id_rna sequence raw_count mapping_loci
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTT 33667 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTT 1304 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGA 1205 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTAG 747 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTA 316 2
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTGA 20 1
mmu-let-7e_precursor TGAGGTAGNAGGTTGTATAGT 6 3
mmu-let-7e_precursor TGAGGTAGNAGGTTGTATAGC 2 3
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGTTA 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTTTA 2 2
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTGT 9 1
mmu-let-7e_precursor NGAGGGAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTCGTATAGTTGA 6 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTC 20 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTG 68 4
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTT 4 1
mmu-let-7e_precursor TAGTAGGTTGTATAGTTG 7 6
mmu-let-7e_precursor GGGGTAGGAGGTTGTATAGTTG 4 1
mmu-let-7e_precursor GAGGTAGTANGTTGTATAGTTG 3 5
mmu-let-7e_precursor TAGGTAGTAGGTTGTATAGTTG 4 5
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTTG 13 1
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTTT 4 3
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTTA 4 1
mmu-let-7e_precursor TCAGGTAGGATGTTGTATAGTT 2 2
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTG 46 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTA 13 1
mmu-let-7e_precursor TGAAGTAGTAGGTTGTATAGTTG 4 4
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGCTG 2 4
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAG 2 2
mmu-let-7e_precursor TGAGGTAGTANGTTGTATAGTTG 36 5
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTA 5 2
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTGAA 2 1
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTTGA 4 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTAAG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTTAA 12 1
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor GAGGTAGTAGGTTGCATAGTTGA 6 3
mmu-let-7e_precursor GAGGTAGGAGGTTGTATGGT 2 4
mmu-let-7e_precursor TGAGGTAGTAGGTGGTATAGTTG 11 4
mmu-let-7e_precursor TGGGTTAGGAGGTTGTATAGTT 2 3
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTTA 2 2
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTTTA 6 2
mmu-let-7e_precursor TNATGTAGGAGGTTGTATAGT 3 2
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTTGA 50 1
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTTGT 26 1
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGT 3 2
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTAG 3 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTGT 27 1
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGT 8 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTCTT 2 1
mmu-let-7e_precursor GAGGTTGGAGGTTGTATAGTT 5 1
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAG 2 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTC 6 1
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTTT 47 4
mmu-let-7e_precursor TNAGGTAGGAGGTTGCATAGTT 2 1
mmu-let-7e_precursor TGAGNTAGGCGGTTGTATAGTT 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAG 2 2
mmu-let-7e_precursor TGGGGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7e_precursor GTAGGAGGTTGTATAGTT 16 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTG 198 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTT 46 3
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTA 45 1
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGTTG 5 1
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGTTA 3 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTAG 4 1
mmu-let-7e_precursor GAGGGAGGAGGTTGTATAGT 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTGT 3 2
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTA 20 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTT 12 5
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTAA 7 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGTT 7 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTTG 41 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTTA 14 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTT 93 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTTAA 2 2
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTAGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTTG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTTT 3 3
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTGT 130 1
mmu-let-7e_precursor GNAGGTTGTATAGTT 290 16
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGA 25 3
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTAA 4 1
mmu-let-7e_precursor GNGGTAGGAGGTTGTATAGT 8 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTT 8 3
mmu-let-7e_precursor GANGTAGGAGGTTGTATAGTT 7 1
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTGA 5 1
mmu-let-7e_precursor GAGGTGGTAGGTTGTATAGTTG 3 4
mmu-let-7e_precursor TGAGGTAGTAGGCTGTATAGTTGA 6 2
mmu-let-7e_precursor TNAGGTAGGAGGTTGTAT 8 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATGGTTA 2 3
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAA 437 2
mmu-let-7e_precursor TAGGTAGGAGGTNGTATAGTT 2 1
mmu-let-7e_precursor TGAGGGAGTAGGTTGTATAGTTG 50 4
mmu-let-7e_precursor TGAGGTAGTAGGNTGTATAGTTGA 5 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGAATAGTTG 5 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATTG 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATTA 5 13
mmu-let-7e_precursor TGCGGTCGGAGGTTGTATAGTTG 5 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTA 10 1
mmu-let-7e_precursor TAGGAGGTTGTATAGTTAT 3 24
mmu-let-7e_precursor TGANGTAGGAGGTTGTCTAGTTG 13 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTTGA 26 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTTGT 25 1
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTT 9 6
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor GTAGGAGGTTGTATAGTTA 3 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATGGTAG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGT 10 1
mmu-let-7e_precursor TGAGGTAGGANATTGTATAGTTGA 6 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGT 23 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGT 20 1
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTTG 32 1
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTTT 6 4
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTTA 9 1
mmu-let-7e_precursor CTATACGGCCTCGTAGCTTTCC 2 1
mmu-let-7e_precursor AGAGGTAGGAGGTTGTATAGT 2 1
mmu-let-7e_precursor TGAGGGAGGATGTTGTATAGTT 3 2
mmu-let-7e_precursor GAGGTGGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTTAA 5 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTTG 8 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTTA 4 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTCT 26 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTCC 38 1
mmu-let-7e_precursor TGAGCTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TNAGGTAGGAGGTTGTA 2 1
