id_rna sequence raw_count mapping_loci
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTT 23708 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGT 5300 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTT 3953 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAG 297 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTT 97 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTA 64 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGTTT 27 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGTTT 20 1
mmu-let-7d_precursor AGGNGTAGTAGGTTGCATAGT 15 1
mmu-let-7d_precursor CTGTACGACCTGCTGCCTTTCT 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTCCATAG 2 2
mmu-let-7d_precursor TAGGTTGCATAGTT 3 19
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGTTA 7 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCCTAGTT 9 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGTTAT 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGTTA 25 1
mmu-let-7d_precursor AGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor GAGGTGGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor CTATACGACCTGCAGCCTTTCT 3 1
mmu-let-7d_precursor ATGTAGTAGGTTGCATAGTT 2 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTC 4 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTG 20 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATACTTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATACTTA 2 1
mmu-let-7d_precursor GTAGTAGGTTGCATAGTT 28 1
mmu-let-7d_precursor AGTGGTAGTAGGTTGCATAGTT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGAATAGTTT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCGTAGTT 16 1
mmu-let-7d_precursor TGGGGTAGTAGGTTGCATAGTTT 2 4
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAG 10 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTGA 6 3
mmu-let-7d_precursor CGATACGACCTGCTGCCTTTCT 7 1
mmu-let-7d_precursor AGAAGTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor CGAGGTAGTAGGTTGCATAGTT 11 1
mmu-let-7d_precursor CTANACGACCTGCTGCCTTTCT 12 1
mmu-let-7d_precursor CCATACGACCTGCTGCCTTTCT 3 1
mmu-let-7d_precursor AGACGTAGTAGGTTGCATAGTT 31 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGT 17 1
mmu-let-7d_precursor TGAGGTGGTAGGTTGCATAGTT 2 5
mmu-let-7d_precursor GAGGTCGTAGGTTGCATAGTT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTGGCATAG 5 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTAA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTCCATAGT 2 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATGGTT 5 3
mmu-let-7d_precursor GAGNTAGTAGGTTGGATAGTT 4 3
mmu-let-7d_precursor AGAGGTAGTAGGTNGCATAGTTAT 3 1
mmu-let-7d_precursor GNGGTAGTAGGTTGCATAGT 3 1
mmu-let-7d_precursor TNTACGACCTGCTGCCTTTCG 2 1
mmu-let-7d_precursor GGTAGTAGGTTGNATAGTT 24 3
mmu-let-7d_precursor AGAGGTAGTANATTGCATAGTT 36 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAT 56 1
mmu-let-7d_precursor ATGTAGTAGGTTGCATAGT 2 2
mmu-let-7d_precursor ACAGGTAGTAGGTTGCATAGTTT 8 1
mmu-let-7d_precursor ACAGGTAGTAGGTTGCATAGTTG 2 1
mmu-let-7d_precursor ACAGGTAGTAGGTTGCATAGTTA 6 1
mmu-let-7d_precursor AGAGNTAGTAGGTTGCATAGTTT 28 1
mmu-let-7d_precursor AGAGNTAGTAGGTTGCATAGTTG 2 1
mmu-let-7d_precursor GNGGTAGTAGGTTGCATAGTTT 3 1
mmu-let-7d_precursor GNGGTAGTAGGTTGCATAGTTA 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTTCATAG 4 2
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTTG 21 1
mmu-let-7d_precursor GAGGTAGTAGGTCGCATAGT 2 1
mmu-let-7d_precursor AGAGGTAGTANATTGCATAG 4 1
mmu-let-7d_precursor AGAGGTAGTANTTTGCATAGTT 18 1
mmu-let-7d_precursor AGAGGTAGTAGGTAGCATAGTT 29 1
mmu-let-7d_precursor GAGGTAGTAGGTCGCATAGTT 2 1
mmu-let-7d_precursor TANACGACCTGCTGCCTTTCT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTC 103 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTA 2261 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTN 3 1
mmu-let-7d_precursor AGAGGTGGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGANGTAGTAGGTTGCATAGTTT 17 1
mmu-let-7d_precursor AGANGTAGTAGGTTGCATAGTTA 6 1
mmu-let-7d_precursor AGAGGTGGTAGGTTGCATAGTT 8 1
mmu-let-7d_precursor GGTAGTAGGTTGCATGGTT 12 3
