Forgot password? Reset it!

 Back to Results Overview 

Results for Project: Zhang_et_al_Arabidopsis (575f8bad7e9f)


Condition: HRCC - Phenotype: hrcc_r1_fastq
Filter:

Download complete Table · Download complete Table (decimal-comma)
id raw_count normalized_mapping_loci type most_prominent_tag
sequence
most_prominent_tag
raw_count
most_prominent_tag
mapping_loci
Alignment of
all sequences
Add to
favorites
ath-snoRNA-snoR9_plant-chr4-15013923-15014032 2 0.1 snoRNA TGATGATGCTGAC 2 20
ath-snoRNA-snoR9_plant-chr4-4290542-4290670 2 0.1 snoRNA TGATGATGCTGAC 2 20
ath-snoRNA-snoR9_plant-chr4-4291052-4291180 2 0.1 snoRNA TGATGATGCTGAC 2 20
ath-snoRNA-snoR9_plant-chr4-4291562-4291690 2 0.1 snoRNA TGATGATGCTGAC 2 20
ath-snoRNA-snoR9_plant-chr5-17867886-17867996 2 0.1 snoRNA TGATGATGCTGAC 2 20
ath-snoRNA-snoU61-chr1-11684800-11684879 8 0.242424 snoRNA GTTGACGGCAA 8 33
ath-snoRNA-snoZ102_R77-chr3-21559241-21559324 28 16.0 snoRNA CGATATGATGGCA 24 2
ath-snoRNA-snoZ105-chr3-18893239-18893308 7 3.5 snoRNA CATGATGAGGATTGTTT 3 2
ath-snoRNA-snoZ105-chr5-26567659-26567729 7 3.5 snoRNA CATGATGAGGATTGTTT 3 2
ath-snoRNA-snoZ107_R87-chr5-20795719-20795831 6 6.0 snoRNA TGGCAGTGATGACTCGGAA 3 1
ath-snoRNA-snoZ107_R87-chr5-24782696-24782802 2 0.0606061 snoRNA GCGTGTGTCG 2 33
ath-snoRNA-snoZ152-chr4-8460055-8460150 2 0.333333 snoRNA ATGCAATGATGAGA 2 6
ath-snoRNA-snoZ152-chr4-8712719-8712814 2 0.333333 snoRNA ATGCAATGATGAGA 2 6
ath-snoRNA-snoZ157-chr3-7682357-7682458 5 0.892857 snoRNA TGGGGCGTAGAAAAG 3 4
ath-snoRNA-snoZ266-chr3-3628016-3628106 2 2.0 snoRNA ATGGATGATGATTCAAT 2 1
ath-snoRNA-snoZ266-chr5-1867732-1867838 7 5.33333 snoRNA GAGAATGATGAACCAAT 5 1
ath-snoRNA-snosnR60_Z15-chr3-8979061-8979158 2 2.0 snoRNA TCAAGTGATGATTGATAACGCAT 2 1
ath-tRNA-chr1-10089437-10089508 14 0.419547 tRNA TTTCTCGGAATGCCCC 4 48
ath-tRNA-chr1-10089898-10089969 13 0.898972 tRNA GGGCATTTGGTCTAGNGGTA 3 47
ath-tRNA-chr1-10090368-10090439 23 0.498006 tRNA TTTCTCGGAATGCCCC 4 48

previous 26 of 52 next