mmu-let-7e_precursor GAGTAGGAGGTTGTATAGTTG 2 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTA 3 3
mmu-let-7e_precursor TNGGAGGTTGTATAGT 2 2
mmu-let-7e_precursor TNAGGTACGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTTT 38 3
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTTC 2 1
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTTA 45 1
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGTT 3 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTA 5 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTG 3 4
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAG 2 1
mmu-let-7e_precursor ACTGAGGTAGTAGGTTGTATAGTT 2 4
mmu-let-7e_precursor TNAGGTAGGATGTTGTATAGTT 6 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTGA 12 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTGT 3 2
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TCAGGTAGTAGGTTGTATAGTTG 13 4
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATGGTT 4 3
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTTAA 3 2
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTTG 12 1
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTTA 4 3
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGTTG 4 1
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGTTT 2 3
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAG 3 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAA 40 3
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAT 6 2
mmu-let-7e_precursor TGAGGTAGNAGGTTGTGTAGTT 2 4
mmu-let-7e_precursor GAGGNAGGCGGTTGTATAGTTG 2 1
mmu-let-7e_precursor NAGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTTTAGTTG 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTTTAGTTT 2 3
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTG 285 1
mmu-let-7e_precursor TGTAGGAGGTTGTATAGT 7 5
mmu-let-7e_precursor TGAGGTAAGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTTTA 4 2
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGTT 17 1
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGT 19 1
mmu-let-7e_precursor CAGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor GGTTGTATAGTTGA 9 15
mmu-let-7e_precursor TGAGGCAGTAGGTTGTATAGTTG 20 4
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTT 172 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATCGTTG 2 1
mmu-let-7e_precursor TATACGGCCTCCTAGCTTTCCT 2 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTT 23 3
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTA 21 2
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTTGAA 2 1
mmu-let-7e_precursor TGAGGTCGNAGGTTGTATAGT 2 3
mmu-let-7e_precursor TGAGGTAGGAGGATGTATAG 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTTTAGTT 4 1
mmu-let-7e_precursor GTAGTAGGTTGTATAGTTG 5 4
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTTA 4 1
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTGA 9 1
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTGG 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGG 17 4
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGC 61 4
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTAG 5 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAA 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGAA 2 30
mmu-let-7e_precursor TGAGGTCGTAGGTTGTATAGTTG 4 4
mmu-let-7e_precursor GAGGGAGGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor TGGGGTAGTAGGTTGTATAGTTG 37 4
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGT 25 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTGA 14 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTGT 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTT 48 1
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGT 6 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTAA 2 1
mmu-let-7e_precursor TGAGGTAGGTCGTTGTATAGTT 3 2
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGTTG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAAAG 3 1
mmu-let-7e_precursor TAGNAGGTTGTATAGTTA 3 16
mmu-let-7e_precursor TNAGGTGGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TNAGGTAGGATGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGTTG 8 1
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTT 12 1
mmu-let-7e_precursor TNAGTTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTATAGTT 35 3
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAAT 3 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAAA 2 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTG 10 1
mmu-let-7e_precursor TGCGGTAGTAGGTTGTATAGTTGA 8 2
mmu-let-7e_precursor GGTAGGAGGTTGTATGGTT 16 3
mmu-let-7e_precursor TGAGGTGGTAGGTTGTATAGTTG 5 4
mmu-let-7e_precursor GAGGTAGGAGGTTGT 4 39
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGT 89 1
mmu-let-7e_precursor TGGNGTAGGAGGTTGTATAGT 22 2
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATGGTT 5 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGTT 2 7
mmu-let-7e_precursor TNGTAGGAGGTTGTATAGTT 2 2
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTAA 8 1
mmu-let-7e_precursor TGAGGTAGGANATTGTATAGTTG 39 2
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTTAA 8 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTT 252 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTGA 41 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTNTAGT 2 1
mmu-let-7e_precursor GGAGGTTGTATAGTT 137 3
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTG 74 1
mmu-let-7e_precursor GTAGGAGGTTGTATAGT 4 1
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTA 12 2
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTTT 50 3
mmu-let-7e_precursor GAGGTAGGANGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTGAC 4 2
mmu-let-7e_precursor TAGGAGGTTGTATAGTTG 11 1
mmu-let-7e_precursor TGCNGTAGGAGGTTGTATAGTT 20 1
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTGT 9 1
mmu-let-7e_precursor CTGAGGTAGGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor TGAGGTAGTAGGTCGTATAGTTG 15 4
mmu-let-7e_precursor TGAGGGAGGAGGTTGAATAGTT 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTAG 2 1
mmu-let-7e_precursor TGAGGCAGNAGGTTGTATAGTT 9 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGGTT 2 3
mmu-let-7e_precursor TGAGGTAGTAGGTTGCATAGTTG 6 5
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTTAA 8 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTAT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTG 35 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTC 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTA 307 1
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAGTTGT 8 1
mmu-let-7e_precursor GCGGTAGGAGGTTGTATAGTT 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGG 4 1
mmu-let-7e_precursor TGAGGTAGNAGGTTGTATAGTTC 27 3
mmu-let-7e_precursor GTAGNAGGTTGTATAGTT 7 3
mmu-let-7e_precursor TGNGGTAGTAGGTTGTATAGTTGA 13 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATA 68 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATG 4 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATT 8 3