mmu-let-7d_precursor TGNGGTAGTAGGTTGCATAGTT 2 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGTTG 4 1
mmu-let-7d_precursor AGTAGGTTGCATAGTTA 2 14
mmu-let-7d_precursor AGAGGTAGTANATTGCATAGT 8 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGTTTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTTAT 2 2
mmu-let-7d_precursor TNTACGACCTGCTGCCTTTCT 2 1
mmu-let-7d_precursor GNAGGTTGCATAGTTT 2 4
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATGGTTT 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTG 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTC 271 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTCG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTCT 2 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTAT 3 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAG 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAAA 65 1
mmu-let-7d_precursor AGGAGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGA 8 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGTTC 2 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGTTG 4 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGTTT 36 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAGTTT 14 1
mmu-let-7d_precursor AGAGGTAGTAGCTTGCATAG 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTGGCATAGT 7 1
mmu-let-7d_precursor TGAGGTAGTAGTTTGCATAGTT 6 8
mmu-let-7d_precursor GNAGGTTGCATAGTT 10 15
mmu-let-7d_precursor AGAGGGAGTAGGTTGCAT 3 4
mmu-let-7d_precursor AGTAGGTTGCATAGTT 7 2
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGT 17 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAGTTGGA 2 1
mmu-let-7d_precursor CTATACGACCTGC 31 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATCGTT 4 1
mmu-let-7d_precursor AGAAGTAGTAGGTTGCATAGTT 8 1
mmu-let-7d_precursor CAATACGACCTGCTGCCTTTCA 2 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAGTTT 3 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAGTTA 2 1
mmu-let-7d_precursor CTATACGACCTGNTGCCTTTC 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTNGCAT 2 1
mmu-let-7d_precursor AGACGTAGTAGGTTGCATAGT 5 1
mmu-let-7d_precursor AAGNGGTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor CTATACGACCTGCTGNCTTTC 2 1
mmu-let-7d_precursor AGAGGTAGTAGCTTGCATAGTT 35 1
mmu-let-7d_precursor AGANGTAGTAGGTTGCATAGT 26 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGTT 82 1
mmu-let-7d_precursor AGCNGTAGTAGGTTGCATAGTT 11 1
mmu-let-7d_precursor AGAGGTAGCAGGTTGCATAGT 3 1
mmu-let-7d_precursor GTAGGTTGCATAGT 52 10
mmu-let-7d_precursor AGAGGTAGTAGGTTGCGTAGTTA 2 1
mmu-let-7d_precursor GGGGTAGTAGGTTGCATAGTT 9 1
mmu-let-7d_precursor AGAGNTAGTAGGTTGCATAG 7 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAAAGTT 2 1
mmu-let-7d_precursor GANGTAGTAGGTTGCATAGTT 9 1
mmu-let-7d_precursor AAGNGGTAGTAGGTTGCATAGTT 2 1
mmu-let-7d_precursor CTNTACGACCTGCTGCCTTTC 3 1
mmu-let-7d_precursor GGTAGTAGGTTGGATAGTT 3 3
mmu-let-7d_precursor AGAGGTAGTCGGTTGCATAG 2 1
mmu-let-7d_precursor AAAGGTAGTAGGTTGCATAGTT 57 1
mmu-let-7d_precursor CTATACGACCTGCNGCCTTTC 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTTT 12 3
mmu-let-7d_precursor AGAGTTAGTAGGTTGCATAGTTT 3 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTTTA 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAT 319 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAG 130 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAA 437 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAC 17 1
mmu-let-7d_precursor AGAGGTAGTAGGTNGCATAGA 2 1
mmu-let-7d_precursor CTATATGACCTGCTGCCTTTC 3 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTAT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTAGA 49 2
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTTA 17 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTTT 33 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTTG 4 2
mmu-let-7d_precursor TNAGGTAGTAGGTTGCATAGTT 2 3
mmu-let-7d_precursor AGAGGTAGTAGGTTCCATAGTTT 2 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTT 26 3
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTA 43 3
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTG 6 5
