id_rna sequence raw_count mapping_loci
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTT 1684564 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGT 218826 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTT 6574 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTT 3756 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGT 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGATTA 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTGT 2 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTA 32 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTC 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTTGTTTA 5 3
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGCTT 7 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGG 12 3
mmu-let-7c-1_precursor TNAGGTAGTAGGATGTATGGTT 7 2
mmu-let-7c-1_precursor GCAGTAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCT 167 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTT 289 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTA 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTC 3 4
mmu-let-7c-1_precursor TTGAGGTAGNAGGTTGTATGGT 7 1
mmu-let-7c-1_precursor TGAGNTAGTACGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGTA 5 3
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGTT 566 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTAT 7 5
mmu-let-7c-1_precursor TGCGGTCGTAGGTTGTATGG 4 2
mmu-let-7c-1_precursor TGAGGGGGTAGGTTGTATGGT 2 6
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATG 16 3
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTAAG 4 6
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGAGGTAGTGGGTNGTATGGTT 3 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGT 6 12
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTAT 6 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTAGC 20 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTAGA 65 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTAGG 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTAGT 2 1
mmu-let-7c-1_precursor TGAGTTAGTAGGNTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTAT 36 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAAGGTT 112 2
mmu-let-7c-1_precursor TTGGTAGTAGGTTGTATGGTT 3 3
mmu-let-7c-1_precursor TGGAGGTAGTAGGTTGTATGGT 17 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGT 2 13
mmu-let-7c-1_precursor TGAGGGAGTAGGTGGTATGGTT 9 4
mmu-let-7c-1_precursor TGAGGTAGTANCTTGTATGG 34 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGTT 2 1
mmu-let-7c-1_precursor TGCGGTTGTAGGTTGTATGGT 3 3
mmu-let-7c-1_precursor GAGGTGGTAGGTTGTATGG 6 3
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTGTGGTTTA 19 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTC 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGT 10 11
mmu-let-7c-1_precursor CNGTACAACCTTCTAGCTTTC 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGTAT 7 3
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTGTGGTTTAG 3 1
mmu-let-7c-1_precursor TGATGTAGTAGGTGGTATGGTT 4 3
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTGTGGTTTAGA 4 1
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTA 7 4
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTG 33 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTA 268 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTT 429 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAAGG 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAAGA 33 9
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTAAA 2 4
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGGATG 2 9
mmu-let-7c-1_precursor TTGAGGTAGTAGGATGTATGGT 3 1
mmu-let-7c-1_precursor TAAGATAGTAGGTTGTATGGTT 2 4
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGTATGGTT 273 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTGTGGTTTA 103 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTAT 4 3
mmu-let-7c-1_precursor CTGAGGTAGTAGGTTNTATGGTT 2 2
mmu-let-7c-1_precursor TTGAGGTAGNAGGTTGTATGGTTT 5 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGN 16 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGG 94 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGC 147 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGA 4523 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTAA 246 1
mmu-let-7c-1_precursor TGGGGTCGTAGGTTGTATGGTTT 7 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGTTAA 7 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATTGTT 2 5
mmu-let-7c-1_precursor TAGGTGGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TTAGGGAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TNAGGTATTAGGTTGTATGGT 3 3
mmu-let-7c-1_precursor TGAGATAGTAGGTTGTATGGTTT 25 2
mmu-let-7c-1_precursor TAAGGGAGTAGGTTGTATGGT 2 4
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGNATGGTT 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGGTTG 6 3
mmu-let-7c-1_precursor TGAGGGAGTAGGTTATATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGTTT 6 5
mmu-let-7c-1_precursor TNAGGTAGAAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTACGGTT 5 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTAGA 4 1
mmu-let-7c-1_precursor TAGTAGGTTGTATGG 32 4
mmu-let-7c-1_precursor TGAGGTAATAGGTTGTGTGGTTTA 3 2
mmu-let-7c-1_precursor TNAGGTAGTATGTTGTATGGTT 8 2
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7c-1_precursor GGTCGTAGGTTGTATGGTT 11 2
mmu-let-7c-1_precursor GAGGTAGGAGGTTGTATGGT 2 4
mmu-let-7c-1_precursor TNAGGCAGTAGGTTGTATGGTT 17 2
mmu-let-7c-1_precursor GAGGTAGTAGGTNGTATGG 7 2
mmu-let-7c-1_precursor GNTAGTAGGTTGTATGG 2 2
mmu-let-7c-1_precursor GGTNGTAGGTTGTAGGGTT 2 9
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTAAG 3 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTAAA 3 1
mmu-let-7c-1_precursor GTAGGTTGTATGGTTAAG 2 3
mmu-let-7c-1_precursor TGNGGGAGTAGGTTGTATGGTT 3 3
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTGTGGTTTA 17 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGTAT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTGAA 7 1
mmu-let-7c-1_precursor TGATGGAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTG 11 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTA 193 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTC 2 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTTTAT 3 1
mmu-let-7c-1_precursor TGNGGTATTAGGTTGTATGGTTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTAAGGTT 2 2
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGTTT 91 2
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGTTA 49 2
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGTTG 3 3
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATG 6 2
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGT 161 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTTTGGT 2 5
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGTTTT 3 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGTTTA 2 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTAT 24 5
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGGT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGNATGTATGGT 5 2
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGTTT 3 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTAAGA 4 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTTAA 9 1
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGTTTAA 2 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGCATGGTT 33 2
mmu-let-7c-1_precursor NGATGTAGTAGGTTGTATGGTT 17 3
mmu-let-7c-1_precursor CAGGTAGTAGGTTGTATGGTTA 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTGTGGTTTAG 4 1
mmu-let-7c-1_precursor GAGNTAGTAGGTTGGATGGT 2 3
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTT 5142 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTA 63 4
mmu-let-7c-1_precursor GAGGTACTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor GTAGTAGGTTGTATGTTT 6 7
mmu-let-7c-1_precursor TGAGNTATTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTTGA 34 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGATGGTTA 11 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGATGGTTT 15 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGA 60 3
mmu-let-7c-1_precursor TGGGGTAGTAGGCTGTATGGTT 2 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTCTATGGTT 5 2
mmu-let-7c-1_precursor TCTGAGGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTG 10 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTA 316 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTC 5 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTT 21017 2
mmu-let-7c-1_precursor TGAGGTATTNGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor GTAGGTTGTATGGTT 3451 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTCAA 6 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTAAGGTT 3 2
mmu-let-7c-1_precursor TGATGGAGTAGGTTGTATGGT 2 3
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGTCTGGTT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAGG 34 2
mmu-let-7c-1_precursor TGTAGTAGGTTGTATGGTTT 10 3
mmu-let-7c-1_precursor TGTAGTAGGTTGTATGGTTA 3 12
mmu-let-7c-1_precursor TTAGGGAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTCTGGT 9 3
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGTTTA 3 1
mmu-let-7c-1_precursor AGGTAGTAGGTTGTGTGGTTAA 14 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTA 81 2
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTGTGGTTTA 6 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGCATGGTT 5 3
mmu-let-7c-1_precursor TGATGTAGTNGGTTGTATGGT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGGTTA 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGATTTA 6 2
mmu-let-7c-1_precursor TTANGTAGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGCT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGNTTGTATGGT 5 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTT 51 48
mmu-let-7c-1_precursor GAGGTTGTAGGTTGTATGGTTT 33 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGT 4 13
mmu-let-7c-1_precursor TGCGGTAGTCGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGTTAGTAGGCTGTATGGTT 9 3
mmu-let-7c-1_precursor TGTAGTAGGTTGTATGGT 31 7
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTGTGGTTTA 5 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGCATGGTTT 5 2
mmu-let-7c-1_precursor TGAGGGAGTTGGTTGTATGGTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTCGGATGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTTTATGGT 2 7
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAAGGTTAA 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTCTGGTT 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTA 300 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTT 443 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTC 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTG 26 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTNTATGGTTT 11 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTNTATGGTTA 22 2
mmu-let-7c-1_precursor GGTAGCAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTGGGCTGTATGGTT 2 3
mmu-let-7c-1_precursor CGAGGTAGTAGGTCGTATGGTTT 2 2
mmu-let-7c-1_precursor TGGGGTATTAGGTTGTATGGT 2 5
mmu-let-7c-1_precursor TGAGGTAGTTGGTTGTATGGTTT 23 2
mmu-let-7c-1_precursor TGAGGTAGTTGGTTGTATGGTTA 16 2
mmu-let-7c-1_precursor GTAGGGTGTATGGTTT 2 41
mmu-let-7c-1_precursor NGAGGTAGTAGTTTGTATGGTT 9 3
mmu-let-7c-1_precursor TGACGTAGTAGGNTGTATGGTT 3 2
mmu-let-7c-1_precursor TAGGTAGTAGGTNGTATGGT 2 5
mmu-let-7c-1_precursor TTATGTAGTAGGTTGTATGGTT 7 4
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGT 139 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGA 5 6
mmu-let-7c-1_precursor GGACGTAGGTTGTATGGTT 2 10
mmu-let-7c-1_precursor TTAGGTAGTAGGNTGTATGGTT 8 2
mmu-let-7c-1_precursor GTAGNAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor GTNGAGGTAGTAGGTTGTATGGTT 3 1
mmu-let-7c-1_precursor TGAGGCAGTAGGGTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTTTAA 2 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTAAGA 5 1
mmu-let-7c-1_precursor TGAGGTAGTACGTTGTGTGGTTTA 4 2
mmu-let-7c-1_precursor TGAGGTAGTCGGGTGTATGGT 2 3
mmu-let-7c-1_precursor TGAGGTGGTNGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGTT 752 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTA 8 16
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGCTT 2 4
mmu-let-7c-1_precursor TGGAGGTAGTAGGTTGTATGGTT 16 1
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGATT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGT 325 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTTTGGTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGA 8 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTANGGTT 2 2
mmu-let-7c-1_precursor CGAGGCAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGGAGTCGGTTGTATGGTT 31 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTGGGTT 2 7
mmu-let-7c-1_precursor TAGTAGGTTGTATGGTT 624 3
mmu-let-7c-1_precursor AGAGGTAGTAGGTTGTATGGTTA 50 3
mmu-let-7c-1_precursor AGAGGTAGTAGGTTGTATGGTTC 2 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATG 18 2
mmu-let-7c-1_precursor GAGGTTGTAGGTTGTATGGT 33 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTGA 32 1
mmu-let-7c-1_precursor TGAGGGGGTAGGTTGTATGGTT 22 3
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGC 2 4
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGTT 743 2
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGTA 5 2
mmu-let-7c-1_precursor GTGGTAGTAGGTTGTATGGTT 29 2
mmu-let-7c-1_precursor TGCNGTAGTAGGTTGTATGGTTT 98 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTA 76 2
mmu-let-7c-1_precursor GTANTAGGTTGTATGGTT 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGAATGGTTT 2 2
mmu-let-7c-1_precursor GAANTAGTAGGTTGTATGGTT 30 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGGTTT 11 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGGTTA 8 3
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTTAT 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTTAA 9 2
mmu-let-7c-1_precursor TGAGGTATTANGTTGTATGGTT 5 2
mmu-let-7c-1_precursor TGAGGTTGTAGGTTGTATGG 6 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGG 321 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGA 9 14
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGAT 2 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGT 45 9
mmu-let-7c-1_precursor GAGGTAGTAGGTTTTATGGT 11 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATG 20 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTCTGGTT 90 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTT 383 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTG 32 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTA 282 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTC 6 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTAAG 3 1
mmu-let-7c-1_precursor TGAGATAGTAGGTTGTATGGTT 180 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGA 4 7
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGT 180 5
mmu-let-7c-1_precursor TGAGGNAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTCTGGTT 3 4
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATG 81 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTAGGTT 2 3
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATGGTT 217 1
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATGGTA 11 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTGG 4 2
mmu-let-7c-1_precursor CCAGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTGTA 6 1
mmu-let-7c-1_precursor TAAGGTATTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTCTGGTA 4 6
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTC 12 3
mmu-let-7c-1_precursor TGAGGGACTAGGTTGTATGGTT 8 3
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTTTAAA 2 1
mmu-let-7c-1_precursor TGCAGTAGTAGGTTGTATGGTT 8 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGTT 28 2
mmu-let-7c-1_precursor TTGGGGTAGTAGGTTGTATGGTT 10 1
mmu-let-7c-1_precursor TNAGGTTGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTAT 15 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGA 28 5
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGT 889 2
mmu-let-7c-1_precursor TGNGGCAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTATGTTGTATGGT 27 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGNATGGTT 15 3
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTGTGGTTTA 8 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTTAA 37 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATCGT 4 4
mmu-let-7c-1_precursor TGANGTAGTAGGTTTTATGGTT 3 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTC 5 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTTAAA 5 1
mmu-let-7c-1_precursor CCGTTGAGGTAGTAGGTTGTATGGTT 4 1
mmu-let-7c-1_precursor GAGGTAGGAGGTTGTATGGTTA 2 3
mmu-let-7c-1_precursor TGAGCTAGTAGGNTGTATGGTT 3 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTAT 11 7
mmu-let-7c-1_precursor GGTAGTAGGTTGCATGGTT 12 3
mmu-let-7c-1_precursor TAGGTAGTAGGTTTTATGGTT 2 17
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTGT 3 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTGA 7 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTGTGGTTTAGA 12 1
mmu-let-7c-1_precursor GATGAGGTAGTAGGTTGTATGGT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTA 1614 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGGTT 7 4
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTAA 151 1
mmu-let-7c-1_precursor TAAGGCAGTAGGTTGTATGGTT 3 3
mmu-let-7c-1_precursor TGAGTTAGTAGGTNGTATGGTTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGT 17 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGG 644 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGA 26 4
mmu-let-7c-1_precursor TGAGGTAGTACGTTGTATGGTT 103 2
mmu-let-7c-1_precursor GTGGTAGTAGGTTGTATGGT 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTACGGT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTT 2289 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTA 36 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTT 721 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTCTGGTTT 3 3
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTA 6 4
mmu-let-7c-1_precursor TGAGGTATTAGGCTGTATGGTT 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTTTGGTT 2 4
mmu-let-7c-1_precursor TGAGGTAGAAGGTTGTATGGTT 139 2
mmu-let-7c-1_precursor GTAGTAGGTNGTATGGTT 5 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTCTGGTTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGCT 341 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTAAGA 2 1
