id_rna sequence raw_count mapping_loci
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTCC 38 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTCT 26 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTC 6 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTCTT 2 1
mmu-let-7e-3p CTATACGGCCTCGTAGCTTTCC 2 1
mmu-let-7e-3p TATACGGCCTCCTAGCTTTCCT 2 1
mmu-let-7e-3p CNATACGGCCTCCTAGCTTTCC 2 1
mmu-let-7e-3p TATACGGCCTCCTAGCTTTCT 2 1
mmu-let-7e-3p TATACGGCCTCCTAGCTTTCC 3 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTTCCT 4 1
mmu-let-7e-3p CTATACGGCCTCCTAGCTTT 3 1