let-7b-5p TGAGGTAGTAAGTTGTGTGG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGG 452 1
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGA 41 2
mmu-let-7b-5p TGAGGTAGTAGGTNGTGTGT 10 2
mmu-let-7b-5p TGCGGTAGTAGGTTGTTTGGTT 4 3
mmu-let-7b-5p TTAGGTAGTAGGTTGNGTGGTT 4 1
mmu-let-7b-5p TGACGTAGTAGGTTGNGTGGTT 3 1
mmu-let-7b-5p TGAGGTAGGAGGTTGTGTGTTT 2 5
mmu-let-7b-5p TGAGGTAGTAGGTAGTGTGGTTAC 2 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGTCGTTTT 2 3
mmu-let-7b-5p TGCCGTAGTAGGTTGTGTGGTTT 4 1
mmu-let-7b-5p TNAGGTAGTAGGTTGTGTTG 2 2
mmu-let-7b-5p TGANGTAGTAGGTTGTTTGGTTT 6 3
mmu-let-7b-5p GGTAGTAGGTTGTNTGGTT 32 3
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGG 4 1
mmu-let-7b-5p TGAGGTAGTAGGTTGTGAGA 7 13
mmu-let-7b-5p TGAGGTAGTAGGTCGTGTGATT 2 1
mmu-let-7b-5p GTAGTAGGTTGTGNGGTT 2 1
mmu-let-7b-5p TGAGGTAGTAGGTCGT 2 20
mmu-let-7b-5p GTAGGTTGTGTGGTTA 366 41
mmu-let-7b-5p GTAGGTTGTGTGGTTN 40