mmu-let-7d_precursor GNAGTAGGTTGCATAGTT 5 1
mmu-let-7d_precursor TGAGGAAGTAGGTTGCATAGTT 2 6
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTA 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTTT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTGTT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATGA 7 7
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAGA 3 5
mmu-let-7d_precursor AGAGGGAGNAGGTTGCATAGTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGAATAGTT 6 1
mmu-let-7d_precursor GGTAGTAGGTTGAATAGTT 3 3
mmu-let-7d_precursor AGAGGTAGAAGGTTGCATAGTT 2 1
mmu-let-7d_precursor TGCGGTAGTAGGTTGCATAG 8 4
mmu-let-7d_precursor ACAGGTAGTAGGTTGCATAGT 11 1
mmu-let-7d_precursor GAGNTAGTAGGTTGCATAGTT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTGGCATAGTTT 9 1
mmu-let-7d_precursor AGAGGTAGTAGGTGGCATAGTTG 3 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTT 72 1
mmu-let-7d_precursor AGAGGTAGTNGGTTGCATAGTTTA 2 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCG 6 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCT 86 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCA 17 1
mmu-let-7d_precursor TGAAGAGGTAGTAGGTTGCATAGTT 3 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGT 118 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGG 3 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGA 6 2
mmu-let-7d_precursor AGAGGTAGTAGGNTGCATAG 11 1
mmu-let-7d_precursor GTAGGTTGCATAGTT 229 5
mmu-let-7d_precursor CTGNACGACCTGCTGCCTTTCT 3 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAG 78 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTTG 6 5
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTTC 2 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTTA 27 3
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAGTT 44 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTA 8 1
mmu-let-7d_precursor GAGGNAGTCGGTTGCATAGTT 3 1
mmu-let-7d_precursor ACGAGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor AAGGTAGTAGGTTGCATAGTT 3 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTAT 7 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTAA 19 2
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTAG 2 2
mmu-let-7d_precursor CGACCTGCTGCCTTTC 2 2
mmu-let-7d_precursor ANAGGTAGTAGGTTGC 4 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGT 64 3
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGT 44 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGA 6 4
mmu-let-7d_precursor AGAGGTAGTAGGTTGCGTAGT 3 1
mmu-let-7d_precursor TATACGACCTGCTGCNTTTCT 2 1
mmu-let-7d_precursor CGATACGACCTGCTGCCTTTC 5 1
mmu-let-7d_precursor CTATACGACCTGCNGCCTTTCT 3 1
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGTT 188 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGT 46 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGC 2 1
mmu-let-7d_precursor CTNTACGACCTGCTGCCTTTCT 3 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAG 7 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAAT 3 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTT 262 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTA 5 1
mmu-let-7d_precursor TGGGGTAGTAGGTTGCATAGTT 11 4
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAG 4 8
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAT 143 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGT 3 1
mmu-let-7d_precursor AGAGGAAGTAGGTTGCATAG 2 2
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAG 42 1
mmu-let-7d_precursor GGTAGTAGGTTGNATAGT 7 3
mmu-let-7d_precursor AGAGGTAGTAGGTTACATAGTT 9 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCA 77 1
mmu-let-7d_precursor GAGGTTGTAGGTTGCATAGT 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTNGCATAGTTT 30 1
mmu-let-7d_precursor AGAGGTAGTAGGTNGCATAGTTA 19 1
mmu-let-7d_precursor AGAGGTAGTAGGNTGCATAGA 2 1
mmu-let-7d_precursor AAGAGGTAGTAGCTTGCATAGT 2 1
mmu-let-7d_precursor AGANGTAGTAGGTTGCATAGTT 106 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGTTA 15 1
mmu-let-7d_precursor AGANGTAGTAGGTTGC 2 1
mmu-let-7d_precursor CTATATGACCTGCTGCCTTTCT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTNGCATAGT 43 1