mmu-let-7e_precursor GAGGGAGGAGGTTGTATGGTT 3 9
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTAA 46 1
mmu-let-7e_precursor AGGAGGTTGTATAGTTGT 2 2
mmu-let-7e_precursor AGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTAA 3 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAA 2 19
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAG 7 2
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGAA 5 1
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTT 36 3
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTTTA 3 2
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTA 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAG 5 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGT 43 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGG 2 10
mmu-let-7e_precursor GAGGTAGTAGGTTGTATAGTAG 4 5
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTAG 2 1
mmu-let-7e_precursor CNATACGGCCTCCTAGCTTTCC 2 1
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTT 22 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATGG 3 5
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTTA 38 1
mmu-let-7e_precursor TAGGAGGTTGTATAG 2 4
mmu-let-7e_precursor TGAGGTAGTCGGTTGTATAGTTG 5 4
mmu-let-7e_precursor GAGGTAGGAGGTTGTCTAGTTG 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTCTAGTTT 2 4
mmu-let-7e_precursor TAGGAGGTTGTATAGTTGT 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGAAG 2 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGT 53 1
mmu-let-7e_precursor TGAGGTAGTNGGTTGTATAGTTG 72 4
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGT 4 1
mmu-let-7e_precursor GAGGTTGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTAA 4 1
mmu-let-7e_precursor TGCGGTAGTAGGTTGTATAGTTG 57 4
mmu-let-7e_precursor TGAGGAAGNAGGTTGTATAGTT 2 3
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAG 5 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAG 2 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTGT 3 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGT 27 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTGAA 4 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTAAG 2 1
mmu-let-7e_precursor TNAGGTAGCAGGTTGTATAGT 3 4
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTTTA 2 3
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATGGTT 24 3
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTTT 36 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTTGA 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTCAA 3 1
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTT 4 3
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTG 57 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTA 13 1
mmu-let-7e_precursor AGAGGTAGTAGGTTGTATAGTTG 6 5
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATTGTTGA 3 4
mmu-let-7e_precursor TGAGGTAGTAGGTNGTATAGTTGA 7 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTGTAGTTGA 4 2
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTC 2 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTAA 5 1
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAGTT 73 1
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTTGT 19 1
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAGTTT 3 3
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAGTTG 54 1
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAGTTA 12 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGG 26 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGC 24 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGA 4666 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGT 32 7
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTAA 14 1
mmu-let-7e_precursor CTGAGGTAGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTGT 26 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTTAA 5 1
mmu-let-7e_precursor GAGGTGGGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor TNAGGTAGTAGGTTGTATAGTTG 318 4
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTT 170 1
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGTT 11 1
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTTT 3 4
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTT 38 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTAG 3 2
mmu-let-7e_precursor TGAGGTAAGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTATTAGGTTGTATAGTTG 8 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTCTG 2 1
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTTGA 4 1
mmu-let-7e_precursor TGATCTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTTGT 3 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTGT 4 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTGT 2 1
mmu-let-7e_precursor AGAGGTAGGAGGTTGTATAGTT 10 1
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAG 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTGGTATAGTTGA 5 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGNATAGTTGA 10 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTT 21 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTA 27 2
mmu-let-7e_precursor TGAGGTAGGANATTGTATAGTT 47 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTT 122 1
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTTG 6 2
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTTA 3 7
mmu-let-7e_precursor TGTAGGAGGTTGTATAGTTT 8 21
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGA 3 2
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAG 3 1
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGTTG 9 1
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTTGA 3 1
mmu-let-7e_precursor AGGAGGTTGTATAGTTT 2 21
mmu-let-7e_precursor AGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGTAGGAGGTTGTATGGTT 2 48
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGT 25 2
mmu-let-7e_precursor TGAGGTAGGAGTTTGNATAGTT 2 1
mmu-let-7e_precursor GNTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTT 9 3
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTG 44 1
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTA 6 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTGA 202 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTGA 22 1
mmu-let-7e_precursor TGCGGTCGGAGGTTGTATAGTT 7 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGCATAGTT 12 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGT 39 1
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTTG 230 1
mmu-let-7e_precursor TGGNGTAGGAGGTTGTATAGTTG 69 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTTG 181 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTTA 38 1
mmu-let-7e_precursor GAGTTAGGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor TAGGAGGTTGTATAGTT 29 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTGT 7 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTT 78 3
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTA 92 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTC 3 1
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGA 3 3
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGT 102 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAG 22 1
