id_rna sequence raw_count mapping_loci
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCT 754 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTC 271 1
mmu-let-7d-3p CTANACGACCTGCTGCCTTTCT 12 1
mmu-let-7d-3p CGATACGACCTGCTGCCTTTCT 7 1
mmu-let-7d-3p CTGTACGACCTGCTGCCTTTCT 4 1
mmu-let-7d-3p CTATACGACCTGCAGCCTTTCT 3 1
mmu-let-7d-3p CCATACGACCTGCTGCCTTTCT 3 1
mmu-let-7d-3p TNTACGACCTGCTGCCTTTCG 2 1
mmu-let-7d-3p TANACGACCTGCTGCCTTTCT 3 1
mmu-let-7d-3p TNTACGACCTGCTGCCTTTCT 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTG 2 1
mmu-let-7d-3p CTATACGACCTGC 31 2
mmu-let-7d-3p CAATACGACCTGCTGCCTTTCA 2 1
mmu-let-7d-3p CTATACGACCTGNTGCCTTTC 2 1
mmu-let-7d-3p CTATACGACCTGCTGNCTTTC 2 1
mmu-let-7d-3p CTNTACGACCTGCTGCCTTTC 3 1
mmu-let-7d-3p CTATACGACCTGCNGCCTTTC 2 1
mmu-let-7d-3p CTATATGACCTGCTGCCTTTC 3 1
mmu-let-7d-3p TATACGACCTGCTGCCTTTCG 6 1
mmu-let-7d-3p TATACGACCTGCTGCCTTTCT 86 1
mmu-let-7d-3p TATACGACCTGCTGCCTTTCA 17 1
mmu-let-7d-3p CTGNACGACCTGCTGCCTTTCT 3 1
mmu-let-7d-3p CGACCTGCTGCCTTTC 2 2
mmu-let-7d-3p TATACGACCTGCTGCNTTTCT 2 1
mmu-let-7d-3p CGATACGACCTGCTGCCTTTC 5 1
mmu-let-7d-3p CTATACGACCTGCNGCCTTTCT 3 1
mmu-let-7d-3p CTNTACGACCTGCTGCCTTTCT 3 1
mmu-let-7d-3p CTATATGACCTGCTGCCTTTCT 5 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCGA 2 1
mmu-let-7d-3p CTATACGACCTGCTGNCTTTCT 6 1
mmu-let-7d-3p CTATACGACCTGCT 2 1
mmu-let-7d-3p CTATACGACCNCCTGCCTTTCT 2 1
mmu-let-7d-3p CTATACGACCTCCTGCCTTTCA 2 1
mmu-let-7d-3p CTATACGACCTCCTGCCTTTCT 4 1
mmu-let-7d-3p CTATACGACCTGNTGCCTTTCT 6 1
mmu-let-7d-3p CTANACGACCTGC 3 22
mmu-let-7d-3p CGACCTGCTGCCTTTCT 3 1
mmu-let-7d-3p CTANACGACCTGCTGCCTTTC 2 1
mmu-let-7d-3p CNATACGACCTGCTGCCTTTCA 5 1
mmu-let-7d-3p CTATACGACCTGTTGCCTTTC 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTGC 2 1
mmu-let-7d-3p CTATACGACCTGCTGCC 3 1
mmu-let-7d-3p CTATAAGACCTGCTGCCTTTCT 3 1
mmu-let-7d-3p TNTACGACCTGCTGCCTTTC 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTGCT 3 1
mmu-let-7d-3p CTATACGACCTGTTGCCTTTCT 2 1
mmu-let-7d-3p CTATACGACCTGCGGCCTTTCA 2 1
mmu-let-7d-3p CTATACGACTTGCTGCCTTTCT 3 1
mmu-let-7d-3p TATACGACCTGCTGCCTTTCTT 7 1
mmu-let-7d-3p TATACGACCTGCTGCCTTTCTG 3 1
mmu-let-7d-3p CTATACGACCTGATGCCTTTCT 2 1
mmu-let-7d-3p CTCTACGACCTGCTGCCTTTCT 4 1
mmu-let-7d-3p CTCTACGACCTGCTGCCTTTCA 2 4
mmu-let-7d-3p CTATACGACCTGCTGCCTT 50 1
mmu-let-7d-3p CTATACGACNTGCTGCCTTTCT 9 1
mmu-let-7d-3p CNATACGACCTGCTGCCTTTCT 33 1
mmu-let-7d-3p CTATACGACCNGCTGCCTTTCT 2 1
mmu-let-7d-3p CTATNCGACCTGCTGCCTTTCT 2 1
mmu-let-7d-3p CTATACGACCTGCCGCCTTTCT 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCTAA 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCTAT 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCTG 13 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCTT 9 1
mmu-let-7d-3p CNATACGACCTGCTGCCTTTC 14 1
mmu-let-7d-3p CTAGACGACCTGCTGCCTTTCT 4 1
mmu-let-7d-3p TATACGACCTGCTGCCTTTC 21 1
mmu-let-7d-3p NTATACGACCTGCTGCCTTTCT 4 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCTGT 3 1
mmu-let-7d-3p CNATACGACCTGC 3 14
mmu-let-7d-3p CTATACGACNTGCTGCCTTTC 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTT 15 1
mmu-let-7d-3p CGATACGACCTGCTGCCTTTCTG 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCCA 3 1
mmu-let-7d-3p TATACGACCTGCTGCCTT 3 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCC 14 1
mmu-let-7d-3p CNATACGACCTGCTGCCTTT 2 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCG 35 1
mmu-let-7d-3p CTATACGACCTGCTGCCTTTCA 117 1
mmu-let-7d-3p CTATAGGACCTGCTGCCTTTCT 7 2