mmu-let-7d_precursor AGAGGTAGTATGTTGCATAGTT 5 1
mmu-let-7d_precursor AGATGTAGTAGGTTGCATAGTTT 6 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAG 12 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGT 31 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGA 5 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCGA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGGTGCATAGTTA 2 1
mmu-let-7d_precursor GTAGGTTGCATAG 6 33
mmu-let-7d_precursor CGAGGTAGTAGGTTGCATAG 2 1
mmu-let-7d_precursor CTATACGACCTGCTGNCTTTCT 6 1
mmu-let-7d_precursor AGAGGTAGTAGCTTGCATAGTTT 3 1
mmu-let-7d_precursor AGAGGTAGTAGCTTGCATAGTTA 3 1
mmu-let-7d_precursor AAGAGGTAGTAGGNTGCATAGT 3 1
mmu-let-7d_precursor CTATACGACCTGCT 2 1
mmu-let-7d_precursor AGAGTTAGTAGGTTGCATAGTT 4 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATGGTT 4 3
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAG 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGAA 3 1
mmu-let-7d_precursor AGAGGTAGTAGATTGCATAGT 13 1
mmu-let-7d_precursor CTATACGACCNCCTGCCTTTCT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTTTT 3 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGT 21 1
mmu-let-7d_precursor AGACGTAGTAGGTTGCATAGTTT 3 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATA 4 1
mmu-let-7d_precursor TGCGGTAGTAGGTTGCATAGTT 191 3
mmu-let-7d_precursor TAGTAGGTTGCATAGT 3 2
mmu-let-7d_precursor AGGTAGTAGGTTGCATAGT 9 1
mmu-let-7d_precursor TGAGGCAGTAGGTTGCATAGTT 5 4
mmu-let-7d_precursor CTATACGACCTCCTGCCTTTCA 2 1
mmu-let-7d_precursor CTATACGACCTCCTGCCTTTCT 4 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTAT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAG 8 3
mmu-let-7d_precursor AGAGGTAGTAGGGTGCATAGT 6 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGGT 5 1
mmu-let-7d_precursor CTATACGACCTGNTGCCTTTCT 6 1
mmu-let-7d_precursor AANAGGTAGTAGGTTGCATAGTT 4 1
mmu-let-7d_precursor AGAGGTAGTNGGTTGCATAG 12 1
mmu-let-7d_precursor CTANACGACCTGC 3 22
mmu-let-7d_precursor AGANGTAGTAGGTTGCCTAGTTT 2 1
mmu-let-7d_precursor AGAGGTAGTCGGTTGCATAGTT 16 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCAT 5 1
mmu-let-7d_precursor AGAGGTAGTANGTTGCATAGTTA 6 1
mmu-let-7d_precursor TGAGGTAGTCGGTTGCATAGTT 3 3
mmu-let-7d_precursor CGACCTGCTGCCTTTCT 3 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTC 2 3
mmu-let-7d_precursor GAGGTAGTAGGTTNCATAGTT 3 1
mmu-let-7d_precursor GTAGGTTGCATANTT 2 27
mmu-let-7d_precursor CTANACGACCTGCTGCCTTTC 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAG 14 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCA 3 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAGTTTT 2 1
mmu-let-7d_precursor CNATACGACCTGCTGCCTTTCA 5 1
mmu-let-7d_precursor AATAAAATGGGTTCCTAGGA 2 1
mmu-let-7d_precursor CTATACGACCTGTTGCCTTTC 2 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTG 9 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTA 8 1
mmu-let-7d_precursor AGAGGTAGTAGGTTTCATAGTT 9 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCAT 11 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTGC 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCC 3 1
mmu-let-7d_precursor AGAGGTAGTAGCTTGCATAGT 9 1
mmu-let-7d_precursor GTAGTAGGTTGCATAGTTA 6 1
mmu-let-7d_precursor AGAGGTAGTANTTTGCATAG 4 2
mmu-let-7d_precursor CTATAAGACCTGCTGCCTTTCT 3 1
mmu-let-7d_precursor AGGTAGTAGGTTGCATAGTT 10 1
mmu-let-7d_precursor AAGAGTTAGTAGGTTGCATAGTT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTCCATAGTT 7 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTT 444 3
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTA 5 4
mmu-let-7d_precursor AGCGGTCGTAGGTTGCATAGTT 6 1
mmu-let-7d_precursor ACGAGGTAGTAGGTTGCATAGTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGATTGCATAGTTT 7 1
mmu-let-7d_precursor AGAGGTAGTAGATTGCATAGTTA 2 1
mmu-let-7d_precursor TGAGGTAGTAGCTTGCATAGTT 4 5
mmu-let-7d_precursor GAGGTAGTAGGTTG 14 26
mmu-let-7d_precursor ANGAGGTAGTAGGTTGCATAGTT 6 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAGTT 36 1
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGT 38 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCACAGTT 9 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTGA 11 1