mmu-let-7e_precursor GAGGTTGTATAGTTG 5 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTNTAGTTG 2 1
mmu-let-7e_precursor TAAGGTAGTAGGTTGTATAGTTG 13 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGATGTATAGTTGAA 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAG 46 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAA 122 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAT 34 1
mmu-let-7e_precursor TNAGGTAGGATGTTGTATAGT 3 2
mmu-let-7e_precursor GAGGTAGGAGATTGTATAGTT 10 3
mmu-let-7e_precursor TGATGTAGGNGGTTGTATAGTT 2 2
mmu-let-7e_precursor TGAGNTAGTAGGTTGTATAGTTGA 9 2
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGAATAGTTG 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGAATAGTTT 2 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGAATAGTTA 3 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTT 33 3
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTG 61 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTA 17 2
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATGGTTG 3 3
mmu-let-7e_precursor TGGNGTAGGAGGTTGTATAGTT 75 2
mmu-let-7e_precursor GGTAGGAGATTGTATAGTT 7 4
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAG 59 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTAG 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTAT 2 5
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTAA 14 4
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGT 26 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATA 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGTT 16 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTAA 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGCTG 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGTTG 8 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGT 18 1
mmu-let-7e_precursor TGAGGTAGTNGGTTGTATAGTTGA 12 2
mmu-let-7e_precursor TATACGGCCTCCTAGCTTTCT 2 1
mmu-let-7e_precursor TATACGGCCTCCTAGCTTTCC 3 1
mmu-let-7e_precursor TGANGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGT 31 2
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTG 59 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTA 6 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTT 417 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAA 1325 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAC 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAG 477 1
mmu-let-7e_precursor GAGGTAGGAGGTNGTATAGT 2 1
mmu-let-7e_precursor TGGNGTAGGAGGTTGTATAG 2 2
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTTGA 13 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTACAGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTAG 2 1
mmu-let-7e_precursor TGCNGTAGGAGGTTGTATAGT 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTNGTATAGTTG 51 4
mmu-let-7e_precursor TGAGGGAGGAGATTGTATAGTT 3 5
mmu-let-7e_precursor TGAGGTAGGAGGATGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAAAT 5 2
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATATTTG 2 2
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGT 452 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGAATAGTT 12 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGG 8 4
mmu-let-7e_precursor TGAGGAAGTAGGTTGTATAGTTG 20 4
mmu-let-7e_precursor TAGGAGGTTGTATGGTT 5 18
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTTG 8 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTTA 18 4
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTT 56 1
mmu-let-7e_precursor TNAGGTAGAAGGTTGTATAGTT 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAT 748 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATT 31 1
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTT 253 1
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTA 6 1
mmu-let-7e_precursor GGTAGTAGGTTGTATAGTTG 23 4
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAG 16 2
mmu-let-7e_precursor TGCGGTAGGAGGTTGCATAGT 2 1
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAGT 24 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGT 26 1
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGT 69 1
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGA 3 3
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGT 17 1
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGA 3 8
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGT 93 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGA 6 2
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor TGAGGTAGTAGGATGTATAGTTG 2 5
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTTT 8 3
mmu-let-7e_precursor TGAGGTAGTAGGTTATATAGTTG 2 4
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTAA 11 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGA 4 2
mmu-let-7e_precursor TNATGTAGGAGGTTGTATAGTTG 4 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAG 3 3
mmu-let-7e_precursor AGTAGGTTGTATAGTTG 4 19
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTT 16 1
mmu-let-7e_precursor TNAGTTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTTG 56 2
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTTC 2 3
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGT 69 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTTGT 3 1
mmu-let-7e_precursor GAGGTAGGAGGTCGTATAGTTG 3 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTTG 7514 4
mmu-let-7e_precursor AGNAGGTTGTATAGTT 4 4
mmu-let-7e_precursor TGAGGTAGCNGGTTGTATAGT 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAA 137 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAG 8 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGT 165 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGC 2 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGT 52 1
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTTGA 10 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTAA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTTA 46 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAG 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTAA 7 2
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTTAA 2 3
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAG 3 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTT 10 1
mmu-let-7e_precursor TGAGGTAGGAGTNTGTATAGTTG 2 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTG 34 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTT 15 3
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTA 10 1
mmu-let-7e_precursor TGAGGGAGTAGGTTGTATAGTTGA 12 2
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTTG 54 1
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTTT 12 3
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTTA 17 2
mmu-let-7e_precursor TGCGGTAGGAGGTTGCATAGTTGA 3 1
mmu-let-7e_precursor TGGNGTAGGAGGTTGTATAGTTGA 16 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGT 41 2
mmu-let-7e_precursor GAGGTCGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTGA 14 1
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTTGT 11 1