mmu-let-7c-1_precursor NGGGGTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGCA 5 2
mmu-let-7c-1_precursor TCNGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTTAG 2 1
mmu-let-7c-1_precursor GAGGTCGTAGGTTGTATGGTT 132 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTTAA 12 1
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTTAT 4 1
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTTGA 4 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTAT 49 2
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTTTGGTT 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGGNTTTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTA 3 24
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTTTTT 9 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGCTT 9 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNGTGGTTTAGA 5 1
mmu-let-7c-1_precursor TGAGGTAGTAGATGGTATGGTT 2 6
mmu-let-7c-1_precursor TGACNTAGTAGGTTGTATGGTT 5 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTAAAGA 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAATA 12 1
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGGTTTC 19 3
mmu-let-7c-1_precursor TNAGGTATTAGGTTGTATGG 3 4
mmu-let-7c-1_precursor TTANGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTNTATGGTTT 3 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTGT 3 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGAATGGTT 7 2
mmu-let-7c-1_precursor AAGGTAGTAGGTTGTATGGTT 18 2
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGCTT 2 3
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGCTT 3 3
mmu-let-7c-1_precursor GTNGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTTAAA 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTGAA 26 1
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGT 35 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGA 2 3
mmu-let-7c-1_precursor TTNAGGTAGTAGGTTGTATGG 3 1
mmu-let-7c-1_precursor TTANGGTAGTAGGTTGTATGGTT 2 1
mmu-let-7c-1_precursor TGCGGTCGTAGGTTGTATGGTT 274 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTTAA 11 1
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTTA 7 1
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGTT 461 2
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGTA 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATGG 6 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGG 10 2
mmu-let-7c-1_precursor TCAGGGAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGAAT 11 3
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTTC 4 3
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTTG 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGNT 89 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGATT 604 2
mmu-let-7c-1_precursor GTAGGTTGTNTGGTTT 8 11
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGCATGGTTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCATATGGTT 2 3
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGG 8 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATTGT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAA 4 17
mmu-let-7c-1_precursor TNAGGTAGTTGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGTTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGTT 1383 2
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGTA 8 3
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGCATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGAAGGTTGTATGG 3 3
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGGATGGTT 7 2
mmu-let-7c-1_precursor TGAGGTAGTNGTTTGTATGGTT 5 3
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTTAT 6 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTGTGGTTTAG 4 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTGTGGTTTAT 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTTA 4 1
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTTA 48 1
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTTC 7 3
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTTG 4 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTGTGGTTTAG 76 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTAT 4 3
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTGT 15 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTTTAA 3 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGA 39 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGT 1966 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTGA 44 1
mmu-let-7c-1_precursor TNAGGTAATAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGCT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGGGT 3 3
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGCT 2 2
mmu-let-7c-1_precursor AGNAGGTTGTATGGTT 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGGATGGTT 8 2
mmu-let-7c-1_precursor TAAGGTAGTAGGNTGTATGGTT 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATTGTT 11 5
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTTTA 3 1
mmu-let-7c-1_precursor TGAGATAGTAGGTTGTATGGTTA 21 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTAAT 13 1
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTTG 8 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTTT 49 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTTA 21 2
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATGGT 64 2
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATGGA 3 3
mmu-let-7c-1_precursor TAGGTAGTAGGTTCTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTACGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTTTGGTT 3 5
mmu-let-7c-1_precursor TGAGTGAGTAGGTTGTATGGTT 6 3
mmu-let-7c-1_precursor TGATGTAGTAGGTCGTATGGTT 6 4
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATTGTT 6 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTTA 48 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTTC 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTTG 5 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGT 3 15
mmu-let-7c-1_precursor TGCGGTAGGAGGTTGTATGGTT 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGG 383 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGA 12 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGT 6 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTNTATGGTT 7 2
mmu-let-7c-1_precursor TAAGGTATTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGTT 685 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGTA 5 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTTAGG 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTTAGT 62 1
mmu-let-7c-1_precursor TTNGGTAGTAGGTTGTATGGTT 10 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGG 364 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGA 10 2
mmu-let-7c-1_precursor TGACGTAGTCGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor ATGAGGTAGTAGGTTGTATGGT 3 3
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTCTGGTT 6 3
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGCT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAAGTTGTATGGTTT 20 2
mmu-let-7c-1_precursor GTAGGTCGTATGGTT 2 32
mmu-let-7c-1_precursor TTGAGGTAGTAGCTTGTATGGTT 3 1
mmu-let-7c-1_precursor TTGAGGTAGTAGCTTGTATGGTA 3 1
mmu-let-7c-1_precursor AGGTAGTAGGTTGTA 2 5
mmu-let-7c-1_precursor CGTTGAGGTAGTAGGTTGTATGGTT 3 1
mmu-let-7c-1_precursor AAGGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGANGTTGTAGGTTGTATGGTT 2 3
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTTT 162 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTTC 6 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTTG 9 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTTA 100 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTGA 13 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTAAG 16 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGCATGGT 4 5
mmu-let-7c-1_precursor GAGGTAGTAGNCTGTATGGT 9 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGGTT 20 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGGTA 15 3
mmu-let-7c-1_precursor GNTAGTAGGTTGTATGGT 5 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATG 114 2
mmu-let-7c-1_precursor GAGGTAGCAGGTTGTATGGTT 22 2
mmu-let-7c-1_precursor GAGGTAGTAGGTCGTATGGTTA 8 2
mmu-let-7c-1_precursor TGGAGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTA 14 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTT 1868 2
mmu-let-7c-1_precursor TAGTAGGTTGTATGGTTA 65 5
mmu-let-7c-1_precursor TAGTAGGTTGTATGGTTG 8 6
mmu-let-7c-1_precursor TGAGGTACTNGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor GTCGTAGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor GGTAGAAGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor TCGAGGTAGTAGGTTGTATGGT 4 1
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTAA 296 1
mmu-let-7c-1_precursor TGAGGTAGTANCTTGTATGGTTTA 3 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGGATGGT 3 4
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTAA 187 1
mmu-let-7c-1_precursor TGCGATAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTGTGGTTTA 36 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTA 127 3
mmu-let-7c-1_precursor TNAGGTAGTGGGTTGTATGGTT 17 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTC 3 3
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGG 86 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGA 3 7
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGT 1732 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGA 46 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTAAG 14 1
mmu-let-7c-1_precursor TAGTAGGTTGTATG 10 11
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTGT 2 2
mmu-let-7c-1_precursor TGGGNTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor GAGGTAGTAGNCTGTATGGTTT 3 2
mmu-let-7c-1_precursor ANTAGGTTGTATGGTT 19 5
mmu-let-7c-1_precursor TGACGTAGTAGGTNGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTACTAGGCTGTATGGTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGNCTGTATGG 3 4
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTCTATGGTT 2 1
mmu-let-7c-1_precursor GNAGGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTGGGT 6 10
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGT 265 3
mmu-let-7c-1_precursor TGAGGTAGTCGGCTGTATGGTT 19 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTACGGTTAA 9 1
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGG 56 3
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTGA 13 1
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGG 70 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGT 4 8
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGA 3 6
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATG 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTTGGTTGNATGGTT 2 2
mmu-let-7c-1_precursor TAAGGTAGTAGATTGTATGGTT 2 5
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGTT 2 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTAT 7 6
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGAATGGTT 57 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATTGT 3 5
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGCATGGTT 9 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTACA 2 1
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGTTAA 3 1
mmu-let-7c-1_precursor TAGCAGGTTGTATGGTT 3 16
mmu-let-7c-1_precursor GTAGGTTGTANGGTT 13 14
mmu-let-7c-1_precursor NGGGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTGTGGTTTA 9 2
mmu-let-7c-1_precursor TTAGGCAGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor GAGGNAGTAGGTTGTATGGTT 23 2
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor CNGAGGTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor AGTAGGTTGTATGGTT 417 3
mmu-let-7c-1_precursor TGAGATAGTAGGTTGTATGG 6 3
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTTTA 9 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGCTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTCAG 12 1
mmu-let-7c-1_precursor GNAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGTTGA 2 1
mmu-let-7c-1_precursor CTGAGGTAGTAGCTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGCCGTAGTAGGTTGTATGGTT 28 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTATATGGTT 4 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTAT 30 9
mmu-let-7c-1_precursor CTGAGGGAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTGGTAGGNTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGATGTAGTAGGNTGTATGGTT 8 3
mmu-let-7c-1_precursor TGNGGTATTAGGTTGTATGGTT 9 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTAGTATGGT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGTTT 4 2
mmu-let-7c-1_precursor AGGGAGTAGGTTGTATGGTT 11 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGT 2226 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGA 61 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTTC 2 3
mmu-let-7c-1_precursor TGAGGTAGAAGGTTGTATGGT 15 2
mmu-let-7c-1_precursor TGAGGTAGCNGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATCGTT 2 4
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGG 136 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGA 2 17
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATGGTTGA 2 1
mmu-let-7c-1_precursor TNGTAGGTTGTATGGTTA 5 11
mmu-let-7c-1_precursor TGAGGGAGTAGGATGTATGGTT 6 6
mmu-let-7c-1_precursor TGAGGTACTAGGTTGNATGGTT 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTTGA 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGA 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTGA 7 1
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTGTGGTTTAGA 5 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTAAA 7 1
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTTAG 4 1
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTTAT 3 1
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTTAA 7 1
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATG 3 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTTA 18 1
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGGT 41 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGCT 2 4
mmu-let-7c-1_precursor GAGGGAGTAGGTTGTATGG 8 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTTTATG 2 8
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGTT 3 2
mmu-let-7c-1_precursor GAGGTCGTAGGTTGTATGGTTAA 5 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGGATGGTT 9 3
mmu-let-7c-1_precursor TGAGGTAGTANATTGTATGGTTT 256 3
mmu-let-7c-1_precursor TTGAGGTAGTNGGTTGTATGGTT 4 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGG 412 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGCTT 6 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTT 2976 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTG 2 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTA 38 3
mmu-let-7c-1_precursor NAGGTAGTAGGTTGTATGG 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATG 11 4
mmu-let-7c-1_precursor TGCTGTAGTAGGTTGTATGGTT 11 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTAAG 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGAGA 9 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGAGT 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTAT 59 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGTT 17 2
mmu-let-7c-1_precursor GAGGTAGTAGGTAGTATGGTTT 3 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGTTT 25 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTGA 5276 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGNATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTATNAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor GAGGTAGTAAGTTGTATGGTT 2 3
mmu-let-7c-1_precursor TGGNGTAGTAGGTTGTATGGTTT 604 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTTA 40 1
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTTG 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTCT 7 3
mmu-let-7c-1_precursor CNAGGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGATGTAGTAGGCTGTATGGTT 2 3
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTTTGGTTT 14 3
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTTAA 57 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGA 13 3
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGG 2 4
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGT 703 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTTAAA 2 1
mmu-let-7c-1_precursor GTAGTTGGTTGTATGGTTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGTTC 4 2
mmu-let-7c-1_precursor TGAGGAAGTGGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGNGGTATTAGGTTGTATGGT 4 2
mmu-let-7c-1_precursor GAGGTAGTAGGTNGTATGGTTT 33 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGT 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGA 9 4
mmu-let-7c-1_precursor TGAGCTAGTAGGGTGTATGGTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTA 33 5
mmu-let-7c-1_precursor GGTAGGAGGTTGTATGGTT 16 3
mmu-let-7c-1_precursor TGCGGTAGTAGGTTTTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTT 15138 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTTC 3 3
mmu-let-7c-1_precursor TTGAGGTAGTAGATTGTATGGT 2 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTCTATGGTA 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTCG 6 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATG 315 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGCTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTTTGGTT 8 4
mmu-let-7c-1_precursor TGAGGTGGGAGGTTGTATGGTT 5 4
mmu-let-7c-1_precursor TGAGGATGTAGGTTGTATGGTT 3 4
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGTTT 5 3
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGTT 2 7
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGGTTAA 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTT 954 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTA 524 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTC 13 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTG 60 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATTGT 7 6
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGT 1419 2
mmu-let-7c-1_precursor TAGAGTTACACCCTGGGAGTTAA 2 1
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTTAA 9 1
mmu-let-7c-1_precursor TGAGGTTGTAGGTTGTATGTTT 2 5
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTAT 15 2
mmu-let-7c-1_precursor CTGAGGTAGTAGGTTGTATGGT 73 2
mmu-let-7c-1_precursor TGTNGTAGTAGGTTGTATGGTT 116 2
mmu-let-7c-1_precursor TGAGGTCGTCGGTTGTATGGTTT 5 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTATATGGTT 30 2
mmu-let-7c-1_precursor NAAGGTAGTAGGTTGTATGGTT 15 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGATGAAGTAGGTTGTATGGTT 3 4