mmu-let-7d_precursor NAGAGGTAGTAGGTTGCATAGTT 2 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGTT 229 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGT 37 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGA 3 4
mmu-let-7d_precursor TNTACGACCTGCTGCCTTTC 2 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAGT 19 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCAT 3 8
mmu-let-7d_precursor AAGNGGTAGTAGGTTGCATAGT 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTTT 6 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAG 11 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTNCATAGT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGA 345 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGC 3 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGG 5 1
mmu-let-7d_precursor TGCGGTAGTAGGTTGCATAGTTT 16 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGTTTA 3 2
mmu-let-7d_precursor AGAGGTAGTAGGTAGCATAGTTT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTAGCATAGTTA 4 1
mmu-let-7d_precursor NGAGGTAGTAGATTGCATAGTT 2 3
mmu-let-7d_precursor AGAGNTAGTAGGTTGCATAGTTA 15 2
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGTTG 8 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAT 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAG 1406 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAA 8 1
mmu-let-7d_precursor GTAGGTTGCNTAGTT 3 14
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTTTT 8 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTTTT 2 1
mmu-let-7d_precursor GAGNTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTA 2 3
mmu-let-7d_precursor GAGGTAGTAGGTTGCAT 5 1
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGTTA 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAGTTT 11 1
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAGTTG 3 1
mmu-let-7d_precursor GCGGTAGTAGGTTGCATAGTT 3 1
mmu-let-7d_precursor AGGNGTAGTAGGTTGCATAGTT 70 1
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAGT 14 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTGCT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTG 609 1
mmu-let-7d_precursor AGGAGGTAGTAGGTTGCATAGTT 2 1
mmu-let-7d_precursor AGATGTAGTAGGTTGCATAGTTA 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTT 17 9
mmu-let-7d_precursor AGAGGTAGTGGGTTGCATAGTT 6 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAGTT 67 1
mmu-let-7d_precursor AGAGGTAGTAGCTTGCATAGTTAT 2 1
mmu-let-7d_precursor AGGGAGTAGGTTGCATAGT 2 2
mmu-let-7d_precursor AGAGGTAGTAGGTNGCATAGTTTT 2 1
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGTTAT 3 1
mmu-let-7d_precursor AGCGGTAGTAGGTTGAATAGTT 2 1
mmu-let-7d_precursor CTATACGACCTGTTGCCTTTCT 2 1
mmu-let-7d_precursor AAGGGGTAGTAGGTTGCATAGT 5 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATTTT 4 4
mmu-let-7d_precursor AGANGTAGTAGGTTGCATAGTTG 5 1
mmu-let-7d_precursor AAAGGTAGTAGGTTGCATAGA 2 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTTA 6 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTTG 5 1
mmu-let-7d_precursor AGAGGTAGTANGTTGCATAGTTT 12 1
mmu-let-7d_precursor AGAGGTAGTANCTTGCATAGTT 19 1
mmu-let-7d_precursor CTATACGACCTGCGGCCTTTCA 2 1
mmu-let-7d_precursor GTAGTAGGTTGCATAGTTT 7 1
mmu-let-7d_precursor AGAGGGAGTAGGTTGCATAGTT 170 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGTT 156 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGTA 2 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCNTAGTT 3 1
mmu-let-7d_precursor CTATACGACTTGCTGCCTTTCT 3 1
mmu-let-7d_precursor AAGAGGTAGNAGGTTGCATAGT 7 1
mmu-let-7d_precursor CAGAGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGTT 52 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAGT 2 1
mmu-let-7d_precursor AGAGTTAGTAGGTTGCATAGT 4 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGC 3 1