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTT 118 1
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGTTA 6 3
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGTT 4 1
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAG 20 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTTAA 5 1
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAG 10 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGA 5 18
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGT 2 23
mmu-let-7e_precursor GAGGNAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor GAGGNAGGAGGTTGTATAGTTA 2 1
mmu-let-7e_precursor TGAGNTAGCAGGTTGTATAGTT 10 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGTTT 6 5
mmu-let-7e_precursor TGAGGTCGNAGGTTGTATAGTT 3 3
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTATAGTTAA 3 2
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGT 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTT 57 1
mmu-let-7e_precursor TGAGGTAGGAGGTTG 54 27
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAG 1539 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAA 37 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAT 20 1
mmu-let-7e_precursor TGATGTAGGAGGTTGNATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTTGA 41 1
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTAG 2 1
mmu-let-7e_precursor GAGGTAGCAGGTTGTATAGTT 3 3
mmu-let-7e_precursor TAGGNGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTTA 3 2
mmu-let-7e_precursor TGAGGTAGGANTTTGTATAGT 13 2
mmu-let-7e_precursor CGAGGTAGGAGGTTGTATAGT 5 1
mmu-let-7e_precursor TGANGTAGGAGGTTGTCTAGTT 13 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTT 137 1
mmu-let-7e_precursor TGAGGTAGTAGGTTTTATAGTTG 4 4
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATGGTT 2 5
mmu-let-7e_precursor TGAGGTAGGAAGTTGTATAGTT 5 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTGA 42 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTGT 37 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATTGTT 7 1
mmu-let-7e_precursor GATGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTT 4 3
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTG 22 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTTA 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAATT 7 2
mmu-let-7e_precursor TGAGGTAGNACGTTGTATAGTT 2 3
mmu-let-7e_precursor GAGGTAGGAGGTTTTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTGA 21 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTGT 10 1
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTT 29 1
mmu-let-7e_precursor TGAGGTAGGANCTTGTATAGTTG 25 1
mmu-let-7e_precursor TGAGGTAGGANTTTGTATAGTTG 25 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTNTAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTGG 2 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTT 10 4
mmu-let-7e_precursor TGAGGTAGGANTTTGTATAGTT 24 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTT 164 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTA 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGGT 10 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATGGTT 2 3
mmu-let-7e_precursor TNAGGTAGCAGGTTGTATAGTT 4 3
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGT 10 2
mmu-let-7e_precursor TNAGGTAGGAGTTTGTATAGT 2 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTT 60 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGT 27 3
mmu-let-7e_precursor GAGGTAGAAGGTTGTATAGTT 4 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGA 97 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAGG 2 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTT 122 3
mmu-let-7e_precursor GAGGTAGGAGGTTGTAT 4 2
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTA 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAGA 18 3
mmu-let-7e_precursor TGAGGTAGGANCTTGTATAGT 6 2
mmu-let-7e_precursor TGGNGTAGGAGGTTGTAT 2 25
mmu-let-7e_precursor GAGGCAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGTTT 3 6
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTTG 16 1
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTTA 2 3
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTTT 4 4
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAGTT 107 2
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTGT 3 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTTCCT 4 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTT 27 3
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTG 111 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTA 35 1
mmu-let-7e_precursor TGAGTTAGTAGGTTGTATAGTTG 5 4
mmu-let-7e_precursor GGAGGTTGTATAGTTGA 3 1
mmu-let-7e_precursor GGAGGTTGTATAGTTGT 2 9
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTAA 15 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTGA 10 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTTGT 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTTGT 29 1
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTAG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGTT 3 1
mmu-let-7e_precursor AGGTTGTATAGTTG 10 10
mmu-let-7e_precursor TGAGGTAGTAGGNTGTATAGTTG 76 4
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTGAA 2 1
mmu-let-7e_precursor TGAGGTACGAGGTTGTATAGTT 8 1
mmu-let-7e_precursor TCAGGTAGTAGGTTGTATAGTTGA 3 2
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTG 21 1
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTT 3 4
mmu-let-7e_precursor TGAGGTAGGCGGTTGTATAGTTA 7 1
mmu-let-7e_precursor GAGGTTGGAGGTTGTATGGTT 2 9
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTGA 51 3
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAGTT 2 1
mmu-let-7e_precursor GNGGTAGGAGGTTGTATAGTTAA 2 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTTGT 7 1
mmu-let-7e_precursor TGNGGTAGTAGGTTGTATAGTTG 86 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGGT 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTT 13 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTGAA 2 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTAG 2 1
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGTT 21 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTT 87 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAAA 3 24
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTT 125 1
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTTT 29 3
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTTG 110 1
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTTA 32 1
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGTAG 2 1
mmu-let-7e_precursor TGTNGTAGGAGGTTGTATAGT 2 2
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATGGTT 17 5
mmu-let-7e_precursor AGGAGGTTGTATAGTT 12 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATGGT 4 8
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTAG 2 1
mmu-let-7e_precursor TNGGAGGTTGTATAGTT 3 2
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTTGT 6 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTG 12 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTA 4 1
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTTT 3 3