mmu-let-7c-1_precursor GAGGTAGTAGGCTGTATGGT 5 2
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGTTT 66 2
mmu-let-7c-1_precursor TGAGGTAGTACGTTGTATGGTTA 14 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTTC 3 3
mmu-let-7c-1_precursor TGACGTAGTNGGTTGTATGGT 2 3
mmu-let-7c-1_precursor TGACGGAGTAGGTTGTATGGTTT 4 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTG 28 14
mmu-let-7c-1_precursor GAGGTAGTAGGATGTATGGTT 26 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTTTAC 4 2
mmu-let-7c-1_precursor AGAGGTAGTAGGTTGTATGGTTTA 3 1
mmu-let-7c-1_precursor TGNAGTAGGTTGTATGGTT 7 11
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGG 8 5
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGC 2 4
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTAA 28 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTAT 10 1
mmu-let-7c-1_precursor GTAGGTTGTNTGGTT 59 19
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGAATGGTT 9 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGTTT 22 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTG 124 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTA 1331 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTC 25 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATCGT 3 4
mmu-let-7c-1_precursor ANTAGGTTGTATGGTTT 2 3
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGTTAA 11 1
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTGA 10 1
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGNATGGT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATCGTT 2 4
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGAT 2 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATCGTT 11 5
mmu-let-7c-1_precursor CGAGGTACTAGGTTGTATGGTTT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTAT 3 7
mmu-let-7c-1_precursor GGTAGTAGGTTGTGTGGTTAAG 9 1
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGT 421 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGA 9 8
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAAA 451 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTCGTT 2 6
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGTTG 6 3
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGTTT 74 2
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGTTA 57 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGTTT 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTG 4 6
mmu-let-7c-1_precursor TGGGGTAGTAGGTCGTATGGTT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTGA 13 1
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTTT 385 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTTA 277 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTTC 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTTG 26 4
mmu-let-7c-1_precursor NGAGGTCGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGG 42 2
mmu-let-7c-1_precursor TGCGGAAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TNGAGGTAGTAGGTTGTATGGTA 6 1
mmu-let-7c-1_precursor GAGGGAGTAGGTTGTATGGT 10 2
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGGTTC 72 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTTTA 140 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGGTTAA 6 1
mmu-let-7c-1_precursor GNAGTAGGTTGTATGGTT 20 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGCATGGTT 11 4
mmu-let-7c-1_precursor TGAGNTAGAAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGNGGTAGTGGGTTGTATGGTT 7 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATTGTT 2 8
mmu-let-7c-1_precursor TTAGGTAGTAGGTCGTATGGTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTAAA 5 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTAAG 2 4
mmu-let-7c-1_precursor GAGGTAGTAGGTCGTATGGTT 63 2
mmu-let-7c-1_precursor TGAGGGCGTAGGTTGTATGG 3 5
mmu-let-7c-1_precursor TNGAGGTAGTAGGTTGTATGGTTT 10 1
mmu-let-7c-1_precursor TNGAGGTAGTAGGTTGTATGGTTA 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTTAAA 965 2
mmu-let-7c-1_precursor GTAGTAGGTTGTATTGTT 2 15
mmu-let-7c-1_precursor GAGGTAGCAGGTTGTATGGT 3 2
mmu-let-7c-1_precursor TGAGGTAGNATGTTGTATGGTT 9 2
mmu-let-7c-1_precursor TGATCTAGTAGGTTGTATGGTT 3 4
mmu-let-7c-1_precursor GGTAGTAGGNTGTATGGTTT 2 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGNTGTATGGTT 5 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGG 332 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGT 4 4
mmu-let-7c-1_precursor NGAGGCAGTAGGTTGTATGGTT 10 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTAA 55 1
mmu-let-7c-1_precursor TGCGGTGGTAGGTTGTATGGTT 29 2
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGTATGGTTT 20 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTC 115 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTA 6209 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTG 492 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTAT 58 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGGTTC 2 2
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGTG 2 3
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGTA 5 3
mmu-let-7c-1_precursor TTAGGTCGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGA 9 4
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGAT 10 2
mmu-let-7c-1_precursor TGANGTGGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGT 78 2
mmu-let-7c-1_precursor TTGAGGTAGTNTGTTGTATGGT 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGCT 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTA 1340 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGTTT 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGTTGA 5 2
mmu-let-7c-1_precursor TGNGGTCGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGGTAGTAGGTTGTATGGTT 245 2
mmu-let-7c-1_precursor TGGTAGTAGGTTGTATGGTG 2 9
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGCATGGT 6 3
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTTTAT 2 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGT 9024 2
mmu-let-7c-1_precursor TAGTAGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGGATGGTTT 2 2
mmu-let-7c-1_precursor TGAAGTAGTAGGNTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTTG 6 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTTTGGTT 2 5
mmu-let-7c-1_precursor TGAGNTGGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTACGGT 3 2
mmu-let-7c-1_precursor TGAGGTTGTAGGTTGTATGGT 16 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATTGTT 5 8
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGATG 3 3
mmu-let-7c-1_precursor GTTNAGGTAGTAGGTTGTATGGTT 2 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTAT 47 1
mmu-let-7c-1_precursor TAGTAGGTTGTATGGT 74 4
mmu-let-7c-1_precursor TAGTAGGTTGTATGGA 4 42
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGTT 7 4
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTG 7 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTA 61 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTC 4 3
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATG 4 5
mmu-let-7c-1_precursor GAGGGAGGAGGTTGTATGGTT 3 9
mmu-let-7c-1_precursor CTGTACAACCTTCTAGCTTTCC 61 1
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7c-1_precursor GCGGTAGTAGGTTGTATGGT 15 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTCGGTTT 2 3
mmu-let-7c-1_precursor TTGAGGTAGTNTGTTGTATGGTT 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGTTGGTT 7 10
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTA 126 3
mmu-let-7c-1_precursor TGAGGTAGTNGGTTTTATGGTT 3 2
mmu-let-7c-1_precursor TGACGCAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor ATGTAGTAGGTTGTATGGTT 9 3
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGGTTGA 3 1
mmu-let-7c-1_precursor TANGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTTTAT 2 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTCTATGGTT 3 4
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTAT 34 4
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTGTGGTTTA 153 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTAA 2 26
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGTT 503 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGTA 10 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTAAGA 10 1
mmu-let-7c-1_precursor TTGCGGTAGTAGGTTGTATGGTT 16 1
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGTATGGTTAA 4 1
mmu-let-7c-1_precursor GAGGTAGTAGGTAGTATGGTT 12 2
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTTGA 8 1
mmu-let-7c-1_precursor TGAGNTAGAAGGTTGTATGGTT 15 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTAT 9 3
mmu-let-7c-1_precursor TGAGGTAGTANTTTGTATGGT 179 3
mmu-let-7c-1_precursor TCGAGGTAGTAGGTTGTATGGTT 2 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGGTTT 41 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGGTTA 26 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGGTTG 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGGTGA 2 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGCTGTATGGT 2 1
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGGT 43 3
mmu-let-7c-1_precursor TGGNGTAGTAGGTTGTATGGT 539 2
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGGG 2 10
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTTA 10 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTG 6 34
mmu-let-7c-1_precursor GAGGGAGTAGGTTGTATGGTTT 15 2
mmu-let-7c-1_precursor GAGGGAGTAGGTTGTATGGTTA 9 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTAAG 14 1
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGCATGGTT 2 3
mmu-let-7c-1_precursor TGAGGTAGTACGTNGTATGGTT 2 2
mmu-let-7c-1_precursor TGACTTAGTAGGTTGTATGGTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTGTGGTTTAG 4 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGCATGGTTTA 3 1
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATTGTT 5 6
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTTGTT 4 9
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTAT 36 2
mmu-let-7c-1_precursor TGAGNTAGGAGGTTGTATGG 3 5
mmu-let-7c-1_precursor TTGAGGTAGTCGGTTGTATGGT 2 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATTGTT 11 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTAT 7 8
mmu-let-7c-1_precursor TNAGGTATTAGGTTGTATGGTT 55 2
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTTA 10 1
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTTC 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATG 17 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGTTT 6 2
mmu-let-7c-1_precursor GACGTAGTAGGTTGTATGGTT 12 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTTTGGTT 9 3
mmu-let-7c-1_precursor TGAGGTAGTNTGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGTAT 2 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATG 74 3
mmu-let-7c-1_precursor TGAGGACGTAGGTTGTATGGTT 8 2
mmu-let-7c-1_precursor TTGNGGTAGTAGGTTGTATGGTAT 3 1
mmu-let-7c-1_precursor GANGTAGTAGGTTGTATGGTTG 4 3
mmu-let-7c-1_precursor AGGTAGTAGGTTCTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTAA 40 1
mmu-let-7c-1_precursor TGAGGTAGTATGTTGTATGGTT 219 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGA 6 4
mmu-let-7c-1_precursor GTAGTAGGTTGTAT 4 20
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGGGGTTTA 13 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGGATGGTTT 21 2
mmu-let-7c-1_precursor TGGGGTGGTAGGTTGTATGGT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGTTT 2 3
mmu-let-7c-1_precursor GAGGTAGTANGTTGTATGGTT 181 2
mmu-let-7c-1_precursor GAGGTAGTANGTTGTATGGTA 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGATTGCATGGT 5 7
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATTGTTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTGTGGTTTA 26 2
mmu-let-7c-1_precursor TGAGGGAGTAAGTTGTATGGT 3 6
mmu-let-7c-1_precursor TNAGGTAGTGGGTTGTATGGT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGTNTGTATGGTT 6 4
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTCTGGTTTAT 2 1
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGTTT 3 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGT 82 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTAAG 3 1
mmu-let-7c-1_precursor GGAAGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGACGGAGTAGGTTGTATGGTT 11 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATCGTTA 37 4
mmu-let-7c-1_precursor GAGGTAGTAGGATGTCTGGT 3 10
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTCTGGTTT 70 3
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTGA 4 1
mmu-let-7c-1_precursor NTAGGTTGTATGGTT 12 18
mmu-let-7c-1_precursor GAGGNAGTCGGTTGTATGGTT 33 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATCGTT 4 4
mmu-let-7c-1_precursor NGAGGTATTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGCTAGTAGGTTGTATGGT 3 22
mmu-let-7c-1_precursor TNAGGTAGTAGGTTATATGGTT 4 2
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGTT 898 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATTGTT 5 5
mmu-let-7c-1_precursor TGAGNTAGGAGGTTGTATGGTT 24 3
mmu-let-7c-1_precursor GNAGTAGGTTGTGTGGTTTA 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTAT 30 4
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGT 288 3
mmu-let-7c-1_precursor TGAGGTAGTAGATTGAATGGT 3 6
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGA 20 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTGGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATGTGGTTTA 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTCTGGTT 3 3
mmu-let-7c-1_precursor NTGAGGTAGTAGGTTGTATGGT 10 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTAA 58 3
mmu-let-7c-1_precursor TTCGGTAGTAGGTTGTATGGTT 12 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTAG 439 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTAA 2074 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTAT 1224 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTTTGGTTT 3 4
mmu-let-7c-1_precursor GTAGTAGGTTGTACGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATTGTT 7 5
mmu-let-7c-1_precursor GAGGTTGTAGGTTGTATGG 5 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGNATGGT 2 2
mmu-let-7c-1_precursor CAGGTAGTAGGTTGTATGGTT 23 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGTTGA 3 4
mmu-let-7c-1_precursor TCGGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGG 65 3
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGA 2 10
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGT 104 2
mmu-let-7c-1_precursor NGAGGAAGTAGGTTGTATGGTT 10 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGT 38 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGC 2 5
mmu-let-7c-1_precursor GTNGGTTGTATGGTTT 4 7
mmu-let-7c-1_precursor GAGATAGTAGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGTTTT 11 2
mmu-let-7c-1_precursor TGAGGTAGCAGGNTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTTAG 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTTAA 5 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTGA 24 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTATATGGT 10 2
mmu-let-7c-1_precursor ANGTAGTAGGTTGTATGGTTA 2 2
mmu-let-7c-1_precursor GCTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGTT 10 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGTTT 5 3
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGTT 5 3
mmu-let-7c-1_precursor NAGGTAGTAGGTTGTATGGTTT 13 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGT 63 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTG 7 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTTTATGGTT 21 3
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTGTGGTTTAG 4 1
mmu-let-7c-1_precursor TGGGGTAGTAGGGTGTATGGT 2 7
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGCATGGTT 605 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTGA 21 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATTGTT 15 5
mmu-let-7c-1_precursor TGANGTAGTAGGTTG 10 15
mmu-let-7c-1_precursor TGAGGTATTAGGNTGTATGGTT 10 2
mmu-let-7c-1_precursor TTAGTAGGTTGTATGGTT 3 8
mmu-let-7c-1_precursor TAGGTAGTANGTTGTATGGTT 8 2
mmu-let-7c-1_precursor TNAGGTAGTAGGGTGTATGGTT 3 2
mmu-let-7c-1_precursor NGAGGTAGTGGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCTTATGGTT 3 3
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGTATG 3 2
mmu-let-7c-1_precursor ATGAGGTAGTAGGTTGTATGGTT 14 3
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGG 15 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTGTGGTTTAG 17 1
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTTT 551 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTGTGGTTTAGA 2 1
mmu-let-7c-1_precursor TNAGGTAGTAGATTGTATGGTT 12 4
mmu-let-7c-1_precursor TGAGGTAGGAGGGTGTATGGTTT 2 4
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGCATGGTT 2 2
mmu-let-7c-1_precursor TGGTAGTAGGTTGTATGGTTT 11 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGGGTT 2 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGTTTT 4 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTTAG 4 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTG 2 4
mmu-let-7c-1_precursor TGAGGTAGTACGTTGTATGGTTT 11 2
mmu-let-7c-1_precursor TGAGGTAGTACGTTGTATGGTTG 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATCGTTT 58 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATCGTTC 11 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCTTT 177 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCTTA 119 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCTTC 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCTTG 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGTTTAT 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGTTTAA 6 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGATA 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGATT 14 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGATC 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGATA 19 2
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGTTAA 6 1
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTT 442 3
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTA 324 4
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTC 9 4
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTGTGGTTTA 32 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTTAG 5 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTTAT 11 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTTAA 12 1
mmu-let-7c-1_precursor TGAGGGAGNAGGTTGTATGGTT 45 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTNATGGTT 4 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGCATGGTTT 85 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTCAT 13 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTCAG 7 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTCAA 24 1