mmu-let-7d_precursor AGAGGTAGTANTTTGCATAGT 7 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTT 1037 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTA 12 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCTT 7 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTCTG 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGAATAG 2 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTC 10 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTA 120 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTG 27 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTT 171 1
mmu-let-7d_precursor GAGGTAGTAGGTTTCATAGTT 4 1
mmu-let-7d_precursor AGAGGTAGTANGTTGCATAGT 4 1
mmu-let-7d_precursor AGAGGTAGTANGTTGCATAGA 2 1
mmu-let-7d_precursor GGAGGTAGTAGGTTGCATAGTT 7 1
mmu-let-7d_precursor AGATGTAGTAGGTTGCATAGTT 24 1
mmu-let-7d_precursor TAGTAGGTTGCATAGTT 9 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTATA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGTATAGTT 182 3
mmu-let-7d_precursor GAGGTAGTAGGTTGCTTAGTT 2 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTT 107 1
mmu-let-7d_precursor AGAGGTAGCAGGTTGCATAGTTT 4 1
mmu-let-7d_precursor GAGGTAGTAGGGTGCATAGTT 2 1
mmu-let-7d_precursor AGAGGTCGTAGGTTGCATAG 2 1
mmu-let-7d_precursor AGANGTAGTAGGTTGCCTAGTT 22 1
mmu-let-7d_precursor CTATACGACCTGATGCCTTTCT 2 1
mmu-let-7d_precursor GNGGTAGTAGGTTGCATAGTT 24 1
mmu-let-7d_precursor AGCNGTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor TGAGGTAGGAGGTTGCATAGTTT 3 4
mmu-let-7d_precursor AGAGGTAGTAGGTTGCACAGTTT 2 1
mmu-let-7d_precursor CTCTACGACCTGCTGCCTTTCT 4 1
mmu-let-7d_precursor CTCTACGACCTGCTGCCTTTCA 2 4
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTTT 14 1
mmu-let-7d_precursor AGAGGTAGTCGGTTGCATAGT 2 1
mmu-let-7d_precursor TGAGGGAGTAGGTTGCATAGTT 17 3
mmu-let-7d_precursor AGAGGTAGTNGGTTGCATAGT 41 1
mmu-let-7d_precursor AGAGGTAGTNGGTTGCATAGA 4 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTT 50 1
mmu-let-7d_precursor CTATACGACNTGCTGCCTTTCT 9 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATACTT 18 1
mmu-let-7d_precursor AGAGGTAGTAGGTTG 53 4
mmu-let-7d_precursor AGAGGTAGTAGGTTTCATAGTTA 4 1
mmu-let-7d_precursor AGAGGTAGTCGGTTGAATAGTT 2 1
mmu-let-7d_precursor GAGGTTGTAGGTTGCATAGTT 10 1
mmu-let-7d_precursor GAGGTAGTAGGTNGCATAGTT 7 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTTC 5 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTTA 101 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTTT 170 1
mmu-let-7d_precursor TAAAATGGGTTCCTAGGA 2 1
mmu-let-7d_precursor AAAGGTAGTAGGTTGCATAGTTT 10 1
mmu-let-7d_precursor AAAGGTAGTAGGTTGCATAGTTA 2 1
mmu-let-7d_precursor AAAGGTAGTAGGTTGCATAGTTG 2 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGTTTA 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGN 2 4
mmu-let-7d_precursor AGAGGTAGTAGGTTGC 73 1
mmu-let-7d_precursor GAGGTAGTAGGTTGGATAGTT 4 3
mmu-let-7d_precursor AGAGGTAGCAGGTTGCATAGTT 6 1
mmu-let-7d_precursor ATAGGTAGTAGGTTGTATAGTT 2 3
mmu-let-7d_precursor AGAGGAAGTAGGTTGCATAGTT 21 1
mmu-let-7d_precursor AGAGGTGGTAGGTTGCATAGT 3 1
mmu-let-7d_precursor GAGGTAGTAGNGTGCATAGTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATGGTT 10 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAATT 3 1
mmu-let-7d_precursor CNATACGACCTGCTGCCTTTCT 33 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGAAT 3 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATACT 4 1
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAGTTT 5 1
mmu-let-7d_precursor ATAGGTAGTAGGTTGCATAGTTA 8 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCAAAGA 3 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTG 13 1
mmu-let-7d_precursor AGAGGTAGTGGGTTGCATAGTTA 2 1
mmu-let-7d_precursor GTNGGTTGCATAGTT 3 12
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGTAG 2 1
mmu-let-7d_precursor ATGTAGTAGGTTGCATAG 4 5
mmu-let-7d_precursor ACAGGTAGTAGGTTGCATAGTT 45 1
mmu-let-7d_precursor GTAGGTTGCATAGTTAT 4 10
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTAA 27 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTTAT 5 1
mmu-let-7d_precursor CTATACGACCNGCTGCCTTTCT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTGGCATAGTT 53 1
mmu-let-7d_precursor AGAGGTAGTANCTTGCATAGTTT 2 1
mmu-let-7d_precursor CTATNCGACCTGCTGCCTTTCT 2 1
mmu-let-7d_precursor TGAGGGAGTAGGTTGCATAGT 2 5
mmu-let-7d_precursor GTAGNTTGCATAGTT 4 17
mmu-let-7d_precursor AGAGGTAGTAGGNTGCATAGTT 220 1