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTTAA 2 1
mmu-let-7e_precursor TGAGGTAGTAGGGTGTATAGTTG 7 4
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTA 4 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTCTAGTT 6 1
mmu-let-7e_precursor NGAGGTAGTAGGTTGTATAGTTG 34 4
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAG 6 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTAG 23 1
mmu-let-7e_precursor TNAGGTATGAGGTTGTATAGTT 3 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTAA 5 1
mmu-let-7e_precursor TGAGGCAGTAGGTTGTATAGTTGA 5 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGTC 4 1
mmu-let-7e_precursor TGNGGTAGCAGGTTGTATAGTT 2 3
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTAGA 2 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTAG 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGC 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGA 397 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGT 11321 1
mmu-let-7e_precursor TGAGGTAGGATTTTGTATAGTT 8 4
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAG 4 3
mmu-let-7e_precursor NGAGGTAGGAGGTTGTA 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAG 14 12
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTG 78 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTA 11 2
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTC 2 2
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTT 10 6
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTTG 16 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTTA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTTT 2 3
mmu-let-7e_precursor TGCNGTAGGAGGTTGTATAGTTG 9 1
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTTTA 2 2
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTTGAA 4 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGAA 84 4
mmu-let-7e_precursor GAGGTAGTAGGTTGTATAGTTGA 21 2
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTTA 2 1
mmu-let-7e_precursor TGANGTAGGAGGTTGTCTAGT 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAA 28 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAG 6 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTAT 14 2
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTC 18 1
mmu-let-7e_precursor TGAGGTAGGTGGTTGTATAGTTG 3 1
mmu-let-7e_precursor TGAGGTAGGTGGTTGTATAGTTT 2 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTG 16 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTT 3 4
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTA 250 1
mmu-let-7e_precursor CTATACGGCCTCCTAGCTTT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAAA 8 1
mmu-let-7e_precursor TGANGTAGGAGGTTGTCTAGTTGA 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGT 8 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGT 19 1
mmu-let-7e_precursor TGCNGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTA 2 1
mmu-let-7e_precursor TGAGTTAGGAGGTTGTATAGTT 48 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGTTA 14 3
mmu-let-7e_precursor TAGGAGGTTGTATAGTTGA 4 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTGA 22 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTG 254 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAG 14 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTTA 2 2
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAG 9 1
mmu-let-7e_precursor AGGAGGTTGTATAGT 10 2
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATAG 3 2
mmu-let-7e_precursor TGAGGTAGGGGGTTGTATAGTT 19 2
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTGT 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTGA 11 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTG 6 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTTA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGATGTATAGT 9 2
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTGA 43 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGAATAGT 2 1
mmu-let-7e_precursor TAGGAGGTTGTATAGTTTA 2 3
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTAG 6 1
mmu-let-7e_precursor TATGTAGGAGGTTGTATAGT 2 11
mmu-let-7e_precursor TGANGTAGTAGGTTGTATAGTTG 37 4
mmu-let-7e_precursor TGAGGTAGTAGGTAGTATAGTTGA 3 2
mmu-let-7e_precursor TGATGTAGGAGGTTGTATGGTT 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAT 22 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGNATAGTTG 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGA 9 3
mmu-let-7e_precursor GGTTGTATAGTTG 35 43
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAG 538 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAT 113 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAC 7 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAGTAG 2 2
mmu-let-7e_precursor TGAGGTAGTANGTTGTATAGTTGA 4 2
mmu-let-7e_precursor TGAGGTAGTAGGTTGTGTAGTTG 6 5
mmu-let-7e_precursor TGAGGTAGTAGGTTGTACAGTTG 8 5
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGTT 261 1
mmu-let-7e_precursor TGAGGTAGNAGCTTGTATAGTT 4 5
mmu-let-7e_precursor TGANGTAGGAGGTTGTATATTTG 3 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTAG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGT 11 1
mmu-let-7e_precursor TAGGAGGTTGTATAGT 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTTGT 4 1
mmu-let-7e_precursor TGAGGTAGTGGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAGTTGT 14 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGAATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGANCTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTT 314 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTG 34 1
mmu-let-7e_precursor TGATGTAGGAGGTTGTATAG 3 2
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATTGTT 2 1
mmu-let-7e_precursor TGAGGTAGNAGGTTGTCTAGTT 10 3
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTTAG 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTGTAGT 10 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTAG 5 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTGAA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGAATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTGA 20 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTGT 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTATATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTTGA 2 1
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGT 124 1
mmu-let-7e_precursor TGAGGTAGTAGGCTGTATAGTTG 36 4
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTAG 2 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTGA 6 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TGACGTAGGAGGTTGTATAGTTGT 7 1
mmu-let-7e_precursor TGAGGTGGGAGATTGTATAGTT 2 4
mmu-let-7e_precursor TGAGGTAGGACGTTGTATAGTT 29 1
mmu-let-7e_precursor TGAGGTAGGAGGATGTATAGTTG 17 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGCT 6 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAATTG 3 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAATTA 2 2
mmu-let-7e_precursor TGCGGTAGGAGGTTGAATAGTTG 10 1
mmu-let-7e_precursor TGCGGTCGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TTAGGTAGTAGGTTGTATAGTTG 21 4