mmu-let-7c-1_precursor TGAGGTAGTTNGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGT 1609 1
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTTTA 6 1
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGGTTTAT 2 1
mmu-let-7c-1_precursor TNAGGTGGTAGGTTGTATGGTT 12 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGTTT 6 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTAAAA 7 1
mmu-let-7c-1_precursor TGAGGTAGTTGGTTGTATGGTTAA 3 1
mmu-let-7c-1_precursor GGAGGTAGTAGGTTGTATGGT 11 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTTA 18 1
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGG 14 2
mmu-let-7c-1_precursor TGATGTAGTANGTTGTATGGTT 2 3
mmu-let-7c-1_precursor GANGTAGTAGGTTGTATGGTTAA 6 1
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTA 8 44
mmu-let-7c-1_precursor TGGGGTGGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor GAGGTACTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGCATGG 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTAA 245 1
mmu-let-7c-1_precursor TTGGGTAGTAGGTTGTATGGTT 5 4
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATTGT 2 5
mmu-let-7c-1_precursor AGGTATTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor GAGGTATTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor NGTAGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAGT 88 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTNTATGGTT 7 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAGC 53 1
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATGGTT 182 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTTAA 240 1
mmu-let-7c-1_precursor GAGGTAGTAGGTAGTATGGTTA 3 2
mmu-let-7c-1_precursor NTAGTAGGTTGTATGGTT 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNAT 38 4
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGTT 6 6
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGT 177 2
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGA 4 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCTA 8 2
mmu-let-7c-1_precursor GAGGGAGTAGGTTGTATG 3 8
mmu-let-7c-1_precursor GAGNTAGTAGGTTGGATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTATTAGGTNGTATGGTT 12 2
mmu-let-7c-1_precursor GAGGTAGTAGGTNGTGTGGTTTA 2 2
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATG 4 5
mmu-let-7c-1_precursor GTAGTAGGTTGTGTGGTTTAG 3 1
mmu-let-7c-1_precursor GTAGTAGGTTGTGTGGTTTAT 6 4
mmu-let-7c-1_precursor TGAGGGAGTAGGTNGTATGGTTT 2 2
mmu-let-7c-1_precursor TGATGGAGTAGGTTGTATGGTT 7 3
mmu-let-7c-1_precursor GAGGTAGTAGGATGTATGGTTA 2 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGATT 2 3
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGTT 411 2
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGTA 7 3
mmu-let-7c-1_precursor GAGGTAGTAGGTGGTATGGT 3 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTTTATGGT 2 6
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGT 73 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGA 4 5
mmu-let-7c-1_precursor GGTAGTAGGTTGTNTGGT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTTACA 4 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGTTT 25 2
mmu-let-7c-1_precursor TGAGGTAGTANTTTGTATGGTTTA 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTGAG 67 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATTGT 2 9
mmu-let-7c-1_precursor TGAGGCAGTAGGCTGTATGGTT 2 2
mmu-let-7c-1_precursor GTAGGTTGTATGNTT 39 24
mmu-let-7c-1_precursor AGTAGGTTGTATGGTTGAAA 2 13
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATNGTTA 2 4
mmu-let-7c-1_precursor TGAGGTATTAGATTGTATGGTT 3 4
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGTTT 7 3
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGNATGGTT 2 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGG 141 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGTTAA 22 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGA 3 8
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTTTGGTTT 3 3
mmu-let-7c-1_precursor TCAGGTATTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTTTA 7 1
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTTTG 3 2
mmu-let-7c-1_precursor TGNTGTAGTAGGTTGTATGGTT 10 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTAG 4 1
mmu-let-7c-1_precursor TGTAGGAGGTTGTATGGTT 2 48
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTAT 23 2
mmu-let-7c-1_precursor TANTAGGTTGTATGGTT 8 3
mmu-let-7c-1_precursor TGAGGTAGTAGGNTG 9 22
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTTTGGTT 22 3
mmu-let-7c-1_precursor TGAGGTAGTNGGCTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCNGTATGGTT 2 2
mmu-let-7c-1_precursor TGGGTAGTAGGTTGTATGGTT 39 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTT 1967 2
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTA 4 7
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGCT 2 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGTA 10 5
mmu-let-7c-1_precursor TGTACAACCTTCTAGCTTTCC 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGTTGGTTT 4 4
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGG 8 2
mmu-let-7c-1_precursor GATGTAGTANGTTGTATGGTT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGGTT 77 2
mmu-let-7c-1_precursor TGAGGTATTNGGTTGTATGGTT 7 2
mmu-let-7c-1_precursor GAAGTAGTAGGTTGTATGGT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGTTAA 18 1
mmu-let-7c-1_precursor GAGGTTGTAGGTTGTATGGTAT 2 3
mmu-let-7c-1_precursor TGAGGTAGTACGTTGTATGGT 15 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTTTGGTT 6 5
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGGTTAA 16 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTCTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATG 5 5
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGTT 7 4
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTTGA 4 1
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTTGA 3 1
mmu-let-7c-1_precursor NTAGGTAGTAGGTTGTATGGT 4 2
mmu-let-7c-1_precursor TGAGGGAGTAGGCTGTATGGTT 32 3
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTTAA 66 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGG 24 2
mmu-let-7c-1_precursor GAGGTAGTAGGGTGTATGGTTT 7 2
mmu-let-7c-1_precursor GAGGTAGTAGGGTGTATGGTTA 5 2
mmu-let-7c-1_precursor AGGTAGTAGGTTNTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGT 105 2
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGCTT 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTA 155751 2
mmu-let-7c-1_precursor TNGGTAGTAGGTTGTATGGTT 21 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTTAA 756 2
mmu-let-7c-1_precursor TCAGGTAGTAGCTTGTATGGTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTAGA 333 1
mmu-let-7c-1_precursor TAGTAGGTTGTATTGTT 6 44
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATG 4 5
mmu-let-7c-1_precursor TGAGGTAGTAAGTTGTATGGTTA 15 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNGTGGTTTAG 14 1
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGCT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGATGG 2 3
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGCATGGTT 10 2
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATGGT 30 2
mmu-let-7c-1_precursor GAGGTAGTAGGTCGTATGGTTT 14 2
mmu-let-7c-1_precursor GCTGAGGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTT 285 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTG 10 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGGTTT 68 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGGTTA 48 2
mmu-let-7c-1_precursor TTGNGGTAGTAGGTTGTATGG 2 1
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGG 86 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTT 1448 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTG 70 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTTAA 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTTAT 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAG 1732 1
mmu-let-7c-1_precursor NCAGGTAGTAGGTTGTATGGTT 8 2
mmu-let-7c-1_precursor GTAGGTTGTANGGT 2 36
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGCTTA 2 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTTAA 59 1
mmu-let-7c-1_precursor TGAGGTAGTANATTGTATGGT 250 5
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTTTGGTT 3 4
mmu-let-7c-1_precursor TGAGATAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7c-1_precursor TGAGNTATTAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATG 87 2
mmu-let-7c-1_precursor TGGGGTAGTCGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TNGAGGTAGTAGGTTGTATGGTAT 2 1
mmu-let-7c-1_precursor NAGGTAGTAGGTTGTATG 4 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGAATGGTT 3 3
mmu-let-7c-1_precursor GGTAGTAGGTTGTATCGT 2 5
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGTTT 19 2
mmu-let-7c-1_precursor CGAGGTAGTAGGCTGTATGGTT 2 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTTT 15 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTTA 3 1
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTGTGGTTTA 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGT 1825 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGA 53 2
mmu-let-7c-1_precursor GGAGGTAGTAGGTTGTATGG 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTAT 30 2
mmu-let-7c-1_precursor CGNGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGT 145 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGA 4 5
mmu-let-7c-1_precursor TGAGGTAGAAGGTTGTGTGGTTTAG 2 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTT 68594 2
mmu-let-7c-1_precursor TGATGTAGTAGGTNGTATGGTT 9 3
mmu-let-7c-1_precursor GAGGTAGTAGNTTGTATGGTTA 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTTTAGA 3 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTNTGGTTT 6 3
mmu-let-7c-1_precursor GGTAGTAGGTTGTNTGGTTA 2 3
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTGTGGTTTA 28 2
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGTTAA 5 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTAG 14 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTAA 132 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTAC 9 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTAT 91 2
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTCTGGT 10 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGTT 2 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTA 1510 2
mmu-let-7c-1_precursor GGTCGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TNACGTAGTAGGTTGTATGGTT 16 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTAAG 84 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTAA 13 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTAG 3 3
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTAT 3 6
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTTTGGTT 2 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGGTT 490 2
mmu-let-7c-1_precursor GTAGTAGGTTGTGTGGTTGA 3 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGGTA 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTA 10 5
mmu-let-7c-1_precursor TGAGGGAGTGGGTTGTATGGTT 10 4
mmu-let-7c-1_precursor TGTAGTAGGTTGTATGG 12 14
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATG 24 2
mmu-let-7c-1_precursor TGAGGTAGNACGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TAAGTAGTAGGTTGTATGGTT 2 5
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTA 6 4
mmu-let-7c-1_precursor TGANGTAGTAGGTTGT 4 8
mmu-let-7c-1_precursor TGAGGTAGTNGGTCGTATGGTT 3 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTA 2 14
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTTT 405 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTACGTTT 5 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTTG 29 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGTTA 275 2
mmu-let-7c-1_precursor TGGNGTAGTAGGTTGTATGG 111 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTNGTATGGTT 8 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGTTT 9 2
mmu-let-7c-1_precursor AGGTAGTAGNTTGTATGGTT 7 2
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATGGTTA 43 2
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATGGTTG 3 3
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATGGTTT 63 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGCATGGTT 4 3
mmu-let-7c-1_precursor TGNGGTAGTAGGTGGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTTAT 15 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTTAA 9 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTACGG 16 3
mmu-let-7c-1_precursor TGAGGCAGTCGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTCA 54 2
mmu-let-7c-1_precursor GTAGTAGGTTGTATGG 14 2
mmu-let-7c-1_precursor TGAGGTAGTAGATTGAATGGTT 10 5
mmu-let-7c-1_precursor GAGGTAGTAGGTTTTATGGTTAA 3 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTG 4 2
mmu-let-7c-1_precursor TGAGGTAGCAGGTNGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTANGTTGCATGGTT 2 2
mmu-let-7c-1_precursor TTAGGTAGTAGGCTGTATGGTT 3 2
mmu-let-7c-1_precursor TGCGGTAGTGGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTGT 164 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTAT 15 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTGC 15 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTGA 191 4
mmu-let-7c-1_precursor TTGCGGAAGTAGGTTGTATGGTT 2 1
mmu-let-7c-1_precursor ACGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGTTTT 3 2
mmu-let-7c-1_precursor TNGGGTAGTAGGTTGTATGGTT 15 2
mmu-let-7c-1_precursor TGTCGTAGGTTGTATGGTT 2 19
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGCGGTTTA 10 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTAA 40 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTAT 47 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTAC 2 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTAG 5 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTT 1844 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTC 3 4
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTTTGGTTT 5 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTA 40 3
mmu-let-7c-1_precursor GGTAGTAGGTTGTATTGTT 9 9
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATG 8 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTGA 18 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGA 2 10
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGG 11 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTCTGGTTT 5 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATCGTT 3 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAA 5990 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAC 411 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAT 1298 1
mmu-let-7c-1_precursor TGAGGGTGTAGGTTGTATGGT 4 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGTTTA 2 1
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTNTGGTT 10 3
mmu-let-7c-1_precursor GTAGTAGGTNGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATCGTT 3 4
mmu-let-7c-1_precursor TGAGGTAATAGATTGTATGGTT 2 5
mmu-let-7c-1_precursor TTGAGGTAGNAGGTTGTATGGTTAA 2 1
mmu-let-7c-1_precursor TGGTAGTAGGTTCTATGGTT 2 8
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGA 4 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTC 3 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTA 14 5
mmu-let-7c-1_precursor TGAGNTAGCAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGGTC 8 2
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGGTA 2 2
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGGTT 144 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTA 781 2
mmu-let-7c-1_precursor TAAGGGAGTAGGTTGTATGGTT 5 3
mmu-let-7c-1_precursor AGGTTGTATGGTTT 5 34
mmu-let-7c-1_precursor TGAGNTAGCAGGTTGTATGGTTTA 2 1
mmu-let-7c-1_precursor NGGTAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTCTGGTT 2 4
mmu-let-7c-1_precursor GAGGTAGTAGNCTGTATGGTT 27 2
mmu-let-7c-1_precursor GTTGAGGTAGTATGTTGTATGGTT 2 1
mmu-let-7c-1_precursor TAGGTAGTAGGTCGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTC 439 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTA 20107 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTG 793 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTCT 22 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTCA 29 2
mmu-let-7c-1_precursor TNAGATAGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATGG 49 1
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGTAT 5 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTTTGGT 4 3
mmu-let-7c-1_precursor TTGNGGTAGTAGGTTGTATGGTT 14 1
mmu-let-7c-1_precursor TGCGGCAGTAGGTTGTATGGTT 10 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGGATGGTT 4 3
mmu-let-7c-1_precursor GGTAGTAGGTTGTGTGGTTGA 4 2
mmu-let-7c-1_precursor GTTGAGGTAGTAGG 3 11
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGNATGGTT 4 2
mmu-let-7c-1_precursor TNGAGGTAGTAGGTTGTATGGTT 49 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTGGTATGGTT 2 2
mmu-let-7c-1_precursor TGCGGTAGTAGGCTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGCCGTAGTAGGTTGTATGGTTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTGGGNTGTATGGTT 2 2
mmu-let-7c-1_precursor NGAGGTAGTAGGCTGTATGGTT 21 2
mmu-let-7c-1_precursor CNGTACAACCTTCTAGCTTTCC 2 1
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGTTA 27 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGTTT 48 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGTTC 3 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTTTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTATGTTGTATGGTTA 17 2
mmu-let-7c-1_precursor TGAGGTAGTATGTTGTATGGTTT 24 2
mmu-let-7c-1_precursor TTAGGGAGTAGGTTGTATGGTT 11 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGC 2 2
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATGG 7 2
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATGA 2 5
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTTT 22 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTTC 2 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTTA 19 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-1_precursor GTAGGTTGTATGGNT 31 18
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTAAG 4 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTTTATGGTTT 10 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTTTATGGTTA 11 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTTTATGGTTG 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATTGTTT 4 4
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGTTG 7 2
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGTTA 70 2
mmu-let-7c-1_precursor TGAGGTAGAAGGTTGTATGGGT 2 6