mmu-let-7d_precursor CTATACGACCTGCCGCCTTTCT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGNTGCATAGT 42 1
mmu-let-7d_precursor ANGAGGTAGTAGGTTGCATAGT 20 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATGGT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAGT 7 1
mmu-let-7d_precursor GTAGTAGGTTGCATAGT 8 1
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGTTT 30 1
mmu-let-7d_precursor AAGAGGTAGTAGTTTGCATAGT 2 1
mmu-let-7d_precursor AGAGGTCGTAGGTTGCATAGTT 11 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTAA 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTAT 2 1
mmu-let-7d_precursor AGAGNTAGTAGGTTGCATAGT 30 1
mmu-let-7d_precursor AGTGGTAGTAGGTTGCATAGT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTAGCATAGT 7 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTG 13 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTT 9 1
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGTTT 7 1
mmu-let-7d_precursor AGGGGTAGTAGGTTGCATAGTTG 3 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTG 4 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTT 15 1
mmu-let-7d_precursor ACAGGTAGTAGGTTGCATAG 2 1
mmu-let-7d_precursor GGTAGTAGGTTGCATAGT 7 1
mmu-let-7d_precursor ANGAGGTAGTAGGTTGCATAG 6 1
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGTTAT 3 1
mmu-let-7d_precursor AGAGGTAGTAGATTGCATAG 5 1
mmu-let-7d_precursor GAGGTCGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTA 157 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTC 3 1
mmu-let-7d_precursor AGAGGTAGTNGGTTGCATAGTT 208 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAAT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAAG 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAAA 4 5
mmu-let-7d_precursor CNATACGACCTGCTGCCTTTC 14 1
mmu-let-7d_precursor AANAGGTAGTAGGTTGCATAGT 5 1
mmu-let-7d_precursor CTAGACGACCTGCTGCCTTTCT 4 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTA 3 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTT 637 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTAA 77 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGCT 5 2
mmu-let-7d_precursor AGAGGTAGTANCTTGCATAGT 8 1
mmu-let-7d_precursor AGAGGTAGTAGGTNGCATAG 11 1
mmu-let-7d_precursor AAGAGGTAGTAGNTTGCATAGT 6 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGTTT 3 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGTTG 2 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAG 7 1
mmu-let-7d_precursor TATACGACCTGCTGCCTTTC 21 1
mmu-let-7d_precursor NGAGGTAGTAGGTTGCATAGTTTT 2 1
mmu-let-7d_precursor NTATACGACCTGCTGCCTTTCT 4 1
mmu-let-7d_precursor AGAGGGCGTAGGTTGCATAGTT 3 2
mmu-let-7d_precursor AGAGGTAATAGGTTGCATAGTT 2 1
mmu-let-7d_precursor AGGNGTAGTAGGTTGCATAG 3 1
mmu-let-7d_precursor AGAGCTAGTAGGTTGCATAGTT 3 2
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTTGT 2 1
mmu-let-7d_precursor AGAGGTAGTCGGTTGCATAGTTA 3 1
mmu-let-7d_precursor GGAGTAGGTTGCATAGTT 2 2
mmu-let-7d_precursor GGAGGTTGCATAGTTT 2 42
mmu-let-7d_precursor AGAGGTAGTAGGTGGCATAGTTA 3 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGAATAGTTTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGCTGCATAG 4 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGTTAT 2 1
mmu-let-7d_precursor GAGNTAGTAGGTTGCATAGTTT 2 1
mmu-let-7d_precursor AGTAGGTTGNATAGTT 13 6
mmu-let-7d_precursor AGAGGTAGTAGGATGCATAGTTT 2 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCTGT 3 1
mmu-let-7d_precursor AGAGNTAGTAGGTTGCATAGTT 152 1
mmu-let-7d_precursor AGAGGTAGTAGATTGCATAGTT 46 1
mmu-let-7d_precursor AGAGGTAGTAGGGTGCATAGTT 24 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATA 28 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATG 2 3
mmu-let-7d_precursor GTCGTAGGTTGCATAGTT 2 2
mmu-let-7d_precursor AGAGGTAGTANATTGCATAGTTT 4 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGT 388 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATAGA 22 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCA 3 17
mmu-let-7d_precursor CNATACGACCTGC 3 14
mmu-let-7d_precursor AGAGGTAGTAGGTT 30 16
mmu-let-7d_precursor AGAGGTAGTAAGTTGCATAGTT 4 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGA 2 1