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATAGTT 42 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAT 4 1
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGT 21 1
mmu-let-7e_precursor TNATGTAGGAGGTTGTATAGTT 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTT 19 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTA 22 1
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTTG 198 1
mmu-let-7e_precursor TGAGGTAGGAGGATGTATAGTTAA 2 1
mmu-let-7e_precursor TGAGNTAGCAGGTTGTATAGT 2 3
mmu-let-7e_precursor TGTNGTAGGAGGTTGTATAGTT 4 1
mmu-let-7e_precursor GAGCTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGANATTGTATAGT 6 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTTG 90 1
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTGA 4 1
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTGT 2 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTA 15 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGT 85 1
mmu-let-7e_precursor TGAGCTAGGAGGTTGTATAGTT 15 1
mmu-let-7e_precursor TAGCAGGTTGTATAGTT 3 13
mmu-let-7e_precursor TGAGGTAGGAGGTCGTATAGTTT 7 3
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTTGA 5 1
mmu-let-7e_precursor TNAGGTAGTAGGTTGTATAGTTGA 51 2
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATTGTT 4 7
mmu-let-7e_precursor TGAGGTAGGAGGTTGTA 99 1
mmu-let-7e_precursor GATCTGAGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTTT 17 3
mmu-let-7e_precursor TGAGGTAGGAGGTAGTATAGTTG 31 1
mmu-let-7e_precursor GAGGTAGGAGATTGTATAGT 2 3
mmu-let-7e_precursor GNGGTAGGAGGTTGTATAGTTG 8 1
mmu-let-7e_precursor GNGGTAGGAGGTTGTATAGTTA 10 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTCG 9 1
mmu-let-7e_precursor GAGGTAGTAGGTTGTATAGTTG 110 4
mmu-let-7e_precursor TGAGGTAGGTGGTTGTATAGTT 6 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATATTTGA 2 2
mmu-let-7e_precursor TGGGGTAGGAGGTTGTATGGTT 7 5
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTTG 189 1
mmu-let-7e_precursor TNAGGTAGGAGTTTGTATAGTT 8 1
mmu-let-7e_precursor TGAGGTAGCAGGNTGTATAGTT 2 3
mmu-let-7e_precursor TGNGGTAGGATGTTGTATAGTT 3 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGT 80 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGATG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGATT 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGT 101 1
mmu-let-7e_precursor GNGGTAGGAGGTTGTATAGTTGA 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATATTA 2 1
mmu-let-7e_precursor NGAGGTAGGAGGTTGTATAG 3 1
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGTTGT 4 1
mmu-let-7e_precursor TGAAGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor TGACGTAGTAGGTTGTATAGTTG 10 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGNT 4 1
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTATAGT 4 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTN 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTG 23929 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTC 225 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTT 4731 3
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTG 88 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTA 21 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTT 15 4
mmu-let-7e_precursor CTGAGGTAGNAGGTTGTATGGTT 2 3
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTTA 10 2
mmu-let-7e_precursor NGAGGTAGTAGGTTGTATAGTTGA 6 2
mmu-let-7e_precursor TGATCTAGGAGGTTGTATAGT 2 5
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGT 13 3
mmu-let-7e_precursor TGNGGTAGGAGGTTGTAT 5 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTTAA 9 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATATTTG 2 1
mmu-let-7e_precursor TGGGTAGGAGGTTGTATAGTT 3 2
mmu-let-7e_precursor GGGGTAGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGTAGGTTGNATAGTTG 56 4
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACT 4 1
mmu-let-7e_precursor GNGGTAGGAGGTTGTATAGTT 18 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTG 8 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTC 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTTA 32 3
mmu-let-7e_precursor TGTGGTAGGAGGTTGTATAGTTGT 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTNTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTA 5716 1
mmu-let-7e_precursor TGAGGGAGAAGGTTGTATAGTT 2 3
mmu-let-7e_precursor TGAGGTAGTATGTTGTATAGTTG 3 5
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGT 7 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTT 72 1
mmu-let-7e_precursor TGAGGGAGNAGGTTGTATAGTT 11 3
mmu-let-7e_precursor GAGNTAGGAGGTTGTATAGTT 8 1
mmu-let-7e_precursor GGTAGTAGGTTGTATAGTTGA 4 2
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTTA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTTG 5 1
mmu-let-7e_precursor GGAGGTTGTATAGT 16 12
mmu-let-7e_precursor TGAGGAAGGAGGTTGTATAGTAG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTAAA 37 1
mmu-let-7e_precursor TGATGGAGGAGGTTGTATAGTT 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATCGTT 6 1
mmu-let-7e_precursor GAGGTAGGAGGTCGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATAGTAGA 48 2
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTTAA 5 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTA 40 1
mmu-let-7e_precursor TGAGGTAGTAGGTAGTATAGTTG 12 4
mmu-let-7e_precursor TGAGGTAGGAGGNTGTATAGTTGA 51 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTT 241 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAG 21 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAT 27 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTAA 87 3
mmu-let-7e_precursor TGAGGTAGNAGGTTGTATAGTT 57 3
mmu-let-7e_precursor TGAGATAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGT 49 1
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGA 2 6
mmu-let-7e_precursor TGAGGTAGAAGGTTGTATAGTT 55 3
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTG 61 1
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTT 11 4
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTTA 12 2
mmu-let-7e_precursor GAGGTAGGAGGTTNTATAGTT 4 1
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGT 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTAG 2 1
mmu-let-7e_precursor GGAGGTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGGATAGTT 4 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGA 4 2
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGT 103 1
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGTTG 4 1
mmu-let-7e_precursor TGGTAGGAGGTTGTATAGTTA 4 4
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTTGAA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGGATAGTTG 4 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATACTTG 2 4
mmu-let-7e_precursor TGAGGTAGGAGGTNGTATAGTTAA 12 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTAA 3 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAG 10 1
mmu-let-7e_precursor TCAGGTAGGAGGTTGTATAGTT 62 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGT 3036 1
mmu-let-7e_precursor TGAGNTAGGAGATTGTATAGTT 9 3