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATG 60 2
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGTTT 97 2
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGTTG 8 2
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGTTA 57 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTN 55 2
mmu-let-7c-1_precursor AGTAGGTTGTATGG 34 13
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGG 159 3
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGA 5 9
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTA 447 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTT 708 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTC 10 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTG 36 2
mmu-let-7c-1_precursor TAGAGGTAGTAGGTTGTATGGTT 6 1
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATG 14 2
mmu-let-7c-1_precursor TAGNTAGTAGGTTGTATGGTT 7 2
mmu-let-7c-1_precursor TGAGGAGGTAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGGAT 3 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGTTT 105 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGTTA 49 2
mmu-let-7c-1_precursor TAGTAGGTTGTATGGTTTA 4 1
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTGA 26 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTGA 123 1
mmu-let-7c-1_precursor TGAGGTAGTAGATTGGATGGTT 4 4
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATG 4 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTATATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGG 8 4
mmu-let-7c-1_precursor TAGGAGGTTGTATGGTT 5 18
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGCTT 2 3
mmu-let-7c-1_precursor GGANGTAGGTTGTATGGTT 5 5
mmu-let-7c-1_precursor TGAGGTAGTAGGNTATATGGTT 2 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTG 9 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTT 186 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTA 60 1
mmu-let-7c-1_precursor TGAGGGTGTAGGTTGTATGGTT 15 3
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGG 12 2
mmu-let-7c-1_precursor AAGGTAGTAGGTTGTATGG 2 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGT 1069 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGA 18 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTAT 54 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTAT 2 10
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGCATGGTT 3 2
mmu-let-7c-1_precursor TGATGTAGTAGGGTGTATGGTT 2 3
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTA 72 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTG 4 2
mmu-let-7c-1_precursor TGATTTAGTAGGTTGTATGGTT 8 3
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGGTTAA 4 1
mmu-let-7c-1_precursor NGAGGTAGTAGGTTTTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGTTAA 9 1
mmu-let-7c-1_precursor TGAGGTAGTANGTTG 4 19
mmu-let-7c-1_precursor GGTAGTAGGTTGNATGGTTT 2 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTACGGTTT 5 2
mmu-let-7c-1_precursor GAGGTAGTANGTTGTATGG 11 2
mmu-let-7c-1_precursor AGTAGGTTGTATNGTT 11 11
mmu-let-7c-1_precursor TTGAGTTAGTAGGTTGTATGG 2 1
mmu-let-7c-1_precursor GACGTAGTAGGTTGTATGG 2 3
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATGGTTT 29 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTAA 97 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTCGTATGGTT 19 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGG 35 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTTTAG 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTTTAT 9 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTTTAA 23 1
mmu-let-7c-1_precursor TGAGNTAGTAGGTTCTATGGTT 3 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTG 17 2
mmu-let-7c-1_precursor GAGGTAGTAGNATGTATG 2 23
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGN 16 10
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGT 817 8
mmu-let-7c-1_precursor GANGTAGTAGGTTGTATG 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTTT 144 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTTG 10 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCGGTATGGTT 4 2
mmu-let-7c-1_precursor TAGTNGGTTGTATGGTT 4 4
mmu-let-7c-1_precursor TGAGGTAGTANATTGTATGGTTTA 3 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTAAA 3 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGTTT 13 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGTTTTAG 5 1
mmu-let-7c-1_precursor TNAGGTCGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGTTT 263 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGTTA 191 3
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTAT 6 15
mmu-let-7c-1_precursor GTAGTCGGTTGTATGGTT 7 2
mmu-let-7c-1_precursor TTGAGTTAGTAGGTTGTATGGT 8 1
mmu-let-7c-1_precursor GAGGTAGTAGNTTGTATGGTT 14 2
mmu-let-7c-1_precursor TNATGTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTTTGGTT 2 4
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTAA 3 4
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTAT 9 6
mmu-let-7c-1_precursor AGGTAGTAGGTTGTGTGGTTGA 2 2
mmu-let-7c-1_precursor GTAGGTTGTATGGT 355 15
mmu-let-7c-1_precursor GCGGTAGTAGGTTGTATGGTT 145 2
mmu-let-7c-1_precursor GGTAGTAGGNTGTATGGTT 11 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGA 10 4
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGTTT 5 2
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGTAT 3 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGA 10 3
mmu-let-7c-1_precursor TNAGGGAGTAGGTTGTATGGTT 8 2
mmu-let-7c-1_precursor TGAGGCATTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor NGAGGTAGTAGGCTGTATGGT 6 2
mmu-let-7c-1_precursor CTGAGGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7c-1_precursor AGAGGTAGTAGGTTGTATGGTTT 96 2
mmu-let-7c-1_precursor GGGAGTAGGTTGTATGGTT 14 4
mmu-let-7c-1_precursor GTGGAGGTAGTAGGTTGTATGGT 2 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTTAT 5 1
mmu-let-7c-1_precursor TGACGTAGTAGGTTGAATGGTT 6 3
mmu-let-7c-1_precursor TNAGGTACTAGGTTGTATGGTT 20 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGGT 125 2
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGTATGGTTA 12 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGTT 8 2
mmu-let-7c-1_precursor TNGGTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor GAGGTGGTAGGTTGTATGGTTAA 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCTT 1427 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTTTGGTT 2 6
mmu-let-7c-1_precursor TGNGGTAGTAGGCTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTANATTGTATGGTT 2048 4
mmu-let-7c-1_precursor TGAGGTCGTCGGTTGTATGGT 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTAA 122 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGCATGGTT 4 2
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGTT 592 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTTC 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTTA 244 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTTT 323 2
mmu-let-7c-1_precursor CTAGGTAGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGT 4 3
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGG 263 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGA 9 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGG 12 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGAA 126 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGAC 4 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTAA 96 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTTGA 56 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGT 7 16
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGG 4 3
mmu-let-7c-1_precursor GTAGTGGGTTGTATGGTT 3 5
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGT 7 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTAAG 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTAT 47 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATG 18 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGG 371 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTTTGGTTT 4 3
mmu-let-7c-1_precursor TGATNTAGTAGGTTGTATGG 2 6
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATG 36 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGT 2 18
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTT 1778 2
mmu-let-7c-1_precursor TGGGGTAGTAGGNTGTATGGTT 5 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATCGTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTAT 13 2
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTGTGGTTTAG 7 1
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGTTT 84 2
mmu-let-7c-1_precursor TGAGGAGGTAGGTTGTATGGTT 40 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGCA 2 3
mmu-let-7c-1_precursor TGAGNTAGGAGGTTGTATGGTTT 6 2
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGGTTAA 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTNGTATGGTT 2 3
mmu-let-7c-1_precursor GAGGTTGTAGGTTGTATGGTA 6 8
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGTTT 2 2
mmu-let-7c-1_precursor GAGGTTGTAGGTTGTATGGTT 168 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGTTTA 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTA 30 2
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTAAG 2 38
mmu-let-7c-1_precursor TTGAGGTAGTAGGGTGTATGGTTT 2 1
mmu-let-7c-1_precursor GAGGGAGTAGGGTGTATGGTT 2 5
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGTT 420 2
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGTA 4 2
mmu-let-7c-1_precursor TGAGGTCGTCGGTTGTATGGTT 30 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTNGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGNATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGG 90 4
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGA 3 11
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGT 3 16
mmu-let-7c-1_precursor TNAGGTAGTAGGTAGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGNATGGTT 10 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTA 3 15
mmu-let-7c-1_precursor GAGGTAGTAGGCTGTATGGTTT 4 2
mmu-let-7c-1_precursor TGAGNTATTAGGTTGTATGGTT 14 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGATATGGTT 2 3
mmu-let-7c-1_precursor TGAGGGAGTCGGTTGTATGGTTT 4 2
mmu-let-7c-1_precursor TGAGGTAATAGGTTGTATGGTTAA 4 2
mmu-let-7c-1_precursor TAGGTTGTAGGTTGTATGGTT 13 10
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGTTAA 6 1
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTTAA 2 1
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTTAT 2 1
mmu-let-7c-1_precursor GAGGTATTAGGTTGTATGGTT 15 2
mmu-let-7c-1_precursor TTAGGTAGTAGCTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGAATGGTTT 4 2
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGNATGGTT 2 2
mmu-let-7c-1_precursor CGAGNTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTCGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTAAG 4 1
mmu-let-7c-1_precursor GTAGGTTGTGTGGTTTA 19 24
mmu-let-7c-1_precursor TNGGGTAGTAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGTTTAA 2 1
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTTAT 6 1
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTTAA 12 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTACTGTT 4 7
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGCTT 12 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGT 393 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGA 5 3
mmu-let-7c-1_precursor TTAGGTAGTAGATTGTATGGTT 3 4
mmu-let-7c-1_precursor GAGGTAGTAGGATGTCTGGTT 11 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTAGAG 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTCTGGTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTTGG 3 3
mmu-let-7c-1_precursor TGGGGTAGTAGTTTGTATGGTT 3 4
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTTTA 5 1
mmu-let-7c-1_precursor TGNGGTAATAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TCGTAGTAGGTTGTATGGTT 5 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTAT 8 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGAATGGT 83 3
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTGTGGTTTA 423 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTCTGGT 63 3
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGNATGGTT 3 2
mmu-let-7c-1_precursor GTAGGTTGTNTGGTTAA 2 44
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGTTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTAA 68461 2
mmu-let-7c-1_precursor TGAGGTAGTANTTTGTATG 9 8
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTTTAA 3 1
mmu-let-7c-1_precursor TGAGGGAGTAGGGTGTATGGTTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTTTAA 3 1
mmu-let-7c-1_precursor TGAGGTAGTATCTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTAAG 12 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTTTATGG 3 4
mmu-let-7c-1_precursor TGAGGTAATAGGTTGTATGGTT 178 2
mmu-let-7c-1_precursor NTAGGTAGTAGGTTGTATGGTT 15 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGCTT 3 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTAAG 5 1
mmu-let-7c-1_precursor GAGGTAGAAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTGTGGTTTAGA 2 1
mmu-let-7c-1_precursor TCATGTAGTAGGTTGTATGGTT 5 3
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTTAA 30 1
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGACGTATTAGGTTGTATGGTT 2 3
mmu-let-7c-1_precursor GTANGTTGTATGGTT 25 17
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTGA 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTACG 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGTTA 85 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGTTC 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGTTT 127 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGTTG 6 2
mmu-let-7c-1_precursor GNTGAGGTAGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTAATAGGTTGTATGG 6 2
mmu-let-7c-1_precursor TGAGGTAGAAGGTTGTATGTT 2 7
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTT 2066 2
mmu-let-7c-1_precursor GAGGTAGTAGGCTGTCTGGTT 12 4
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTTTGGTT 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGCAT 5 2
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTGTGGTTTA 28 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTAA 16 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTAT 31 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTAG 3 1
mmu-let-7c-1_precursor TTGAGGTAGTAGNTTGTATGGTTT 3 1
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGA 5 18
mmu-let-7c-1_precursor TGAGTTAGTAGGTNGTATGGTT 27 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTTTGGTT 11 3
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGT 2 23
mmu-let-7c-1_precursor GAGGTAGTAGGTTG 14 26
mmu-let-7c-1_precursor TCACGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTC 36 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTT 2324 2
mmu-let-7c-1_precursor TGCGGTCGTAGGTTGTATGGTTT 36 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTGTGGTTTA 111 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTATA 162 2
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGTTT 6 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTAT 6281 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATCGTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTAC 351 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTAG 2537 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTA 1230 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTG 91 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTC 24 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTT 1795 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTGTGGTTTAGA 7 1
mmu-let-7c-1_precursor TGATGTACTAGGTTGTATGGTT 3 3
mmu-let-7c-1_precursor TNGTAGGTTGTATGGT 2 7
mmu-let-7c-1_precursor TTANGTAGTAGGTTGTATGG 3 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGTTAAGA 2 1
mmu-let-7c-1_precursor TGCGGTAGTGGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTCGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTAAG 14 1
mmu-let-7c-1_precursor GAGGTAGTATGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGATAGTAGGTTGTATGGTT 6 9
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTG 62 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTC 17 2
mmu-let-7c-1_precursor TGGCGTAGTAGGTTGTATGGTT 19 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTA 9 6
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATG 4 4
mmu-let-7c-1_precursor TGGGGTAGTNGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATG 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTGTGGTTTAG 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGATAT 5 2
mmu-let-7c-1_precursor GAGCTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor ANAGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTTTAT 4 1
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTTTAA 2 1
mmu-let-7c-1_precursor TGAGGTTGTAGGTTGTATGGTT 124 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGATTAA 16 1
mmu-let-7c-1_precursor TGAGGTTGTAGGTTGTATGGTA 3 6
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTA 8 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTG 3 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTT 523 2
mmu-let-7c-1_precursor TGAGGTAGTATGTGGTATGGTT 2 3
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTGA 38 1
mmu-let-7c-1_precursor TGAGGTTGTAGGTTGTATGGTTTA 2 1
mmu-let-7c-1_precursor GGGNGTAGGTTGTATGGTT 8 4
mmu-let-7c-1_precursor TGCNGTAGTAGGTTGTATG 4 4
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTAT 11 5
mmu-let-7c-1_precursor GAGGGAGTAGGTTGTATGGTT 71 2
mmu-let-7c-1_precursor CTGTACAACCTTCTAGCTTTCCT 6 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCAT 3 8
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTGTGGTTTA 91 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGTT 4 4
mmu-let-7c-1_precursor TTGCGGTAGTAGGTTGTATGGT 21 1
mmu-let-7c-1_precursor GAGTTAGTAGGTTGTATGGTTAA 2 1
mmu-let-7c-1_precursor TNTGGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTAA 122 1
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTTTGGTT 4 5
mmu-let-7c-1_precursor TGAGGTATTNGGTTGTATGGT 2 3
mmu-let-7c-1_precursor GATGTAGTAGGTTGTATGGT 4 3
mmu-let-7c-1_precursor TTACGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGTTT 4 2
mmu-let-7c-1_precursor TGCGGGAGTAGGTTGTATGGTT 15 3
mmu-let-7c-1_precursor TGGNGTAGTAGGTTGTATGGTTTA 16 1
mmu-let-7c-1_precursor ANGTAGTAGGTTGTATGGTT 16 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGTTT 93 2
mmu-let-7c-1_precursor NGAGGGAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTGTGGTTTA 4 2
