id_rna sequence raw_count mapping_loci
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCCT 10 1
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCC 4 1
mmu-let-7f-1-3p CTATACAATCTATTGCCTTCCA 2 1