mmu-let-7e_precursor TGAGGTAGGAGTCTGTATAGTT 3 2
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTAG 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTT 290 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTA 3 2
mmu-let-7e_precursor TGAGGTAGGAGGTGGTATAGTT 50 1
mmu-let-7e_precursor TAGNAGGTTGTATAGTT 8 3
mmu-let-7e_precursor GAGGTAGGAGGTNGTATAGTTGA 2 1
mmu-let-7e_precursor TNAGGTAGGACGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTGT 4 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTATG 2 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTT 309 1
mmu-let-7e_precursor GANGTAGGAGGTTGTATAGTTG 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATCGTTG 3 7
mmu-let-7e_precursor TGAGGTCGGAGGTTGTATAGTTG 4 1
mmu-let-7e_precursor TGAGGTAGGAAGTTGTATAGTTG 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATGGTT 18 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGAT 10 1
mmu-let-7e_precursor GGTAGGAGGTTGTATAGTT 25 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTG 949 1
mmu-let-7e_precursor TNAGGTAGGAGGTTGTATAGTTT 208 3
mmu-let-7e_precursor GAGTTAGGAGGTTGTATAGT 2 1
mmu-let-7e_precursor CTGAGGTAGTAGGTTGTATAGTTA 9 3
mmu-let-7e_precursor GGAGGTTGTATAGTTG 6 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAGA 3 10
mmu-let-7e_precursor GNGGTAGTAGGTTGTATAGTTG 5 4
mmu-let-7e_precursor TAGGAGGTTGTATAGTTT 10 8
mmu-let-7e_precursor TAGGAGGTTGTATAGTTA 3 4
mmu-let-7e_precursor AGAGGTAGGAGGTTGTATAGTTG 17 1
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTA 3 5
mmu-let-7e_precursor TGAGGTAGCAGGTTGTATAGTT 141 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTCTAGT 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTCTGGTT 2 9
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTTG 6 1
mmu-let-7e_precursor TGAGGTTGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATAGTTAA 5 1
mmu-let-7e_precursor TGAGNTAGAAGGTTGTATAGTT 4 3
mmu-let-7e_precursor GNGGTAGGAGGTTGTATAGTTT 3 4
mmu-let-7e_precursor TGAGTTAGGAGGTNGTATAGT 2 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTC 2 1
mmu-let-7e_precursor TGCGGTAGGAGGTTGTATAGTTG 186 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAAT 11 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAAA 9 8
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATGGT 6 3
mmu-let-7e_precursor TGAGGTAGGAGGATGTATAGTT 24 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTGAA 3 2
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTTGA 41 1
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAGTTGT 17 1
mmu-let-7e_precursor TGAGGTGGGAGGTTGTATAGT 7 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGAATAGT 6 1
mmu-let-7e_precursor GGAGGTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTA 69 1
mmu-let-7e_precursor TGAGGCAGGAGGTTGTATGGTT 2 7
mmu-let-7e_precursor TGAGNTAGTAGGTTGTATAGTTG 48 4
mmu-let-7e_precursor NGAGGTAGGAGGTGGTATAGTT 2 1
mmu-let-7e_precursor AGTAGGTTGTATAGTTGA 2 6
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGT 34 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGA 61 1
mmu-let-7e_precursor TGAGGTTGTAGGTTGTATAGTTG 2 4
mmu-let-7e_precursor TGAGGTAGGANCTTGTATAGTT 26 1
mmu-let-7e_precursor AGGTAGGAGGTTGTATAGTTGA 2 1
mmu-let-7e_precursor GAGGTAGGAGGTTGGATAGTT 2 1
mmu-let-7e_precursor GANGTAGGAGGTTGTATAGT 2 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTGA 5 1
mmu-let-7e_precursor TGAGGTAGGATGTTGTATAGTTGT 4 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAA 34 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGTAT 208 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTCG 3 3
mmu-let-7e_precursor TGAGGTAGNATGTTGTATAGTT 9 3
mmu-let-7e_precursor GGTAGAAGGTTGTATAGTT 5 4
mmu-let-7e_precursor GAGNTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor GAGGTTGTATAGTT 20 15
mmu-let-7e_precursor TGATGTAGTAGGTTGTATAGTTG 12 5
mmu-let-7e_precursor TGCGGTAGGAGGTTGCATAGTTG 10 1
mmu-let-7e_precursor GAGGTAGGAGGTTATATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAC 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTGAAA 8 1
mmu-let-7e_precursor AGAGGTAGTAGGTTGTATAGTTGA 2 2
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTTGA 21 1
mmu-let-7e_precursor TGANGTAGGAGGTTGTATAGTTGT 11 1
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTTG 59 1
mmu-let-7e_precursor GNTAGGAGGTTGTATAGTT 2 1
mmu-let-7e_precursor TGGGTAGGAGGTTGTATAGT 2 10
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTT 43 4
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAGTTC 6 1
mmu-let-7e_precursor TGNGGTAGGAGGTTGTATAG 15 1
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAGTTAA 6 1
mmu-let-7e_precursor GGGGTAGGAGGTTGTATAGTT 6 2
mmu-let-7e_precursor TGTAGGAGGTTGTATAG 2 18
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTTTG 3 4
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGT 2 1
mmu-let-7e_precursor GAGGTCGGAGGTTGTATAGTT 4 1
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAGTTAA 3 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAGT 26 3
mmu-let-7e_precursor TGAGGTAGGANTTTGTATAGTTGA 4 1
mmu-let-7e_precursor GAGGTAGGAGGTTGTATAGTTGAA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGTTG 9 1
mmu-let-7e_precursor TGAGGTAGGAGGTTTTATAGTTA 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTCTATAGTTT 4 5
mmu-let-7e_precursor TGAGGTAGGAGGTTGAATAGTT 12 1
mmu-let-7e_precursor TAGGTAGGAGGTTGTATAGTTAA 5 3
mmu-let-7e_precursor TGATGTAGGAGGTTGTATA 2 4
mmu-let-7e_precursor GATGTAGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor GATGTAGGAGGTTGTATAGTTT 2 4
mmu-let-7e_precursor TGAGGTATGAGGTTGTATAGTT 27 1
mmu-let-7e_precursor GAGGTAGGAGGTNGTATAGTT 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTTC 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTTG 192 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTTA 41 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGNATAGTTT 37 3
mmu-let-7e_precursor TGAGGTAGGANGTTGTATAGTTGA 5 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATACTT 14 1
mmu-let-7e_precursor TGAGGGAGGAGGTTGTATAA 2 17
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTA 2 3
mmu-let-7e_precursor TGAGGTAGGNGGTTGTATAGTT 288 1
mmu-let-7e_precursor GAGNTAGGAGGTTGTATAGT 2 1
mmu-let-7e_precursor TAAGGTAGGAGGTTGTATAGTAG 2 2
mmu-let-7e_precursor TGAGGTAGGAGGTTGCATAGTTGA 3 1
mmu-let-7e_precursor TGAGGTAGGAGGNTGTAT 2 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATAGTTAAGA 4 2
mmu-let-7e_precursor TGAGGTAGGAGTTTGTATAG 3 2
mmu-let-7e_precursor TGAGGTAGGAGCTTGTATAGTAG 2 1
mmu-let-7e_precursor TGNGGTAGGAGTTTGTATAGTT 3 1
mmu-let-7e_precursor TGAGGTAGTAGGTTGTATATTTG 30 4
mmu-let-7e_precursor GGTAGCAGGTTGTATAGTT 5 3
mmu-let-7e_precursor TGAGNTAGGAGGTTGTATAG 9 1
mmu-let-7e_precursor GAGGTTGGAGGTTGTATAGTTG 2 1
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTA 3 3
mmu-let-7e_precursor TGAGGTAGGAGGTTGTATGGTT 447 3
mmu-let-7e_precursor TGAGGTAGGAGGCTGTATAGTTAA 7 1
mmu-let-7e_precursor TGAGGTAGGAGGGTGTATGGTT 2 6
mmu-let-7e_precursor TTAGGTAGGAGGTTGTATAGTT 75 1
mmu-let-7e_precursor TGAGGTAGGAGATTGTATAG 2 3