mmu-let-7c-1_precursor GAGGTAGTTGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTTAAG 16 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTGTGGTTTA 15 3
mmu-let-7c-1_precursor TGCGGTTGTAGGTTGTATGGTT 21 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATG 43 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGT 297 3
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGA 3 3
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATG 24 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATT 2 2
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGTTT 3 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATG 17 3
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGCTT 4 2
mmu-let-7c-1_precursor NGAGGGAGTAGGTTGTATGGTT 34 2
mmu-let-7c-1_precursor GGTGGTAGGTTGTATGGTT 8 2
mmu-let-7c-1_precursor NGAGGTAGTAGATTGTATGGTT 15 4
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTAA 36 1
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTAG 2 17
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATTGTT 6 5
mmu-let-7c-1_precursor TGCGGTAGTAGGTCGTATGGTT 3 2
mmu-let-7c-1_precursor NGCGGTAGTAGGTTGTATGGTT 38 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGA 192 2
mmu-let-7c-1_precursor GGGAGTAGGTTGTATCGTT 2 14
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGTTGA 2 1
mmu-let-7c-1_precursor TGGGGTTGTAGGTTGTATGGTT 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGT 2021 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTA 18 3
mmu-let-7c-1_precursor TNAGGTAGTAGTTTGTATGGTT 23 4
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGAATGGTT 591 2
mmu-let-7c-1_precursor CGCGGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TTAGGAAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGGNGTAGTAGGTTGTATG 26 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTTAAG 4 1
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTGA 8 1
mmu-let-7c-1_precursor TGCGGTCGTAGGTTGTATGGT 44 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTG 14 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTC 2 16
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTA 13 15
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTT 711 23
mmu-let-7c-1_precursor TGAGGTGGTGGGTTGTATGGTT 18 2
mmu-let-7c-1_precursor GAGGTAGTGGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCTTAA 27 1
mmu-let-7c-1_precursor GAGGTAGTAGGTNGTATGGT 27 2
mmu-let-7c-1_precursor TGGGATAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGTT 3 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTTA 36 1
mmu-let-7c-1_precursor TGNTAGTAGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTTAG 5 1
mmu-let-7c-1_precursor TGCGTTAGTAGGTTGTATGGTT 10 2
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATGGTTAA 3 1
mmu-let-7c-1_precursor TGAGGAAGGAGGTTGTATGGTT 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTNA 4 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGCTT 5 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTGTGGTTTAG 4 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATG 84 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATGGTTAA 4 1
mmu-let-7c-1_precursor TAGGTCGTAGGTTGTATGGTT 7 2
mmu-let-7c-1_precursor NGAGGTGGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGAGCTAGTAGGTTGTATGG 8 2
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTAT 2 10
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGATTT 67 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGATTA 51 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGATTG 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTTTGG 2 3
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGTTT 2 2
mmu-let-7c-1_precursor TNAGGTAGGAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATG 10140 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTACGGTT 2 3
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGTAT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGT 114 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGA 3 7
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTG 4 2
mmu-let-7c-1_precursor GTTAGTAGGTTGTATGGTT 2 4
mmu-let-7c-1_precursor CTGTACAACCTTCTAGCTTTC 4 1
mmu-let-7c-1_precursor TGAGGGAGNAGGTTGTATGGT 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGG 63 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTACGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGT 2 5
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTTC 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTT 91 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTC 28 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTA 52 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTG 3 3
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7c-1_precursor TTGAGGTAGTAGNTTGTATGGT 14 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTGTGGTTTA 94 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTGA 10 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTT 4543 17
mmu-let-7c-1_precursor TNAGGTAGTAGGCTGTATGGT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGG 33 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGA 2 7
mmu-let-7c-1_precursor GAGTTAGTAGGTTGTATGGT 9 2
mmu-let-7c-1_precursor NGTAGGTTGTATGGTT 4 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTCAAA 3 1
mmu-let-7c-1_precursor TTAGGTAGTAGGTAGTATGGTT 4 2
mmu-let-7c-1_precursor TGTAGTAGGTTGTATGGTTAA 2 3
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGT 1871 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGA 43 7
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGCTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGATNGTATGGTT 2 4
mmu-let-7c-1_precursor TGATNTAGTAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATCGTT 442 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATCGTC 4 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATCGTA 5 5
mmu-let-7c-1_precursor AGTAGGTTGTATGGTAT 2 14
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGGTTT 47 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGGTTG 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGGTTA 24 2
mmu-let-7c-1_precursor GAGGTCGTAGGTTGTGTGGTTTA 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGAT 62 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGAG 35 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGAC 14 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGAA 262 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTT 14 15
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTTTGGTT 23 3
mmu-let-7c-1_precursor TCAGGTAGTAGGATGTATGGTT 2 2
mmu-let-7c-1_precursor TNAGGTATTAGGTTGTATGGTTT 4 2
mmu-let-7c-1_precursor TGANGTATTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGGTAA 3 1
mmu-let-7c-1_precursor TNGAGGTAGTAGGTTGTATGGTTAA 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTGGG 3 18
mmu-let-7c-1_precursor TGAGGTAGTATGTTGTGTGGTTTA 4 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGTTT 83 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGTTA 62 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGTTG 10 2
mmu-let-7c-1_precursor TGAGGTAGTAGTTTTTATGGTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATG 10 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGGTA 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTATATGGTT 271 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTACGGTA 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTCT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATCG 5 4
mmu-let-7c-1_precursor GAGGTAGTAGCTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTGTGGTTTA 59 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTAAAG 41 1
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGTTGA 2 1
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGT 26 2
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGA 3 11
mmu-let-7c-1_precursor GAGGTAGTNGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTGGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGTTAGTAGCTTGTATGGTT 3 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTGTGGTTTA 28 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTTAT 2 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATTGTT 7 5
mmu-let-7c-1_precursor TGAGGTAGGAGGCTGTATGGTT 2 3
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATG 15 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGATGGT 23 2
mmu-let-7c-1_precursor TGAGGTGGTTGGTTGTATGGTT 2 9
mmu-let-7c-1_precursor TGNGGTGGTAGGTTGTATGGTT 7 2
mmu-let-7c-1_precursor GCCTGAGGTAGTAGGTTGTATGG 3 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGCATGGTT 18 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTTGA 3 1
mmu-let-7c-1_precursor TGAGGGAGTAGATTGTATGGTT 2 4
mmu-let-7c-1_precursor TAGGTTGTATGGTTT 21 9
mmu-let-7c-1_precursor TNGTAGGTTGTGTGGTTTA 2 9
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTGTGGTT 5 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTA 1021 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTC 19 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNCGTATGGTT 4 2
mmu-let-7c-1_precursor GTTGAGGTAGTANGTTGTATGGT 4 1
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGTTGA 3 1
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGTTG 5 2
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGTTA 86 2
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGGTTT 99 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTA 52 4
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTGTGGTTTA 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATGGT 37 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATGGA 4 2
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTGTGGTTTAG 8 1
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTGTGGTTTAG 2 1
mmu-let-7c-1_precursor TNAGGCAGTAGGTTGTATGGT 4 2
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATGGTTA 17 2
mmu-let-7c-1_precursor TGTAGTAGGTTGTATGGTAT 3 13
mmu-let-7c-1_precursor GAGGTAGTAGTTTGTATGGTT 13 3
mmu-let-7c-1_precursor TNAGTTAGTAGGTTGTATG 2 4
mmu-let-7c-1_precursor TGGGGTATTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor CTGAGGTAGTAGGTTGTATGGTAT 3 2
mmu-let-7c-1_precursor GGTNGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATG 71 2
mmu-let-7c-1_precursor GAGGTCGTAGGTTGTATGGT 31 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGT 1907 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGA 35 2
mmu-let-7c-1_precursor TAGAGGTAGTAGGTTGTATGGT 2 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTGGTATGGT 2 2
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGT 65 2
mmu-let-7c-1_precursor TGAGGTAGTCGCTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAAGTAGTAGGTNGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGTTTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTNGTATGGTTA 17 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTTGA 6 1
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGTTTT 3 2
mmu-let-7c-1_precursor TGCGGTAGTAGGNTGTATGGTT 3 2
mmu-let-7c-1_precursor GGTAGTAGATTGTATGGTT 3 5
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATG 7 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTT 10458 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTTAAGA 4 1
mmu-let-7c-1_precursor TAGTAGGTTGTANGGTT 6 3
mmu-let-7c-1_precursor AGTAGGTTGTATGGTTA 42 16
mmu-let-7c-1_precursor AGTAGGTTGTATGGTTG 4 18
mmu-let-7c-1_precursor AGTAGGTTGTATGGTTT 65 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTTA 31 1
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTTG 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGGTTTC 2 3
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTTAA 6 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGCATGGT 85 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTATA 2 1
mmu-let-7c-1_precursor TTNAGGTAGTAGGTTGTATGGTTT 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTGTGGTTTAGA 2 1
mmu-let-7c-1_precursor TGAGGAAGNAGGTTGTATGGTT 7 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGGA 3 4
mmu-let-7c-1_precursor CTGAGGTAGTAGGTTGTATGGTTAA 4 1
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTTAAG 8 1
mmu-let-7c-1_precursor TNAGGTAGTACGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATTGTT 16 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGG 78 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGCATGGTT 3 2
mmu-let-7c-1_precursor GTGGTAGTAGGTTGTATGGTTA 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGCATGGTT 2 2
mmu-let-7c-1_precursor GCGGTAGTAGGTTGTATGGTTT 13 2
mmu-let-7c-1_precursor GCGGTAGTAGGTTGTATGGTTA 10 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGGTTGA 10 1
mmu-let-7c-1_precursor TNAGGTAGTATGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGTT 3 4
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGGTTTA 3 1
mmu-let-7c-1_precursor TGAGGGCGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGAGGTAGGTTGTATGGT 5 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGCGGTTTAG 2 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGGT 46 3
mmu-let-7c-1_precursor TGGTAGGTTGTATGGTT 5 24
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGG 12 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGA 2 14
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGTTTAA 3 1
mmu-let-7c-1_precursor TNATGTAGTAGGTTGTATGGTT 29 3
mmu-let-7c-1_precursor TNAGGTAGCAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGANGTAGCAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTTAG 5 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTTAA 16 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTTAT 12 1
mmu-let-7c-1_precursor NGACGTAGTAGGTTGTATGGTT 13 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTTTAA 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTTA 104 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGAATGGTTT 80 2
mmu-let-7c-1_precursor GAGGTAGTAGGCTGTATGGTT 25 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGCTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTGTGGTTTA 21 2
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTAT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTGTGGTTTAGA 2 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTTTAAA 9 3
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGTAT 2 2
mmu-let-7c-1_precursor CNGAGGTAGTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATGGTAA 3 1
mmu-let-7c-1_precursor TGAGATAGTAGGTTGTATGGTTAA 5 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTT 13922 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTA 143 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTC 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTG 4 2
mmu-let-7c-1_precursor TAAGGTGGTAGGTTGTATGGTT 2 3
mmu-let-7c-1_precursor TGAGGAATTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTT 1184 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTTA 155 3
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTTC 3 3
mmu-let-7c-1_precursor TGAGGGGGTAGGTTGTATGGTTT 3 3
mmu-let-7c-1_precursor TGNGGTAGAAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAGTGGTTTA 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTGC 18 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTGA 321 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTGG 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTGT 249 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTGT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTAAA 978 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTCTGGTT 6 3
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTAT 4 12
mmu-let-7c-1_precursor GTAGGTTGTATGNTTT 3 10
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGG 16 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGA 4 5
mmu-let-7c-1_precursor GAGGTTGGAGGTTGTATGGTT 2 9
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTAC 4 1
mmu-let-7c-1_precursor GTAGGTTGTATGGTTTA 8 2
mmu-let-7c-1_precursor GNTAGTAGGTTGTATGGTTA 6 2
mmu-let-7c-1_precursor GNTAGTAGGTTGTATGGTTT 7 2
mmu-let-7c-1_precursor GAGGTAGCAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATTGTT 7 5
mmu-let-7c-1_precursor TGAGGTAGTCGGGTGTATGGTT 2 3
mmu-let-7c-1_precursor GTAGGTTGTATGGTTGA 3 17
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCAGGTT 2 5
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGCATGGTT 36 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTATAA 2 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTNTATGG 3 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTNTATGA 2 5
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGTTT 14 3
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTAT 2 5
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATTGTTT 6 5
mmu-let-7c-1_precursor GAGGTCGTAGGTTGTATGGTTT 15 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTCTA 2 1
mmu-let-7c-1_precursor GAGGTCGTAGGTTGTATGGTTA 10 2
mmu-let-7c-1_precursor CGAGGTAGTAGGNTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGGAGGTTGTATGGGT 2 4
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTCTGG 11 4
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTGTGGTTTAG 9 1
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGTATGGTTC 5 3
mmu-let-7c-1_precursor GTAGTAGGTTGTATGNTT 2 2
mmu-let-7c-1_precursor TCAGNTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGCATGGTTT 2 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGGTGTATGGT 7 1
mmu-let-7c-1_precursor TGAGGTAGTANCTTGTATGGTTT 251 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTAA 1257 1
mmu-let-7c-1_precursor TGAGGTAGTAAGTTGTATTGTTTA 49 3
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATG 31 5
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTAT 233 2
mmu-let-7c-1_precursor GAGGTAGTAGNATGTATGGTTT 4 2
mmu-let-7c-1_precursor TACGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTANATTGTATG 10 9
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGGTTA 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTGAGA 17 1
mmu-let-7c-1_precursor NGGGGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATGGTTAA 14 1
mmu-let-7c-1_precursor GGNAGTAGGTTGTATGGTT 13 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTTA 37 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTTG 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGNTA 6 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTAT 27 4
mmu-let-7c-1_precursor TGACGTAGTNGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGTT 860 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGTC 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGTA 6 7