mmu-let-7d_precursor AGNGGTAGTAGGTTGCATAGT 46 1
mmu-let-7d_precursor AGANGTAGTAGGTTGCATAG 5 1
mmu-let-7d_precursor TGAGGTAGTAGCTTGCATAGT 3 5
mmu-let-7d_precursor AGCGGTAGTAGGTTGCAT 2 1
mmu-let-7d_precursor AGAGGAAGTAGGTTGCATAGT 4 1
mmu-let-7d_precursor CTATACGACNTGCTGCCTTTC 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTCGCATAGTT 34 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGAATAGT 3 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTT 15 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGTT 26 1
mmu-let-7d_precursor AGAGGAAGTAGGTTGCATAGTTT 6 1
mmu-let-7d_precursor AGAGGAAGTAGGTTGCATAGTTA 3 1
mmu-let-7d_precursor AGAGGTAGTAGGATGCATAGTT 14 1
mmu-let-7d_precursor GAGGTTGTAGGTTGCATAGTTA 2 2
mmu-let-7d_precursor AGAGGTTGTAGGTTGCATAGTT 3 1
mmu-let-7d_precursor CGATACGACCTGCTGCCTTTCTG 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGAT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGAA 27 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGG 10 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTTGA 151 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATTTAT 2 1
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGTTA 19 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGT 217 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTTT 7 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAGTTTA 2 2
mmu-let-7d_precursor GAGGTAGTAGGTTGCATAG 28 1
mmu-let-7d_precursor TAGGTAGTAGGTTGCATAGTT 2 1
mmu-let-7d_precursor GAGGTAGTAGGTNGCATAGTTT 2 1
mmu-let-7d_precursor AGAGGCAGTAGGTTGCATAGTTA 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATT 7 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATATA 3 2
mmu-let-7d_precursor AGAGGTAGGAGGTTGCATAGTT 6 1
mmu-let-7d_precursor AAGAGTTAGTAGGTTGCATAGTTA 2 1
mmu-let-7d_precursor AGCGGTAGTAGGTTGCATAGTTC 2 1
mmu-let-7d_precursor CAGAGGTAGTAGGTTGCATAGTT 8 1
mmu-let-7d_precursor TGAGGTAGTAGGTNGCATAGTT 2 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGNAT 2 2
mmu-let-7d_precursor AAAGGTAGTAGGTTGCATAGT 18 1
mmu-let-7d_precursor AGAGGTAGTAGTTTGCATAGTTA 4 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATGGT 2 1
mmu-let-7d_precursor ANAGGTAGTAGGTTGCATAGTTAT 15 1
mmu-let-7d_precursor GAGGTAGTAGGTTGCA 2 2
mmu-let-7d_precursor AAAGGTAGTAGGTTGCATAG 5 1
mmu-let-7d_precursor CAGAGGTAGTAGGTTGCATAG 2 2
mmu-let-7d_precursor GAGGGAGTAGGTTGCATAGTT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTTGNATAGTTAT 2 1
mmu-let-7d_precursor AGAGGTAGTAGGTAGCATAG 4 1
mmu-let-7d_precursor AGAGGTAGTANGTTGCATAGTT 53 1
mmu-let-7d_precursor AGGNGTAGTAGGTTGCATAGTTT 7 1
mmu-let-7d_precursor AGAGGTACTAGGTTGCATAGTT 4 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCCA 3 1
mmu-let-7d_precursor TATACGACCTGCTGCCTT 3 1
mmu-let-7d_precursor AGAGGTAGTAGGNTGCATAGTTT 41 1
mmu-let-7d_precursor AGAGGTAGTAGGNTGCATAGTTA 20 1
mmu-let-7d_precursor AGAGGTAGTAGGNTGCATAGTTG 10 1
mmu-let-7d_precursor GTAGTAGGTTGGATAGTT 4 3
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCC 14 1
mmu-let-7d_precursor GAGGTAGTANGTTGCATAGTT 6 1
mmu-let-7d_precursor TGAGGTAGTAGGTTGCATAGTTTT 2 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGTGA 11 1
mmu-let-7d_precursor AAGAGGTAGTAGGTTGCATCGT 3 1
mmu-let-7d_precursor CNATACGACCTGCTGCCTTT 2 1
mmu-let-7d_precursor AGATGTAGTAGGTTGCATAGT 6 1
mmu-let-7d_precursor AGAGGTAGTANCTTGCATAG 3 3
mmu-let-7d_precursor AGAGGTAGTAGGTTGGATAGTTT 2 1
mmu-let-7d_precursor TGCGGTAGTAGGTTGCATAGT 24 4
mmu-let-7d_precursor AGAGGTAGTAGGTNGCATAGTT 189 1
mmu-let-7d_precursor AGAGGTAGTNGGTTGCATAGTTT 43 1
mmu-let-7d_precursor AGAGGTCGTAGGTTGCATAGTTT 3 1
mmu-let-7d_precursor AGAGGTAGTNGGTTGCATAGTTG 6 1
mmu-let-7d_precursor AGAGGTAGTNGGTTGCATAGTTA 19 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCT 754 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCG 35 1
mmu-let-7d_precursor CTATACGACCTGCTGCCTTTCA 117 1
mmu-let-7d_precursor CTATAGGACCTGCTGCCTTTCT 7 2
mmu-let-7d_precursor AGAGGTAGTAGGTTGCATAGGT 2 1
mmu-let-7d_precursor GTAGGTTGCATAGTTN 2 5
mmu-let-7d_precursor GTAGGTTGCATAGTTT 28 1
mmu-let-7d_precursor AGANGTAGTAGGTTGCATAGTTAT 3 1