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGG 27 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTAA 8 21
mmu-let-7c-1_precursor GANGTAGTAGGTTGTATGG 3 2
mmu-let-7c-1_precursor GAGGTAGTAGNCTGTATG 3 11
mmu-let-7c-1_precursor TGAGGTAGTACGTTGTATGG 9 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTATGA 7 2
mmu-let-7c-1_precursor TGAGGTGTTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTAT 5 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGAT 2 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTAG 2 5
mmu-let-7c-1_precursor GANGTAGTAGGTTGTATGGTT 204 2
mmu-let-7c-1_precursor GANGTAGTAGGTTGTATGGTA 5 3
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGTTT 10 3
mmu-let-7c-1_precursor TGAGGGAGGAGGTTGTATGGTT 17 5
mmu-let-7c-1_precursor TGAGGTAGTACGTTGTATGGTA 3 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGT 415 2
mmu-let-7c-1_precursor TGAGGGAGGAGGTTGTATGGT 4 8
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTGTGGTTTAG 4 1
mmu-let-7c-1_precursor TGAGATAGTAGGTTGNATGGTT 3 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTNTGG 2 3
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor CNGAGGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TAGTAGGTTGTATNGTT 4 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGGT 9 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCGTGGTTTA 10 2
mmu-let-7c-1_precursor TGAGGTAGNAGGCTGTATGGTT 3 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTTT 493 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTTG 43 2
mmu-let-7c-1_precursor AAGGTAGTAGGTTGTATGGTTA 2 3
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTTC 9 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTTA 345 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTG 2 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTCTGGTT 7 3
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTA 14 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTT 1231 2
mmu-let-7c-1_precursor TGCGGTAGCAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTAAGA 2 1
mmu-let-7c-1_precursor NGAGGTAGTAGGTGGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGTTT 204 2
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGTTA 115 2
mmu-let-7c-1_precursor GTAGNAGGTTGTATGG 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGTTG 8 2
mmu-let-7c-1_precursor TGCGGTATTAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGTAT 26 2
mmu-let-7c-1_precursor GAGGTAGTAGATTGTATGGTT 2 4
mmu-let-7c-1_precursor NGAGGCAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGAGT 5 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGG 410 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTCTATGGT 3 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTCTGGTT 4 3
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTGTGGTTTA 95 3
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTTTAA 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCNATGGTT 2 2
mmu-let-7c-1_precursor TGANTTAGTAGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor TGNGGTAGTAGATTGTATGGTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTTTGA 22 2
mmu-let-7c-1_precursor GTNGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTANGTGGTATGGTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGTTTTA 39 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGCTAA 5 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTTTT 84 6
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTNTATGGT 10 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTNTATG 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTG 2 5
mmu-let-7c-1_precursor GAGGTGGTAGGTTGTATGGTT 142 2
mmu-let-7c-1_precursor GAGGTGGTAGGTTGTATGGTA 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTTC 2 2
mmu-let-7c-1_precursor TGAGGGATTAGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGG 10 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTA 227 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTT 334 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTC 4 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTG 20 2
mmu-let-7c-1_precursor GTTGAGGTAGTAGTTTGTATGGT 4 2
mmu-let-7c-1_precursor TGAGNTACTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTTAG 2 1
mmu-let-7c-1_precursor CNAGGTAGTAGGTTGTATGGTT 16 2
mmu-let-7c-1_precursor TGAGGTAGTNGCTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTATTAGGTGGTATGGT 3 8
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTTA 23 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTAAGA 2 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGCATGGTTT 6 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGTT 56 2
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGGTTG 3 3
mmu-let-7c-1_precursor TNAGGTAGTAGGTTTTATGGTTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTATGGTAT 2 2
mmu-let-7c-1_precursor TTAGGTATTAGGTTGTATGGTT 9 3
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGG 79 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGA 3 7
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTGTGGTTTAG 19 1
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGT 59 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTAT 5 2
mmu-let-7c-1_precursor TGANGCAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor CTGAGGTAGTNGGTTGTATGGT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTA 19 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGATA 6 3
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGAT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNA 9 5
mmu-let-7c-1_precursor TGAGNTGGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor TCCGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTTTGGTT 5 3
mmu-let-7c-1_precursor TGANGTAGTGGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor GAGGTCGTAGGTTGTATG 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAT 3400 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGATT 2 2
mmu-let-7c-1_precursor TGAGGTATTAGGTGGTATGGTT 2 5
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGTT 2 6
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGTTAA 218 1
mmu-let-7c-1_precursor GAGGGAGTAGGTTNTATGGTT 5 3
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGTTAA 8 1
mmu-let-7c-1_precursor GTAGTAGGTTGTATGGTTAG 2 9
mmu-let-7c-1_precursor TGAGNTAGCAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTCTGGTT 5 3
mmu-let-7c-1_precursor GANGTAGTAGGTTGTATGGTTA 19 2
mmu-let-7c-1_precursor TNGTAGGTTGTATGGTT 25 4
mmu-let-7c-1_precursor TGAGGTAGTATGTTGTATGG 14 2
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGTTTA 2 1
mmu-let-7c-1_precursor TGAGGTACTAGTTTGTATGGTT 2 3
mmu-let-7c-1_precursor GAGGNAGTCGGTTGTATGGTTT 9 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTG 3 23
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGNTT 10 2
mmu-let-7c-1_precursor TANGTAGTAGGTTGTATGGTT 7 2
mmu-let-7c-1_precursor TTGAGGTAGTNCGTTGTATGGTT 4 1
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTT 2402 3
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTA 35 6
mmu-let-7c-1_precursor TCGTAGGTTGTATGGTT 2 7
mmu-let-7c-1_precursor AGNTAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGATGTATGGTTAA 24 1
mmu-let-7c-1_precursor TGAGGTAGTANGTTGT 2 12
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTAT 5 11
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTTAA 55 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTAT 19 5
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTAA 3 28
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGAT 19 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGAA 17 4
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGNATGGTT 4 3
mmu-let-7c-1_precursor CGATGTAGTAGGTTGTATGGTT 6 3
mmu-let-7c-1_precursor NTGAGGTAGTAGGTTGTATGGTT 14 2
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTATG 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGCCGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAATGT 4 14
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGTTTAT 3 1
mmu-let-7c-1_precursor GAGGTAGTAGGCTGTATGG 2 4
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGCTT 3 2
mmu-let-7c-1_precursor TGAGGGTGTAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTTTGGT 2 4
mmu-let-7c-1_precursor CTGCGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGA 15 3
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGT 4 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTTTATGGTT 88 2
mmu-let-7c-1_precursor GAGGCAGTAGGTTGTATGGT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTG 681 10
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTCTGGTTT 10 3
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTGTGGTTTA 10 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTCTGGTTA 12 3
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTAT 5 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGCATGG 2 9
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGGT 23 2
mmu-let-7c-1_precursor TGAGGTAGNAGGTTGTATGGC 3 3
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGTTT 28 2
mmu-let-7c-1_precursor TGGAGGTAGTAGGTTGTATGG 3 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTAAG 6 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGT 43 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGA 3 6
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATG 24 2
mmu-let-7c-1_precursor GTAGTAGGTTGTGTGGTTAA 66 5
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGATT 3 2
mmu-let-7c-1_precursor TGGGGTAGTGGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGA 12 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTGTGGTATA 3 2
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATGGA 3 1
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATGGT 290 1
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTAAGA 2 1
mmu-let-7c-1_precursor TGNGGTAGTAGTTTGTATGGT 2 4
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGTT 612 2
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGTA 8 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTT 1306 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTG 8 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTC 2 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTA 112 1
mmu-let-7c-1_precursor TGCGCTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGAGGTACTNGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGGTAT 2 3
mmu-let-7c-1_precursor TGGTATTAGGTTGTATGGTT 2 13
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTT 3283 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTG 16 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTGTGGTTTAG 4 1
mmu-let-7c-1_precursor TAAGCTAGTAGGTTGTATGGTT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAAAGT 3 1
mmu-let-7c-1_precursor TGAGGGCGTAGGTTGTATGGTT 14 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTGGTATGA 2 11
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTT 2902 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTA 44 2
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTAT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTTAA 54 3
mmu-let-7c-1_precursor TGAGGGAGTAAGTTGTATGGTT 2 6
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATG 41 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGTTTA 2 1
mmu-let-7c-1_precursor TGAGGGAGTAGGCTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGCGGTCGTAGGTTGTATG 3 3
mmu-let-7c-1_precursor GGTNGTAGGTTGTATGGTT 17 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATG 20 8
mmu-let-7c-1_precursor TGAGGTAGTATGTTGTATGGTA 4 2
mmu-let-7c-1_precursor TGCGGGAGTAGGTTGTATGGT 2 3
mmu-let-7c-1_precursor TGCGGTAGTAGGCTGTATGGTT 17 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGGTAA 4 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTCG 4 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTACGGTT 2 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGTTTC 2 3
mmu-let-7c-1_precursor CTGNGGTAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTA 1390 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTC 22 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTG 115 2
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTT 2067 2
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGGTAT 2 3
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATGTTTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATGGTTT 36 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATGGTTC 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATGGTTA 21 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTG 12 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGNTGTATGGT 5 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTC 3 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTTT 213 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTNTGTGGTTTA 2 3
mmu-let-7c-1_precursor TGGNGTAGTAGGTTGTATGGTT 3860 2
mmu-let-7c-1_precursor TGAGNCAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTTA 179 3
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTTC 3 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTTT 259 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGGTTG 19 3
mmu-let-7c-1_precursor TGAGTTAGTAGGTTGTAT 2 8
mmu-let-7c-1_precursor GAGGTAGTAGNATGTATGGTT 21 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTAT 6 4
mmu-let-7c-1_precursor NGAGGTAGCAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TNCGGTAGTAGGTTGTATGGTT 4 2
mmu-let-7c-1_precursor GAGGCAGTAGGTTGTATGGTTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGANTGTATGGTT 3 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTAGTATGGTTG 17 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTCTGG 4 4
mmu-let-7c-1_precursor TGATGTAGGAGGTTGTATGGTT 2 4
mmu-let-7c-1_precursor TCGGTAGTAGGTTGTATGGTT 2 4
mmu-let-7c-1_precursor TGATGAGGTAGTAGGTTGTATGGTT 2 3
mmu-let-7c-1_precursor TGAGNTAGTAGTTTGTATGGTT 3 3
mmu-let-7c-1_precursor CTGAGGTAGTAGGTTGTATGGTT 243 2
mmu-let-7c-1_precursor CTGAGGTAGTAGGTTGTATGGTA 5 2
mmu-let-7c-1_precursor TNGGGTAGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTTG 3 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTTA 25 1
mmu-let-7c-1_precursor GGTAGTAGGTTGTGTGGTTAA 40 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGTT 2 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATTGT 2 5
mmu-let-7c-1_precursor TGAGGTAGTTGGTTGTATGGT 22 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATCGT 2 4
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGTTT 32 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGTTTT 3 3
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGGTT 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTTAA 5 1
mmu-let-7c-1_precursor CGATGAGGTAGTAGGTTGTATGGTT 2 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGGTT 232 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGGTA 4 3
mmu-let-7c-1_precursor TGGTAGTAGGTTGTATGG 3 7
mmu-let-7c-1_precursor TTGGGGTAGTAGGTTGTATGGT 13 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTCGTATGGTTTA 8 1
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTT 8109 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTG 5 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTA 108 3
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTA 4 12
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGTTT 66 2
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGGTTA 25 2
mmu-let-7c-1_precursor TGCGGTGGTAGGTTGTATGGT 6 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGTTT 28 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATTGT 7 5
mmu-let-7c-1_precursor TGAGGTAGTAAGNTGTATGGTT 2 3
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTTTGGT 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTTT 118 10
mmu-let-7c-1_precursor GGTAGTAGGTTGTATNGTT 34 4
mmu-let-7c-1_precursor TGGGGTAGTCGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TTGAGGTAGTNGGTTGTATGGT 3 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTTGA 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATGATT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTACGTT 7 3
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGGATGGT 18 2
mmu-let-7c-1_precursor TNGAGGTAGTAGGTTGTATGG 7 1
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGT 9 10
mmu-let-7c-1_precursor CGAGGGAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor CGAGGTACTAGGTTGTATGGTT 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGA 3073 1
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATGGTTC 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGG 37 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTGC 147 3
mmu-let-7c-1_precursor GAGGTAGTAGGTTATATGGTA 2 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATC 2 4
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGTT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTNTATGGTA 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTNTATGGTT 135 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATG 6 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGTATGG 51 3
mmu-let-7c-1_precursor GTAGTAGGTTGTTTGGTTT 2 10
mmu-let-7c-1_precursor GAGGTCGTAGGTTGTATGG 4 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTCTATGGTTT 5 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTCTATGGTTA 2 2
mmu-let-7c-1_precursor TAGGTAGTAGGTTGTATGGGT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGGT 2 4
mmu-let-7c-1_precursor TGAGGTAGTANATTGTATGG 58 5
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTAAG 13 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTAAA 69 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTTAAC 9 1
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTC 2 4
mmu-let-7c-1_precursor TNAGGTACTAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTCTATGGTT 28 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGG 9 3
mmu-let-7c-1_precursor GAGGCAGTAGGTTGTATGGTT 22 2
mmu-let-7c-1_precursor NGAGGTAGTAGGTCGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTGTA 6 2
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGTATG 4 3
mmu-let-7c-1_precursor TGAGGGAGTAGGTTTTATGGTT 6 3
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGTTG 2 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTCTG 3 5
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGTTA 34 2
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGTTC 2 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGCATGGTT 3 4
mmu-let-7c-1_precursor TGGTAGTAGGTTGTATGGTTA 6 2
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATGGTTA 10 1
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGTATGGTTT 12 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTTTTATGGT 5 3
mmu-let-7c-1_precursor GAGGGAGTAGGTTGTATGGA 2 17
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTAT 7 9
mmu-let-7c-1_precursor TGCGGTAGTAGGGTGTATGGTT 4 3
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGGCT 2 3
mmu-let-7c-1_precursor TGGTAGTAGGTTGTANGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTC 26 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTT 2132 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTG 121 2
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGGTTT 26 2
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGGTTA 30 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGNATGGTT 2 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTGTGGTTTA 8 2
mmu-let-7c-1_precursor GAGCTAGTAGGTTGTATGGTT 30 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTAA 68 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTAG 13 1
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGAATGGT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTT 233409 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTN 74 2
mmu-let-7c-1_precursor TAGTAGGTTGTATGGNTA 2 11
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTC 3449 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTTAAA 3 1
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGAATGG 19 4
mmu-let-7c-1_precursor TGGGGTTGTAGGTTGTATGGT 2 6
mmu-let-7c-1_precursor AGGTAGTAGGTCGTATGGTT 2 2
mmu-let-7c-1_precursor GACNTAGTAGGTTGTATGGTT 7 4
mmu-let-7c-1_precursor GAGGTACTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTTTA 11 1
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTATGGTTTG 2 4
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGGTTG 10 2
mmu-let-7c-1_precursor TGTNGTAGTAGGTTGTATG 2 7
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGG 177 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGT 4 2
mmu-let-7c-1_precursor TGATGTAGTAGGTAGTATGGTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGTTTGGATGGTT 2 3
mmu-let-7c-1_precursor GATGTAGTAGGTTGTATGGTT 27 3
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATGG 12 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTGTGGTTTAG 4 1
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTTAAG 17 1
mmu-let-7c-1_precursor TGAGGTATTAGCTTGTATGGTT 2 3
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGG 25 2
mmu-let-7c-1_precursor TGATGTAGTAGGTTGTATGGTTT 211 2
mmu-let-7c-1_precursor TGTAGTAGGTTGTATGGTT 269 5
mmu-let-7c-1_precursor TGAGGTGGTAGGCTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGCTT 2 2
mmu-let-7c-1_precursor TGTAGTAGGTTGTATGGTA 3 45
mmu-let-7c-1_precursor TCAGTTAGTAGGTTGTATGGTT 2 5
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTT 16608 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTC 2 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATGGTA 206 2
mmu-let-7c-1_precursor CTTGAGGTAGTAGGTTGTATGGTT 2 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTA 10 18
mmu-let-7c-1_precursor TTAGGTAGTACGTTGTATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGGTGTATG 2 3
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTTAG 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTTGA 5 1
mmu-let-7c-1_precursor TGAGGAAGNAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTTAT 4 1
mmu-let-7c-1_precursor TGAGGTTGTAGGTTGTATGGTTT 17 2
mmu-let-7c-1_precursor GTAGTAGGTTGTNTGGTT 8 3
mmu-let-7c-1_precursor GAGGTAGTAGGGTGTCTGGT 2 10
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGCTTTG 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTATAGA 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAAGGTTA 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTAT 41 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTNTGGTTAA 10 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATCGTAT 2 5
mmu-let-7c-1_precursor TTGAGCTAGTAGGTTGTATGGT 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTAT 12 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGCATGGTT 8 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTGTGGTTTA 106 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTT 14316 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTG 7 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTA 157 2
mmu-let-7c-1_precursor GATAGTAGGTTGTATGGTT 4 3
mmu-let-7c-1_precursor TGGTAGTAGGTTGTATGGT 15 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGC 2 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGT 679 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTATGGA 9 2
mmu-let-7c-1_precursor TAGGTAGTAGGTNGTATGGTT 8 2
mmu-let-7c-1_precursor GTAGTAGGTTGTA 2 45
mmu-let-7c-1_precursor GAGGTAGGAGGTTGTATGGTTT 3 2
mmu-let-7c-1_precursor TGAGGTGGTAGGNTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATGGTTTAA 16 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTTTGGTTGA 12 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGT 143 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGCATGGA 5 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGGT 107 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGGA 5 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGTTTT 2 2
mmu-let-7c-1_precursor GGAGGTAGTAGGTTGTATGGTTAA 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAAG 38 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAAC 2 30
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGGTTAA 259 1
mmu-let-7c-1_precursor TGAGGTAGTAAGTTGTATGGTT 126 3
mmu-let-7c-1_precursor TGAGGTAGTAAGTTGTATGGTA 6 4
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGT 822 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGA 1099 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGC 51 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGG 41793 2
mmu-let-7c-1_precursor GNAGGTTGTATGGTT 169 15
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTA 17 5
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTATG 37 3
mmu-let-7c-1_precursor AGAGGTAGTAGGTTGTATGGTTG 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGGTTAA 17 1
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTATGGTTTAT 3 1
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGTAGGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAGAT 5 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAAGAA 4 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTG 33 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTC 18 2
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGGA 13 2
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATG 3 4
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTAGGGTT 2 2
mmu-let-7c-1_precursor GGCAGTAGGTTGTATGGTT 6 3
mmu-let-7c-1_precursor TGAGTTAGTAGGTGGTATGGTT 3 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTA 208 1
mmu-let-7c-1_precursor TNACGTAGTAGGTTGTATGGT 2 3
mmu-let-7c-1_precursor GAGTTAGTAGGTTGTATGGTTA 2 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTG 37 3
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTT 733 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTC 13 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTTA 473 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTT 5135 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTATGGTC 7 2
mmu-let-7c-1_precursor GTTNAGGTAGTAGGTTGTATGGT 3 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGCTT 7 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGATT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTTAT 4 1
mmu-let-7c-1_precursor NGAGGTAGTAGGTTGTATGTTT 39 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGTTTTAA 8 1
mmu-let-7c-1_precursor TCAGGTAGTAGGTTGTATGT 2 12
mmu-let-7c-1_precursor TCAGGCAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGATTGCATGGTT 25 5
mmu-let-7c-1_precursor GAGGTAGTANGTTGTATGGT 36 2
mmu-let-7c-1_precursor TTGAGGTATTAGGTTGTATGGTT 2 1
mmu-let-7c-1_precursor GANGTAGTAGGTTGTATGGT 39 2
mmu-let-7c-1_precursor TGNGGTAGTAGGTTTTATGGTT 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGAT 88 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGAG 12 4
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTATA 2 1
mmu-let-7c-1_precursor TGAGGGCGTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGCT 14 3
mmu-let-7c-1_precursor TGAGGTAGTANCTTGTAT 6 26
mmu-let-7c-1_precursor TGAGGGAGTAGGTNGTATGGTT 2 3
mmu-let-7c-1_precursor TNGAGGTAGTAGGTTGTATGGT 47 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTCTGTTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGTTAA 240 1
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTATGTTTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGNTT 17 2
mmu-let-7c-1_precursor AGTAGGTTGTATGGTTAA 17 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATTG 2 6
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTTTGGTT 5 3
mmu-let-7c-1_precursor GAGGTAGTAGNGTGTATGGTT 38 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGTTC 5 5
mmu-let-7c-1_precursor TTGAGTTAGTAGGTTGTATGGTT 5 1
mmu-let-7c-1_precursor TAGGAGGTTGTATGGTTT 2 8
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTACGGTT 2 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGAATGGT 14 5
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGNATGGT 3 2
mmu-let-7c-1_precursor TAAGGTAGTAGGTTGTGTGGTTTAGA 2 1
mmu-let-7c-1_precursor TGNGGTAGTAGGTTGTATTGTTT 2 4
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGGCT 2 2
mmu-let-7c-1_precursor AGAGGTAGTAGGTTGTATGGTTAA 6 1
mmu-let-7c-1_precursor TTGNGGTAGTAGGTTGTATGGT 10 1
mmu-let-7c-1_precursor GTAGTAGGTTGTANGGTT 5 2
mmu-let-7c-1_precursor TGAGGTAGTCGGTTGTCTGGTT 10 3
mmu-let-7c-1_precursor TGGNGTAGTAGGTTGTAT 9 14
mmu-let-7c-1_precursor GAGNTAGTAGGTTGTATG 5 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTATGGGT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTTAAGA 2 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNTTGGTT 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATT 10 5
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGGT 25 3
mmu-let-7c-1_precursor TGAGGTCGNAGGTTGTATGGTT 14 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTATA 33 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTATC 26 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTATG 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGATGGTT 108 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGGATGGTA 4 3
mmu-let-7c-1_precursor TGAGGGAGTAGGCTGTATGGT 2 6
mmu-let-7c-1_precursor GNGGTAGTAGGTTGTATGTT 3 4
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTTAT 16 1
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTTAG 6 1
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTTAA 17 1
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTATGGTTTAC 3 1
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGGTTTAAA 8 1
mmu-let-7c-1_precursor TGCGGTATTAGGTTGTATGGT 2 2
mmu-let-7c-1_precursor TGCGGTACTAGGTTGTATGGTT 6 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGNATGGTTAAG 14 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTGTAT 2 1
mmu-let-7c-1_precursor TAGTAGGTTGTATGGTAT 4 5
mmu-let-7c-1_precursor GTAGTAGGTTGTGTGGTTAAG 6 3
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTT 3598 2
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTA 41 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTTTGGTT 12 3
mmu-let-7c-1_precursor TGAGGTAGTGGGTTGAATGGTT 2 2
mmu-let-7c-1_precursor TGAGGTACTAGGTTGTATGTTT 4 2
mmu-let-7c-1_precursor TAACGTAGTAGGTTGTATGGTT 2 3
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTT 1133 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTG 65 3
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTC 14 2
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGTTA 762 2
mmu-let-7c-1_precursor GAGGTAGTAGGTNGTATG 3 2
mmu-let-7c-1_precursor TNGTAGTAGGTTGTATGGTT 6 4
mmu-let-7c-1_precursor TGAAGTAGTAGGTTGTATGGTTAA 14 1
mmu-let-7c-1_precursor TGAGGTAGTAGCTNGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGTTTTAGA 4 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGTTTA 4 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGTTTG 2 5
mmu-let-7c-1_precursor TGAGGTAGTAGATTGTATGGTTAA 58 1
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGGT 1088 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGG 232 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGA 4 1
mmu-let-7c-1_precursor GAGGTAGTAGGGTGTCTGGTT 17 3
mmu-let-7c-1_precursor TGTGNTAGTAGGTTGTATGGTTT 2 2
mmu-let-7c-1_precursor GNTAGTAGGTTGTATGGTT 70 2
mmu-let-7c-1_precursor TGAGGTAGTANGTTGTATGGTAT 12 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTTTATGGTT 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTAC 37 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGCTTTA 7 2
mmu-let-7c-1_precursor TGAGGTGGTAGGTTGTGTGGTTTA 7 2
mmu-let-7c-1_precursor CTGGGGTAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGTTG 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGTTT 63 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGAATGGTTA 44 2
mmu-let-7c-1_precursor TGAGGTAGTAGCTTGCATGGTTT 3 2
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGTTGT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGT 13 10
mmu-let-7c-1_precursor TGAGGTAGCAGGTTGTATTGTT 4 7
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTTAAA 5 1
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTCTG 5 9
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTACGGTT 2 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTNGTATGTT 9 2
mmu-let-7c-1_precursor TGTGGTAGTAGGTTGTATGGA 2 5
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTA 12 6
mmu-let-7c-1_precursor GTTGAGGTAGTAGGTTGCATGGTT 2 1
mmu-let-7c-1_precursor AGAGGTAGTAGGTTGTGTGGTTTA 2 2
mmu-let-7c-1_precursor TGAGGAAGTAGGTTGTATGGCT 2 3
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTAC 2 4
mmu-let-7c-1_precursor GAGGTAGTAGNGTGTATGGTTT 4 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAGGGTTAA 4 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTACGGTT 17 2
mmu-let-7c-1_precursor TAGTAGGTTGNATGGTT 3 4
mmu-let-7c-1_precursor CAGAGGTAGTAGGTTGTATGGTT 2 2
mmu-let-7c-1_precursor NGAGGTAGTAGCTTGTATGGTT 15 2
mmu-let-7c-1_precursor TGGGGTAGTAGGTTGTTTGGTTT 4 3
mmu-let-7c-1_precursor TGANGTAGTAGGTTGTATGTTT 13 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGCATGGTT 2 2
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGNATGGTT 4 2
mmu-let-7c-1_precursor AGGTAGTAGGTTGTATGGTTAAA 4 1
mmu-let-7c-1_precursor TGNGGTAGTAGGTTG 8 16
mmu-let-7c-1_precursor GNAGGTTGTATGGTTT 18 8
mmu-let-7c-1_precursor TTAGGTAGTAGGNTGTATGGT 3 2
mmu-let-7c-1_precursor GTAGTAGGTTGTGTGGTTTA 5 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTTAAGA 602 1
mmu-let-7c-1_precursor TGTNGTAGTAGGTTGTATGGTTT 15 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTTAGA 2 1
mmu-let-7c-1_precursor TGCGGTAGTAGATTGTATGGTT 3 4
mmu-let-7c-1_precursor TGAGGAAGTCGGTTGTATGGTT 5 2
mmu-let-7c-1_precursor TGAGNTAGTAGGTTGTGTGGTTTAG 8 1
mmu-let-7c-1_precursor TGAGGTAATAGGNTGTATGGTT 2 2
mmu-let-7c-1_precursor GGGGTAGTAGGTTGTATGGTTAAG 2 1
mmu-let-7c-1_precursor TTGAGGTAGTAGGTTGTATGGAA 4 1
mmu-let-7c-1_precursor TGGGGTAGGAGGTTGTATGGTT 7 5
mmu-let-7c-1_precursor TGATGTAGTNGGTTGTATGGTT 9 3
mmu-let-7c-1_precursor CGAGGTAGTAGGTTGTATGGA 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGCTGTGTGGTTTA 44 2
mmu-let-7c-1_precursor GAGTTAGTAGGTTGTATGGTT 40 2
mmu-let-7c-1_precursor TGCNGTAGTAGGTTGTATGGT 124 2
mmu-let-7c-1_precursor TGAGGTAGTAGGNTGTATCGTTT 2 4
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGCT 2 2
mmu-let-7c-1_precursor TGACGTAGTAGGCTGTATGGTT 4 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTAGTATGGT 2 2
mmu-let-7c-1_precursor TGCGGTAGTAGGTTGTACGGTTT 2 2
mmu-let-7c-1_precursor TGAGATAGTAGGTTGTATGGT 39 3
mmu-let-7c-1_precursor GAAGTAGTAGGTTGTATGGTT 25 2
mmu-let-7c-1_precursor TGACGTAGTAGGTTGNATGGTT 3 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTCTATGGTTTA 3 1
mmu-let-7c-1_precursor NAGGTAGTAGGTTGTATGGT 12 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGGTTT 154 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGGTTA 60 2
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGGTTC 4 2
mmu-let-7c-1_precursor AGTAGGTTGTATGGT 46 6
mmu-let-7c-1_precursor GAGGTAGTAGGTCGTATGGT 12 2
mmu-let-7c-1_precursor TAGTATGTTGTATGGTT 4 24
mmu-let-7c-1_precursor TGAGGTAGTAGGTTTTATGG 17 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAG 7785 2
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAA 28982 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTAC 920 3
mmu-let-7c-1_precursor TGAGGTTGTAGGTTGTATGGTTA 18 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTAAGGTTT 21 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTCGTATGGTT 3 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATGGTTTTTA 8 2
mmu-let-7c-1_precursor TTAGGTAGTNGGTTGTATGGT 2 3
mmu-let-7c-1_precursor TGCGCTAGTAGGTTGTATGGTT 3 2
mmu-let-7c-1_precursor GAGGTAGTAGGTTGTATGGTATC 3 3
mmu-let-7c-1_precursor TGAGGGAGTGGGTTGTATGGTTT 3 3
mmu-let-7c-1_precursor GGAGGTAGTAGGTTGTATGGTTT 14 2
mmu-let-7c-1_precursor GGAGGTAGTAGGTTGTATGGTTA 8 2
mmu-let-7c-1_precursor TGAGGGAGTCGGTTGTATGGT 2 3
mmu-let-7c-1_precursor TGAGTTAGTNGGTTGTATGGTT 9 2
mmu-let-7c-1_precursor TTAGGTAGTAGGTTGTATGGTTGA 4 1
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTATTGTTAA 17 2
mmu-let-7c-1_precursor NAGGTAGTAGGTTGTATGGTT 94 2
mmu-let-7c-1_precursor TGAGGTAGTANTTTGTATGGTT 1286 3
mmu-let-7c-1_precursor TGAGGTAGTNGGTTGTGTGGTTTAG 19 1
mmu-let-7c-1_precursor GNAGTAGGTTGTATGG 2 6
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGT 22 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGG 1754 2
mmu-let-7c-1_precursor TNAGGTAGTAGGTTGTATGA 45 2
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTTAG 7 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTTAT 6 1
mmu-let-7c-1_precursor TGAGGGAGTAGGTTGTATGGTTTAA 13 1
mmu-let-7c-1_precursor TGAGGTCGTAGGTTGTATGGTTAA 14 1
mmu-let-7c-1_precursor TGATNTAGTAGGTTGTATGGTT 12 3
mmu-let-7c-1_precursor TGAGGCAGTAGGTTGTGTGGTTTA 33 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATNGTTT 3 4
mmu-let-7c-1_precursor TGAGGTAGTANTTTGTATGG 34 3
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGTGTGGTGTAG 3 1
mmu-let-7c-1_precursor TAGTAGGTTNTATGGTT 5 5
mmu-let-7c-1_precursor TGAGGTATTAGGTTGTATGTTT 6 3
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTAT 3 2
mmu-let-7c-1_precursor GGTAGTAGGTTGTATGGTAG 2 6
mmu-let-7c-1_precursor TGAGGTAGTAGGTTGATTGGTT 2 8
mmu-let-7c-1_precursor NAAGGTAGTAGGTTGTATGGTTT 5 2